Early life infection alters adult BALB/c hippocampal gene expression in a sex specific manner

Figures & data

Table I.  Primer details for target and reference genes.

Target gene	Forward	Reverse
Oxytocin	TTGCTGCCTGCTTGGCTTA	GGAGACACTTGCGCATATCCA
Prolactin	TGGTTCTCTCAGGCCATCTTG	CAGATTGGCAGAGGCTGAACA
Vasopressin	TCGCCAGGATGCTCAACAC	CACTGTCTCAGCTCCATGTCAGA
CRH BP	AGCTGGAGCCATTCGAGCTA	TGCTGCCCATGAAGATCACA
Hypocretin	GCGCAGAGCTAGAGCCACAT	TGCTAAAGCGGTGGTAGTTACG
β-actin	AGAGGGAAATCGTGCGTGAC	CAATAGTGATGACCTGGCCGT

Table II.  Networks identified of genes differentially expressed in male adult mice after neonatal infection (bold indicates up-regulation).

ID	Molecules in network	Score	Focus molecules	Top functions
1	ACP5, AHR, ATF4, B2M, C5, C5AR1, CDKN1A, DCN, DUSP1, FAS, FCER1G, FCGR2A, FHL2, FOS, HSD11B1, IFITM2, IFNG, IL3, IL4, JUN, JUNB, KITLG, KLF2, LGALS1, MEF2C, MYH7, PLAU, PRDM1, PRKCB, RUNX2, SELP, SELPLG, STAT3, TNF, TNFSF11	21	14	Tissue morphology, cellular development, connective tissue development, and function
2	ARC, CREB1, CREM, DUSP14, FMR1, GPRIN1, SERTAD1, SIK1	6	4	Nervous system development and function, cellular compromise, and neurological disease
3	MITF, MYL4	2	1	Cellular development, embryonic development, and gene expression
4	KAP, PPIB	2	1	Drug metabolism, small molecule biochemistry, DNA replication, recombination, and repair
5	PLXNA1, TREM2	2	1	Cell-to-cell signaling and interaction, cellular function and maintenance, and genetic disorder

Figure 1.  Network 1 identified by IPA showing differentially expressed genes in male adult hippocampus after neonatal respiratory C. muridarum infection. Red shading indicates up-regulation of the gene. No color indicates genes that form the network and have no change in expression in the present study. Fourteen genes were differentially expressed and associated with tissue morphology, cellular development, and connective tissue development and function. For example, 11β-HSD1 gene expression was altered following male neonatal infection and was indirectly regulated by IL-4. For full names of genes involved in the network, see Table IV.

Table III.  Networks identified of genes differentially expressed in female adult mice after neonatal infection (bold indicates up-regulation; italic indicates down-regulation).

Network ID	Molecules in network	Score	Focus molecules	Top functions
1	AHCYL1, ATP6V0E2, B2M, C5, C5AR1, CD74, CSF2, DCTN1, FCER1G, FCGR2A, FMR1, FOXP3, HCN2, HLA-C, HLA-DQB2, HSPD1, HTT, IFNG, IL4, IL6, IL10, IL13, ITPR1, MBP, MYC, MYT1L, POU3F1, RGS14, RGS16, RHOA, STAT3, TGFB1, TLR4, TNF, TP53	13	13	Cell-to-cell signaling and interaction, hematological system development and function, and immune cell trafficking
2	AKAP9, BCAR1, CIT, CTNNB1, EGFR, FGF8, FNTA, FYN, GBX2, GRIK2, GRIN1, GRM1, MMP2, MMP14, MSX1, MTCH2, NR3C1, OTX2, PDIA3, PTP4A2, SEP15, SLC6A3, SRC, SUMOl, TGFB1I1, TRH, UGCG, WNT5A	11	11	Cell death, cellular movement, and cancer
3	AGRP, APBB1, ASS1, CEBPB, CYTB, EGFR, GPX1, GSK3B, HNRNPK, LEP, LEPR, MYH7, ND4, NF2, PPARGC1A, PRKCB, PRL, PSMB8, RORA, SOCS3, SRC, STAT1, STAT3, TNFSF11	9	9	Cellular growth and proliferation, cellular development, and genetic disorder
4	ADIPOQ, CEBPB, CIITA, CSF2, DDC, DLK1, FOS, FOXA1, FOXA2, GH1, GPC3, GRB10, IFNG, IL6, IL10, IL13, INSR, MMP2, MMP12, NNAT, PDPK1, PRKCB, PRKCD, PRKCE, SCNN1B, SELP, SELPLG, SERPINE1, STAT3, TGFB1, TH, THRB (includes EG:7068), TNF, TOP2A, YY1	9	10	Cellular movement, lipid metabolism, and molecular transport
5	SNRPN, UBE3A	1	1	Cellular function and maintenance, reproductive system development and function, and genetic disorder

Table IV.  Definitions of abbreviations used in figures and tables.

