Ameliorative effects of pentoxifylline on NOS induced by diabetes in rat kidney

Figures & data

Table 1. Sequences of primers and ID numbers of UPL probes used for qRT-PCR.

Organism	Gene symbol	Gene description	Assay ID	Forward primer sequence	Reverse primer sequence	UPL probe no.
R. norvegicus	GapdH	Glyceraldehyde-3-phosphate dehydrogenase	502303	AAAGCTGTGGCGTGATGG	TTCAGCTCTGGGATGACCTT	26
R. norvegicus	Nos1	Neuronal nitric oxide synthase	505837	CGTCCGTGACTACTGTGACAA	TGTCCAAATCCATCTTCTTGG	65
R. norvegicus	Nos2	Inducible nitric oxide synthase	503518	AGAAGGGGACGAACTCAGC	TCGAACATCGAACGTCTCAC	26
R. norvegicus	Nos3	Endothelial nitric oxide synthase	500228	TGACCCTCACCGATACAACA	CGGGTGTCTAGATCCATGC	5
R. norvegicus	Actb	Beta actin	500152	CTAAGGCCAACCGTGAAAAG	GCCTGGATGGCTACGTACA	115

Table 2. Body weight and blood glucose at beginning and end of the experiment.

	Beginning body weight (g)	Final body weight (g)	Beginning blood glucose (mg/dL)	Final blood glucose (mg/dL)
Group C	170.22 ± 9.56	279.85 ± 10.94	109.88 ± 3.91	118.57 ± 4.37
Group D	167.88 ± 9.89	195.88 ± 13.35*	103.55 ± 1.93	561.66 ± 25.48*
Group D + PI	165.11 ± 4.00	218.25 ± 21.67	112.66 ± 4.48	540.37 ± 28.38*
Group D + PII	160.44 ± 6.39	199.14 ± 11.04*	106.88 ± 4.82	512.42 ± 44.44*
Group P	163.77 ± 8.04	301.77 ± 13.66	113.88 ± 3.13	114.44 ± 4.80

Notes: Group C: control, Group D: diabetic; Groups D + PI and D + PII: diabetes + pentoxifylline, Group P: pentoxifylline. Values are expressed as mean ± SE.

* p<0.05 compared to Group C.

Table 3. Kidney weight and apoptotic index of rats.

	Kidney weight (g)	Apoptotic index
Group C	1.09 ± 0.02	18.06 ± 2.64
Group D	1.06 ± 0.04	30.30 ± 2.76*
Group D + PI	1.05 ± 0.04	18.05 ± 1.90**
Group D + PII	1.05 ± 0.04	13.00 ± 1.71**
Group P	1.08 ± 0.02	16.40 ± 1.85**

Notes: Group C: control, Group D: diabetic; Groups D + PI and D + PII: diabetes + pentoxifylline, Group P: pentoxifylline. Values are expressed as mean ± SE.

* p<0.05 compared to Group C.

** p<0.05 compared to Group D.

Figure 1. Light microscopy of kidney tissues is seen in different groups. (A) In controls, normal kidney architecture is observed. (B) Group D, transparent tubules (*) are detected. (C) Group D, dilatation in distal tubules (*) and epithelial desquamation into the lumen of tubules (arrow) are seen. (D) Group D + PI, transparent tubules (*) are exhibited. (E) Group D + PII, transparent tubules (*) are shown. (F) Group P, normal kidney architecture is observed. Kidney cross sections were stained with Masson’s Trichome.

Figure 2. Immunohistochemical localization and histoscore of neuronal, inducible and endothelial NOS expression of the kidney tissue are seen in the different groups (A) Group C, (B) Group D, (C) Group D + PI, (D) Group D + PII, (E) Group P, and (F) Negative controls.

Figure 3. TUNEL staining of kidney tissues are seen. (A) Group C, (B) Group D, (C) Group D + PI, (D) Group D + PII, (E) Group P and (F) Negative controls. TUNEL-positive cells (arrow) are mainly observed in the cells of distal tubules.

Figure 4. Neuronal, inducible and endothelial NOS mRNA/β-Actin mRNA levels of the kidney tissue are seen in the different groups.