The effects of qindan-capsule-containing serum on the TGF-β1/ERK signaling pathway, matrix metalloproteinase synthesis and cell function in adventitial fibroblasts

Figures & data

Table 1. Recipe for qindan-capsule formulation.

Component	Family	Amount used (g)	Place of production (Province)	Season	Part	Voucher specimen number
Uncaria rhynchophylla (Miq) Jacks	Rubiaceae	30	Fujian	Autumn	Ramulus	SDU0177
Salvia miltiorrhiza Bge	Labiatae	30	Hebei	Autumn	Root	SDU0159
Loranthus parasiticus (L.) Merr	Loranthaceae	20	Guangdong	Winter	Stem and branch	SDU0187
Leonurus heterophyllus Sweet	Labiatae	15	Shandong	Summer	Aerial part	SDU0187
Scutellaria baicalensis Georgi	Labiatae	12	Shanxi	Spring	Root	SDU01
Pheretima aspergillum (E. Perrier)	Megascolecidae	12	Guangdong	Summer	Dried body	SDU0213
Ligusticum chuanxiong Hort	Umbelliferae	9	Sichuan	Summer	Rhizome	SDU0132
Coptis chinensis Franch	Ranunculaceae	9	Sichuan	Autumn	Rhizome	SDU0186

Table 2. Quality evaluation of the qindan-capsule compound.

Major constituent	Content (/QC)	Method of determination
Stachydrine	30.1 mg/g	HPLC
Baicalin	19.11 mg/g	HPLC
Berberine	4.3 mg/g	HPLC
Danshensu	(3,4-dihydroxyphenyllactic acid) 0.669 mg/g	HPLC
Rhynchophylline	0.126 mg/g	HPLC
Ligusticum chuanxiong	Contained	TLC
Loranthus parasiticus	Contained	TLC
Pheretima aspergillum	Contained	TLC

Table 3. Primers for RT-PCR.

Gene	Primer sequence (5′-3′)	Size (bp)	TM (°C)^a
β-Actin	GACAGGATGCAGAAGGAGATTACT	141	57.6
	TGATCCACATCTGCTGGAAGGT		55.8
CTGF	ATCCCTGCGACCCACACAAG	450	60.5
	CAACTGCTTTGGAAGGACTCGC		63.7
MMP2	TTCTTCGCAGGGAATGAG	263	50.4
	ACGACAGCATCCAGGTTAT		51.7
MMP9	CTTTGTAGGGTCGGTTCTG	175	54.8
	GAGTGGATAGCTCGGTGG		52.8

^aThe theoretical primer melting temperature calculated with Primer Premier 5.0 software (Palo Alto, CA).

Figure 1. Identification of AFs: (A) AFs cells (100×); (B) negative expression of SMA by immunocytochemistry (100×); and (C) positive expression of vimentin by immunocytochemistry (100×).

Figure 2. The effects of drug-containing serum on AF migration. AFs were treated with TGF-β1 for 24 h. Cell migration was measured with the transwell assay. The values shown represent the mean ± SEM, n = 3. &, p < 0.01 compared to NC; #, p < 0.05 compared to PC; *, p > 0.05 compared to losartan; Student’s t-test.

Figure 3. The effects of drug-containing serum on AF proliferation. AFs were treated with TGF-β1 for 24 h. Cell growth was measured with the MTT assay. The values shown represent the mean ± SEM, n = 3. &, p < 0.01 compared to NC; #, p < 0.05 compared to PC; ##, p < 0.01 compared to PC; *, p > 0.05 compared to losartan; **, p < 0.05 compared to losartan; Student’s t-test.

Figure 4. The effects of drug-containing serum on the AF cell cycle. AFs were treated with TGF-β1 for 24 h. Cell cycle progression was evaluated by flow cytometry. The values shown represent the mean ± SEM, n = 3. &, p < 0.01 compared to NC; $, p < 0.05 compared to NC; &&, p > 0.05 compared to NC; ##, p < 0.05 compared to PC; #, p > 0.05 compared to PC; *, p > 0.05 compared to losartan; Student’s t-test.

Figure 5. The effects of drug-containing serum on AF apoptosis. AFs were treated with TGF-β1 for 24 h. Cell apoptosis was measured by flow cytometry. (A) Representative data shows apoptosis cells. (B) Columns, mean of data obtained from three independent experiments. Bar mean SEM. &, p < 0.01 compared to NC; ##, p < 0.05 compared to PC; #, p < 0.01 compared to PC; *, p > 0.05 compared to losartan; Student’s t-test.

Figure 6. ERK1/2, CTGF, MMP2 and MMP9 expression. (A) and (B): protein levels of ERK1/2, p-ERK1/2, CTGF, MMP2 and MMP9. The values shown represent the mean ± SEM, n = 3. &&, p < 0.05 compared to NC; $, p < 0.01 compared to NC; &, p > 0.05 compared to NC; #, p > 0.05 compared to PC; ##, p < 0.05 compared to PC; @, p < 0.01 compared to PC; *, p > 0.05 compared to losartan; **, p < 0.05 compared to losartan; %, p < 0.01 compared to losartan; Student’s t-test. (C) and (D): CTGF, MMP2 and MMP9 mRNA expression. The values shown represent the mean ± SEM, n = 3. $, p < 0.05 compared to NC; $, p < 0.01 compared to NC; &&, p > 0.05 compared to NC; ##, p < 0.05 compared to PC; #, p > 0.05 compared to PC; *, p > 0.05 compared to losartan; **, p < 0.05 compared to losartan; Student’s t-test.