Dexamethasone-induced hepatic lipogenesis is insulin dependent in chickens (Gallus gallus domesticus)

Figures & data

Table I.  Gene-specific primers for the lipid metabolism enzyme of mRNAs.

Gene	GenBank accession no.	Primers sequences (5′ → 3′)	Orientation	Product size (bp)
ACC	NM_205505	aatggcagctttggaggtgt	Forward	136
		tctgtttgggtgggaggtg	Reverse
FAS	J03860	ctatcgacacagcctgctcct	Forward	107
		cagaatgttgacccctcctacc	Reverse
ME	NM204303	tgccagcattacggtttagc	Forward	175
		ccattccataacagccaaggtc	Reverse
LPL	NM205282	cagtgcaacttcaaccatacca	Forward	150
		aaccagccagtccacaacaa	Reverse
PPARγ	AF163811	ccagcgacatcgaccagtt	Forward	145
		ggtgatttgtctgtcgtctttcc	Reverse
GAPDH	NM_204305	ctacacacggacacttcaag	Forward	244
		acaaacatgggggcatcag	Reverse
ATGL	EU852334	tccttcaccttcagcgtcca	Forward	113
		agtgttgtcctccatctggtc	Reverse
LXRα	AJ507202	gtccctgaccctaataaccgc	Forward	185
		gtctccaacaacatcacctctatg	Reverse
SREBP-1	AY029224	gccctctgtgcctttgtcttc	Forward	130
		actcagccatgatgcttcttcc	Reverse
18SrRNA	AF173612	ataacgaacgagactctggca	Forward	130
		cggacatctaagggcatcaca	Reverse

Notes: ACC, acetyl-CoA carboxylase; ATGL, adipose triglyceride lipase; FAS, fatty acid synthase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; LPL, lipoprotein lipase; LXR, liver X receptors; ME, malic enzyme; PPARγ, peroxisome proliferator-activated receptor-γ and SREBP-1, sterol response element-binding protein 1.

Table II.  Effect of 3-d DEX treatment (DEX, 2 mg/kg BM) on BM gain (n = 3), feed intake (n = 3), and organ index (% of BM, n = 8) of broiler chickens.

	DEX	Pair-fed	Control	Probability
Body mass gain, g/d	− 44.0 ± 14.4^b	31.0 ± 7.8^a	42.0 ± 9.3^a	< 0.0001
Feed intake, g/d	101.3 ± 5.0^b	112.8 ± 4.0^b	131.8 ± 4.1^a	0.0075
Liver, %	3.15 ± 0.14^a	2.22 ± 0.14^b	2.13 ± 0.10^b	< 0.0001
Abdominal fat, %	1.45 ± 0.16	1.12 ± 0.10	1.15 ± 0.12	NS
Cervical fat, %	0.44 ± 0.03^a	0.31 ± 0.04^b	0.31 ± 0.04^b	0.04
Thigh fat, %	0.43 ± 0.05	0.33 ± 0.04	0.46 ± 0.05	NS

Notes: Values are mean ± SEM; the mean initial BM of experimental chickens was 1.73 ± 0.02 kg and ^a,bmeans in the same row with different superscripts differ significantly, P < 0.05, by ANOVA.

Table III.  Effect of 3-d DEX treatment (DEX, 2 mg/kg BM) on plasma metabolite and insulin concentrations of broiler chickens in fasting and fed states.

	DEX	Pair-fed	Control	Probability
Fasting
Glucose, mmol/l	12.28 ± 1.58	9.96 ± 0.30	9.93 ± 0.49	NS
TG, μmol/l	0.30 ± 0.06^a	0.05 ± 0.02^b	0.11 ± 0.03^b	0.0014
NEFA, μmol/l	770.7 ± 118.9	763.6 ± 69.9	827.7 ± 166.1	NS
VLDL, abs	0.13 ± 0.03^a	0.03 ± 0.01^b	0.04 ± 0.01^b	0.0046
Urate, mg/l	55.39 ± 5.94^a	35.15 ± 4.27^b	25.58 ± 2.26^b	0.0004
Insulin, μIU/ml	13.83 ± 1.43^a	8.89 ± 1.03^b	8.77 ± 1.17^b	0.013
LPL,U/ml	22.58 ± 2.80^a	12.23 ± 1.62^b	14.39 ± 1.31^b	0.0006
Fed
Glucose, mmol/l	23.9 ± 2.7^a	10.5 ± 0.5^b	9.9 ± 0.4^b	< 0.0001
TG, μmol/l	0.664 ± 0.15^a	0.242 ± 0.07^b	0.492 ± 0.10^b	0.043
NEFA, μmol/l	812.8 ± 98.6	595.1 ± 98.9	661.3 ± 97.3	NS
VLDL, abs	0.18 ± 0.03^a	0.05 ± 0.01^b	0.08 ± 0.02^b	0.0005
Urate, mg/l	86.42 ± 8.97^a	32.04 ± 3.54^b	38.60 ± 4.47^b	< 0.0001
Insulin, μIU/ml	17.82 ± 2.75^a	11.47 ± 1.50^b	10.68 ± 1.63^b	0.046

Notes: LPL, lipoprotein lipase; NEFA, non-esterified fatty acids; TG, triglyceride; VLDL, very low-density lipoprotein; values are means ± SEM (n = 8); NS, not significant and ^a,bmeans within the same row with different superscripts differ significantly, P < 0.05, by ANOVA.

Figure 1.  Effects of 3-d DEX treatment (DEX, 2 mg/kg BM) on the hepatic expression of mRNAs for ACC, FAS, and ME in broiler chickens in fasting (A) and fed states (B) Values were determined in duplicate for each sample; values are means ± SEM (n = 8); ^a–bmeans with different letters differ significantly, P < 0.05, by ANOVA.

Figure 2.  Effects of DEX and insulin treatment on the expression of mRNAs for ACC, FAS, ME, LXR, and SREBP-1 in hepatocytes cultured in vitro. Values were determined in duplicate for each sample; values are means ± SEM (n = 8); ^a–bmeans with different letters differ significantly, P < 0.05, by ANOVA.