Abbreviation	Gene name
ACP5	Acid phosphatase 5, tartrate resistant
ADIPOQ	Adenylate cyclase 9
AGRP	Agouti-related protein homolog (mouse)
AHCYL1	Adenosylhomocysteinase-like 1
AHR	Aryl hydrocarbon receptor
AKAP9	A kinase (PRKA) anchor protein (yotiao) 9
APBB1	Amyloid beta precursor protein (cytoplasmic tail) binding protein 1
ASS1	Argininosuccinate synthetase 1
ATF4	Activating transcription factor 4 (tax-responsive enhancer element B67)
ATP6V0E2	ATPase, H^+ transporting V0 subunit e2
ARC	Activity-regulated cytoskeleton-associated protein
B2M	Beta-2-microglobulin
BCAR1	Breast cancer anti-estrogen resistance protein 1
C5	Complement component 5
C5AR1	Complement component 5a receptor 1
CD74	CD74 molecule, major histocompatibility complex, class II invariant chain
CDKN1A	Cyclin-dependent kinase inhibitor 1A (p21, Cip1)
CIT	Citron (rho-interacting serine/threonine kinase 21)
CIITA	Class II, major histocompatibility complex, transactivator
CREB1	cAMP responsive element binding protein 1
CREM	cAMP responsive element modulator
CSF2	Colony stimulating factor 2 (granulocyte-macrophage)
CTNNB1	catenin (catherin-associated protein), beta 1, 88 kDa
CYTB	Mitochondria encoded cytochrome B
DCN	Decorin
DCTN1	Dynactin 1 (p150, glued homolog, drosophila)
DDC	Dopa decarboxylase (aromatic l-amino acid decarboxylase)
DLK1	Delta-like 1 homolog (drosophila)
DUSP1	Dual specificity phosphatase 1
EGFR	Epidermal growth factor receptor
FAS	FAS (TNF receptor superfamily, member 6)
FCER1G	Fc fragment of lgE, high affinity I, receptor for, gamma polypeptide
FCGR2A	Fc fragment of IgG, low affinity IIa, receptor (CD32)
FGF8	Fibroblast growth factor 8 (acidic)
FHL2	Four-and-a-half LIM domains 2
FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog
FOXA1	Forkhead box Al
FOXA2	Forkhead box A2
FOXP3	Forkhead box P3
FMR1	Fragile × mental retardation 1
FNTA	Famesyltransferase, CAAX box, alpha
FYN	Proto-oncogene tyrosine-protein kinase
GBX2	Gastrulation brain homeobox 2
GH1	Growth hormone 1
GPC3	Glypican 3
GPRIN1	G protein regulated inducer of neurite outgrowth 1
GPX1	Glutathione peroxidase 1
GRB10	Growth factor receptor-bound protein 10
GRIK2	Glutamate receptor, ionotropic, kainate 2
GRIN1	Glutamate [NMDA] receptor subunit zeta-1
GRM1	Glutamate receptor, metabotropic 1
GSK3B	Glycogen, synthase kinase 3 beta
HCN2	Hyperpolarization-activated cyclic nucleotide-gated potassium channel 2
HLA-C	Major histocompatibility complex, class I, C
HLA-DBQ2	Major histocompatability complex, class II, DQ beta 1
HSD11B1	Hydroxysteroid (11-beta) dehydrogenase 1
HSPD1	Heat shock 60 kDa protein 1 (chaperonin)
HTT	Huntingtin gene
IFITM2	Interferon (alpha, beta, and omega) receptor 1
IFNG	Interferon, gamma
IL	Interleukin
INSR	Insulin receptor
ITPR1	Inositol 1,4,5-trisphosphate receptor type 1
JUN	Jun oncogene
JUNB	JunB proto-oncogene
KITLG	KIT ligand
KLF2	Kruppel-like factor 2 (lung)
LEP	Leptin
LEPR	Leptin receptor
LGALS1	Lectin, galactoside-binding, soluble, 1
MBP	Myelin basic protein
MEF2C	Myocyte enhancer factor 2C
MITF	Microphthalmia-associated transcription factor
MMP2	Matrix metalloproteinase 2
MMP12	Matrix metallopeptidase 12
MMP14	Matrix metallopeptidase 14
MSX1	MSH homeobox 1
MTCH2	Mitochondrial carrier homolog 2 (C. elegans)
MYC	Myc gene
MYL4	Myosin, light chain 4, alkali, atrial, embryonic
MYH7	Myosin, heavy chain 7, cardiac muscle, beta
MYT1L	Myelin transcription factor 1-like
NR3C1	Glucocorticoid receptor
ND4	NDH dehydrogenase subunit 4
NF2	Neurofibromin 2
NNAT	Neuronatin
OTX2	Orthodenticle homeobox 2
PDIA3	Protein disulfide isomerase associated 3
PDPK1	3-Phosphoinositide dependant protein kinase-1
PLAU	Plasminogen activator, urokinase
PLXNA1	Plexin A1
POU3F1	POU class 3 homeobox l
PPARGC1A	Peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
PPIB	Peptidylprolyl isomerase B (cyclophilin B)
PRDM1	PR domain containing 1, with ZNF domain
PRKCB	Protein kinase C, beta
PRKCD	Protein kinase C, delta
PRKCE	Protein kinase C, epsilon
PRL	Prolactin
PSMB8	Proteasome (prosome, macropain) subunit, beta type, 8
PTP4A2	Protein tyrosine phosphatase type IV A, member 2
RGS14	Regulator of G-protein signaling 14
RGS16	Regulator of G-protein signaling 16
RHOA	RAS homolog gene family, member A
RORA	RAR-related orphan receptor A
RUNX2	Runt-related transcription factor 2
SCNN1B	Sodium channel, non-voltage-gated 1, beta
SELP	Selectin P (granule membrane protein 140 kDa, antigen CD62)
SELPLG	Selectin P ligand
SEP_15	15 kDa selenoprotein
SERPINE1	Serine (or cysteine) peptidase inhibitor, clade E, member 1
SERTAD1	SERTA domain containing 1
SIK1	Salt-inducible kinase 1
SLC6A3	Solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
SOCS3	Suppressor of cytokine signaling 3
SNRPN	Small nuclear ribonucleoprotein N
SRC	Rous sarcoma oncogene
STAT	Signal transducer and activator of transcription
SUMOl	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
TGFB1	Transforming growth factor beta 1
TGFB1I1	Transforming growth factor beta 1 induced transcript 1
TH	Tyrosine hydroxylase
THRB	Thyroid hormon receptor beta
TLR4	Toll-like receptor 4
TNF	Tumor necrosis factor (TNF superfamily, member 2)
TNFSF11	Tumor necrosis factor (ligand) superfamily, member 11
TOP2A	Topoisomerase (DNA) II alpha
TP53	Tumor protein 53
TREM2	Triggering receptor expressed on myeloid cells 2
TRH	Thyrotropin-releasing hormone
UBE3A	Ubiquitin protein ligase E3A
UGCG	UDP-glucose ceramide glicosyltransferase
WNT5A	Wingless-related MMTV integration site 5A.
YY1	YY1 transcription factor

