Recombinant human erythropoietin treatment protects the cardio-renal axis in a model of moderate chronic renal failure

Figures & data

Table 1.  Genes of interest and endogenous controls used in the present RT-qPCR study

Gene symbol	Gene name	GenBank number	Forward primer sequence (5′–3′)	Reverse primer sequence (5′–3′)	Amplicon length (bp)
EPO	Erythropoietin	NM_017001	aaagcttgccctgtgtgg	Ctgccggaactgtaatcca	67
Casp9	Caspase 9	NM_031632	gagcatccatctgtgccata	cgtggtggtcatcctctctc	81
Vegf	Vascular endothelial growth factor	NM_031836	tttctccgctctgaacaagg	aaaaacgaaagcgcaagaaa	63
Actb	Actin beta	NM_031144	Primers from geNorm Housekeeping Gene Selection kit
Gapdh	Glyceraldehyde-3-phosphate dehydrogenase	NM_017008
Top1	Topoisomerase I	NM_022615

Table 2.  Effects of rhEPO treatment in renal and hematological data in a rat model of moderate CRF

	Initial time (0 weeks)	Final time (15 weeks)
Parameters	Before 3/4 nephrectomy	No surgery		3/4 Nephrectomy
	All the rats	Controls	rhEPO	CRF	CRF + rhEPO
Renal data
Creatinine (μmol/L)	36.24 ± 1.78	39.78 ± 1.77	38.90 ± 2.64	80.44 ± 5.30**	64.53 ± 2.65***
Urea (mmol/L)	14.63 ± 0.24	13.93 ± 0.56	13.78 ± 0.61	24.21 ± 1.01	22.49 ± 0.99
Uric acid (μmol/L)	35.69 ± 3.57	36.88 ± 9.52	49.37 ± 8.33	28.55 ± 5.35	36.88 ± 5.95
Hematological data
EPO (pg/mL)	23.05 ± 0.88	22.25 ± 1.00	35.75 ± 10.11	19.43 ± 3.05	24.18 ± 2.12
RBC (×10^12/L)	7.32 ± 0.12	7.44 ± 0.10	6.84 ± 0.38	6.91 ± 0.14	7.83 ± 0.94
Hematocrit (L/L)	0.395 ± 0.005	0.409 ± 0.007	0.361 ± 0.017	0.395 ± 0.006	0.439 ± 0.056
Hb (g/L)	138.21 ± 1.42	139.44 ± 3.61	128.72 ± 5.29	134.39 ± 2.01	148.81 ± 17.20

Note: Results are means ± SEM of 7 rats for each group: *p < 0.05 and **p < 0.01 versus the control group; ***p < 0.05 versus the CRF group. EPO, erythropoietin; RBC, red blood cell; Hb, hemoglobin.

Table 3.  Effects of rhEPO treatment on blood pressure, body and tissue weights, and peripheral catecholamine measures in a rat model of moderate CRF, at the final time (15 weeks)

	No surgery		¾ Nephrectomy
	Control	rhEPO	CRF	CRF + rhEPO
Blood pressure
SBP (mmHg)	114.88 ± 3.08	135.96 ± 3.07***	143.07 ± 4.61***	139.71 ± 3.33
DBP (mmHg)	99.11 ± 1.76	109.55 ± 4.51	123.31 ± 12.38**	113.21 ± 0.96
MBP (mmHg)	104.33 ± 1.89	117.78 ± 3.80**	129.64 ± 9.79***	121.69 ± 0.78
Body and tissue weights
BW (kg)	0.47 ± 0.02	0.49 ± 0.02	0.46 ± 0.01	0.48 ± 0.03
HW (g)	1.21 ± 0.03	1.37 ± 0.11	1.46 ± 0.06	1.48 ± 0.08
KW (g)	1.24 ± 0.04	1.28 ± 0.06	1.94 ± 0.20	2.21 ± 0.47
Catecholamine measures
Plasma NE (nmol/L)	8.21 ± 2.25	27.42 ± 3.13***	17.32 ± 2.30	13.24 ± 1.42
Plasma E (pmol/L)	4859.4 ± 1037.4	9828 ± 1856.4	7753.2 ± 1856.4	4531.8 ± 1146.6****
Platelet NE (nmol/L)	3.19 ± 0.59	3.19 ± 0.53	2.01 ± 0.24	1.12 ± 0.18
Platelet E (pmol/L)	1419.6 ± 382.2	1201.2 ± 54.6	491.4 ± 54.6**	764.4 ± 109.2
Adrenals NE (μg/g)	159.17 ± 22.93	152.82 ± 19.73	143.77 ± 16.6	114.93 ± 12.51
Adrenals E (μg/g)	579.57 ± 11.81	663.61 ± 56.99	315.89 ± 34.7	563.14 ± 83.02****

Note: Results are means ± SEM (seven rats per group): *p < 0.05, **p < 0.01, and ***p < 0.001 versus the control group; ****p < 0.05 versus the CRF group. BW, body weight; DBP, diastolic blood pressure; E, epinephrine; HW, heart weight; KW, kidney weight; MBP, mean blood pressure; NE, norepinephrine; SBP, systolic blood pressure.

Figure 1. Effects of rhEPO treatment on heart rate and left ventricle sympathetic nervous system activity in a rat model of moderate CRF, at the final time: heart rate (A) and left ventricle content in norepinephrine (B) and epinephrine (C). Results are means ± SEM (seven rats per group): ^ap < 0.05 and ^aaap < 0.001 versus the control group; ^bp < 0.05 versus the CRF group.

Figure 2. Effects of rhEPO treatment on trophism/proliferation markers: heart/body weight (A); kidney/body weight (B); and serum-transforming growth factor-1beta (C) in a rat model of moderate CRF, at the final time. Results are means ± SEM (seven rats per group): ^ap < 0.05 versus the control group; ^bp < 0.05 versus the CRF group.

Figure 3. Relative kidney gene expression quantification for erythropoietin (A); Caspase 9 (B); and Vegf (C) in rhEPO, CRF, and CRF + rhEPO groups comparatively to control group (zero line). Results are means ± SEM (seven rats per group): ^ap < 0.05 versus the control group; ^bp < 0.05 versus the CRF group.