Transit Time Affects the Community Stability of Lactobacillus and Bifidobacterium Species in an In Vitro Model of Human Colonic Microbiotia

Figures & data

Figure 1. Schematic representation of the semi-continuous colon model fermentation system derived from the computer-controlled human dynamic gastrointestinal tract [16]. The fermentor is continuously magnetically stirred. Temperature of the culture system is kept constant at 37 °C by the flow of hot water in the double-jacketed vessel. pH is computer controlled at 6.4. Portholes allow for the addition of food solution and the removal of the culture solution. Anaerobic atmosphere is maintained by the flush of nitrogen.

Table 1. Retention time during fermentation 1, 2, and 3 as determined by operating parameters.

Fermentation	1	2	3
Culture system volume - Cv [mL]	600	600	600
Retention volume - Rv [mL]	200	150	100
Rv/Cv	0,333	0,250	0,167
Time period [h]	24	24	24
Dilution rate [h^−1]	0,014	0,010	0,010
Retention time [h]	72	96	144

Table 2. PCR primers used to analyze Bifidobacteria, Lactobacilli, and total bacteria.

PCR assay (amplicon size)	Oligonucletotide sequence (5′→ 3′)	Reference
Bifidobacterium sp. (520 bp)	F: 5′- GGGTGGTAATGCCGGATG -3′	[24]
	R: 5′- CCACCGTTACACCGGGAA -3′
Lactobacillus sp. (341 bp)	F: 5′- AGCAGTAGGGAATCTTCCA -3′	[23]
	R: 5′- CACCGCTACACATGGAG -3′
Total bacteria (233 bp)	F: 5′- ACTCCTACGGGAGGCAGCAG -3′	[22]
	R: 5′- ATTACCGCGGCTGCTGG -3′

Table 3. Comparison of the cell viability of Lactobacilli and Bifidobacteria in the presence of other intestinal bacterial groups during fermentation 1 (Rt = 72 h), 2 (Rt = 96 h), and 3 (Rt = 144 h) to available human colon data. Mean log viable count and standard deviation were calculated from plate counts between day 0 and day 35. Clinical data are presented as the range of the average composition of the adult ecosystem [9]

Bacterial group	Fermentation 1 (Rt : 72h) [log CFU mL^−1]	Fermentation 2 (Rt : 96 h) [log CFU mL^−1]	Fermentation 3 (Rt : 144 h) [log CFU mL^−1]	Data from literature on human colon microbiota [9] [log CFU mL^−1]
Total bacteria	7.82 ± 0.22	7.48 ± 0.42	8.01 ± 0.49	10–12
Enterococci	6.46 ± 0.79	4.66 ± 0.99	4.93 ± 0.57	5–10
Staphylococci	5.47 ± 0.45	4.47 ± 0.43	4.33 ± 0.17	4–6
Bifidobacteria	6.24 ± 0.64	6.01 ± 0.84	6.92 ± 0.65	8–11
Lactobacilli	4.03 ± 0.26	4.23 ± 0.26	3.61 ± 0.31	6–8
Clostridia	5.56 ± 1.15	5.86 ± 1.16	5.65 ± 0.28	6–9

Figure 2. Percentage bacterial cell variability, computed as the variation coefficient calculated from plate counts, of Lactobacilli (A) and Bifidobacteria (B) during fermentation 1 (Rt : 72 h), 2 (Rt : 96 h), and 3 (Rt : 144 h) between day 0 and day 5, 10, 15, 25, and 35.

Figure 3. PCR analysis of the inoculum samples per group analyzed (Bifidobacteria, Lactobacilli and total bacteria) and fermentation 1 (Rt: 72 h), 2 (Rt: 96 h), and 3 (Rt: 144 h) on days 0, 15, and 35 (A). Abbreviations: L - Ladder; NTC - Non template control. The graphs (B: Bifidobacteria and C: Lactobacilli) are the semi-quantitative representation of the band intensities PCR products as analyzed by Image J software. The band intensities of the PCR products were normalized by that of total bacteria. The band intensities of Fermentation 1 on day 0 have been taken as 1, and the other band intensity values were represented relative to that. Data represent the means ± SD (n = 3).

Martoni, C., Bhathena, J., Jones, M.L., Urbanska, A.M., Chen, H., Prakash, S. (2007). Investigation of microencapsulated BSH active lactobacillus in the simulated human GI tract. J Biomed Biotechnol 2007(7):13684.

 PubMedGoogle Scholar

Satokari, R.M., Vaughan, E.E., Akkermans, A.D., Saarela, M., de Vos, W.M. (2001). Bifidobacterial diversity in human feces detected by genus-specific PCR and denaturing gradient gel electrophoresis. Appl Environ Microbiol 67(2): 504–13.

 PubMedGoogle Scholar

Rinttila, T., Kassinen, A., Malinen, E., Krogius, L., Palva, A. (2004). Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol 97(6):1166–77.

 PubMedGoogle Scholar

Muyzer, G., de Waal, E.C., Uitterlinden, A.G. (1993). Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59(3):695–700.

 PubMedGoogle Scholar

Orrhage, K., Nord, C.E. (2000). Bifidobacteria and lactobacilli in human health. Drugs Exp Clin Res 26(3):95–111.

 PubMedGoogle Scholar