Figure 2.  Network 1 identified by IPA showing differentially expressed genes in female adult hippocampus after neonatal respiratory C. muridarum infection. Red shading indicates up-regulation of the gene. Gray shading indicates down-regulation. No color indicates genes that form the network and have no change in expression in the present study. Thirteen genes were differentially expressed after infection and were indirectly involved with cytokine regulation. For example, HLA DQB2 was increased following infection and identified to indirectly regulate IL-6 and IL-10. For full names of genes involved in the network, see Table IV.

Table V.  Direction of change in mRNA in microarray (fold change) and qRT PCR (relative abundance) with pairwise comparison across treatment for qRT PCR.

		Infection vs. control		Pairwise comparison
Gene	Sex	Fold change	qRT PCR	F	P
Prolactin	Male	–	–	5.29	0.03
	Female	↑	–	0.03	0.87
Vasopressin	Male	↓	↓	136.61	< 0.01
	Female	↑	↑	4.11	0.05
Hypocretin	Male	↓	↓	14.61	< 0.01
	Female	↑	↑	19.08	< 0.01
CRHBP	Male	↑	↓	1227.25	< 0.01
	Female	–	–	0.10	0.75
Oxytocin	Male	↓	↓	197.51	< 0.01
	Female	↑	–	3.1	0.87

Figure 3.  Expression of target mRNA relative to β-actin (log) in adult male and female hippocampus after neonatal respiratory infection with C. muridarum compared to sham-infected controls. The expression of (a) prolactin, (b) vasopressin, (c) hypocretin, (d) CRH-BP, and (e) oxytocin.