Membrane topology of the cyanobacterial bicarbonate transporter, SbtA, and identification of potential regulatory loops

Figures & data

Table I. Primers used for generating SbtA (6803) phoA/lacZ constructs.

Fusion	Type	Reverse primer used (if applicable)
S5	ExoIII digest	NA
I29	ExoIII digest	NA
V37	ExoIII digest	NA
A41	ExoIII digest	NA
T44	ExoIII digest	NA
N64	PCR	GGATCTAGAGTTCCGAATTGCCATGC
A93	PCR	TTTTCTAGAAGCCAGGGTAAAACGGGC
T100	PCR	CACTCTAGAGGTTCTGACGTTAGGCAGTT
E127	PCR	TGATCTAGATTCTTCCAACGTAGTGAGGG
A138	ExoIII digest	NA
A167	PCR	AGCTCTAGAAGCAGACTTACGTTTTCTCTTATTGA
G187	ExoIII digest	NA
W212	PCR	TGGTCTAGACCAGATTTTGACCCGATTAT
Y247	PCR	TTCTCTAGAATAGACACTTTCCGGCTTGGT
A277	PCR	TTGTCTAGAAGCTACTTTACGTAGTTCACCAA
H303	PCR	TATTCTAGAGTGGGCAATCATACCAAGAC
S323	ExoIII digest	NA
G328	PCR	AGGTCTAGACCCGGAGATATCAGAGCTA
G346	PCR	TGATCTAGAACCGATATAGGCAGAGGGGT
I351	ExoIII digest	NA
G374	ExoIII digest	NA
	Forward primer	TTCAGGGCCAGGATCCACTACC (BamH1)
	Reverse primer	CAGACCATAAACTATTTCTAGATAACCTG (XbaI)

Table II. Enzyme activities of SbtA dual reporter fusions.

Indicator screen	Fusion clone	Alkaline phosphatase data		β-Galactosidase data		Ratio AP/BG	Scored location
		% of max	SD	% of max	SD
P	S5	8.9	2.2	39.8	12.2	0.22	Internal, ??
P	I29	74.7	11.3	74.9	7.0	1.00	??
P	V37	23.1	3.2	18.5	3.1	1.25	??
P	A41	46.9	7.1	47.1	7.2	1.00	??
P	T44	40.1	5.6	63.6	3.1	0.63	??
B	N64	75.1	9.4	4.9	5.4	15.18	External
R	A93	42.3	3.2	98.0	4.1	0.43	Internal
R	T100	1.2	0.6	98.7	7.9	0.01	Internal
P	E127	9.2	0.4	14.2	2.4	0.65	TMH
P	A138	15.2	0.3	6.8	1.2	2.24	External
R	A167	0.7	1.3	49.9	4.8	0.01	Internal
R	G187	0.2	0.6	100.0	3.6	0.00	Internal
R	W212	0.6	1.0	52.6	4.5	0.01	Internal
B	Y247	96.1	5.3	9.2	2.0	10.45	External
R	A277	0.3	0.1	87.3	12.9	0.00	Internal
B	H303	53.1	4.8	6.4	1.6	8.24	External
P	S323	20.0	1.4	27.5	4.7	0.73	TMH
P	G328	25.3	4.4	90.3	4.2	0.28	Internal
R	G346	8.0	0.2	16.9	0.8	0.48	Internal
R	I351	1.1	0.1	23.5	19.3	0.05	Internal
B	G374	100.0	3.2	3.4	0.7	29.28	External

Periplasmic fusions were scored as AP/BG ratios of greater than 2.2, cytoplasmic fusions where scored for ratios less than 0.5, TMH-located fusions 0.6–1.5. Fusions scored as ‘??’ resulted from an ambiguous location of the fusion (see Discussion); the maximum AP activity was for G374 at 5.361 OD₆₀₀/cell OD/h, while the maximum BG activity was found for fusion G187 to be 2.151 OD₆₀₀/cell OD/h. The first column (indicator screen) refers to the initial screening of constructs as colony colours when plated on dual indicator plates; these fell into three basic phenotypes of bluish (B), reddish (R) and a range of purple hewed (P) colonies.

Figure 1. Topology map of the Na⁺-dependent HCO₃ ^- transporter, SbtA, from Synechocystis PCC6803. Experimentally determined phoA/lacZ mapping positions are shown as black (internal), mid-grey (TMH located) or light grey (external) based on the scored locations in Table II (primarily based on AP/BG enzyme assay ratios); in the online version these are shown as blue, purple and red, respectively. The positions of positive charges on the inter-helical loops are also shown. This Figure is reproduced in colour in the online version of Molecular Membrane Biology. In addition, a Supplementary residue-based Figure (Supplementary Figure 1) is also provided online.

Figure 2. The locations of the ten TMHs in the SbtA from Synechocystis PCC6803 based on experimentally determined phoA/lacZ mapping positions and the SCAMPI-msa prediction model. ‘i’ refers to cytoplasmic domains, while ‘o’ refers to periplasmic domains and grey blocks denote TMH domains.

Figure 3. Alignment of the two halves of the 5 + 5 repeated structure of SbtA-6803. The region encompassing helices 1–5 aligned to the region encompassing helices 6–10 of SbtA.

Figure 4. Simple cartoon showing the inversion of each helix in the repeat (H6–10) relative to each helix in the H1–5 region.

Figure 5. Phylogenetic tree showing the relationship of the extended SbtA family (95 prokaryotic members shown). Protein sequences were aligned using ClustalW and organized into a phylogenetic tree using nearest neighbour-joining routines in MEGA4 software (www.megasoftware.net). The scale marker represents 0.05 substitutions per residue. A list of defined abbreviations is available in Supplementary Table I, available online. This Figure is reproduced in colour in the online version of Molecular Membrane Biology.

Figure 6. Alpha-helical wheel projections of the ten TMH helices from SbtA-6803. The N-terminal residue in each helix is located at 12 o'clock position each following residue precedes 100° clockwise. A central arrowhead indicates the face with the highest hydrophobic moment (HM); charge residues are highlighted with a star symbol. Hydrophilic (circles), hydrophobic (diamonds), negatively charged (triangles) and positively charged (pentagons) residues are shown. This Figure is reproduced in colour in the online version of Molecular Membrane Biology.

Figure 7. Weblogo representations of aligned helices 1–10 from the 22 member set of high probability SbtA homologs (Figure 5) and including the cytoplasmic loops H1–H2 and H9–H10 in the bottom panel. Conserved charge residues are highlighted with grey (yellow) arrowheads. Conserved S/T residues are indicated with asterisks (bottom panel). This Figure is reproduced in colour in the online version of Molecular Membrane Biology.