Plasma Kallikrein-Kinin system mediates immune-mediated renal injury in trichloroethylene-sensitized mice

Figures & data

Figure 1. The plasma kallikrein–kinin system. Pathways involved in the plasma kallikrein–kinin and complement system. HMW-kininogen, high-molecular-weight kininogen; FXII, factor XII; C3, complement 3; gC1q-R, globular head receptors of isolated C1q; C1-INH, complement 1 inhibitor; B1R, bradykinin 1 receptor; B2R, bradykinin 2 receptor.

Table 1. PCR primer pairs used.

		Sequences		Gen Bank
GAPDH forward	5’	ACCCCAGCAAGGACACTGAGCAAG	3’	NM 001289726.1
GAPDH reverse	5’	GGCCCCTCCTGTTATTATGGGGGT	3’
B1 receptor forward	5’	CCATCAGTCAGGACCGCTAC	3’	NM 007539.2
B1 receptor reverse	5’	AGGGACGACTTTGACGGAAC	3’
B2 receptor forward	5’	GCTCGCTTGAGAAAAGGAGGA	3’	NM 009747.2
B2 receptor reverse	5’	CATTTCGATGCCAAAGGAGGC	3’

Table 2. Sensitization rates and scores.

		Score
Group	Animals (n)	0	1	2	3	Sensitization- positive animals (n)	Sensitization rate (%)
Blank control	5	0	0	0	0	0	0
Solvent control	5	0	0	0	0	0	0
TCE	120	72	22	17	9	48	40^a^b
PKSI + TCE	120	93	14	7	6	27	22.50
Total	250	165	36	24	15	75	31.25

a p < 0.05 vs solvent control.

b p < 0.05 vs corresponding PKSI + TCE pre-treatment group.

Figure 2. Kidney histopathology. (A) Blank control; (B–E) TCE + group at 24 h, 48 h, 72 h and Day 7, respectively; (F) solvent control group; (G–J) PKSI + group at 24 h, 48 h, 72 h and Day 7, respectively. Black and yellow arrows point to cellular infiltration and tubular epithelial vacuolar degeneration, respectively. Magnification 200×; hematoxylin–eosin staining.

Table 3. Serum BUN and Cr in mice.

Group	n	BUN (mg/ml)	Cr (mol/l)
Blank control	5	5.78 ± 0.48	32.06 ± 9.00
Solvent control	5	5.78 ± 0.66	26.86 ± 7.12
TCE 24 h+	7	9.09 ± 0.42^a	65.00 ± 11.46^a^b
TCE 24 h−	8	7.18 ± 0.83	36.40 ± 4.94
PKSI^‡ 24 h+	4	7.86 ± 0.64	57.05 ± 18.06
PKSI 24 h−	11	6.18 ± 1.20	37.26 ± 7.25
TCE 48 h+	6	10.10 ± 0.64^a^bc	66.08 ± 7.60^a^b
TCE 48 h−	9	7.48 ± 0.35	35.75 ± 6.50
PKSI 48 h+	3	7.52 ± 0.60	50.26 ± 13.21
PKSI 48 h−	12	6.41 ± 0.41	32.06 ± 5.81
TCE 72 h+	6	11.21 ± 0.64^a^b^c	78.00 ± 9.20^a^b^c
TCE 72 h−	9	7.22 ± 0.98	35.75 ± 4.15
PKSI 72 h+	3	8.70 ± 0.52^a^b	48.75 ± 4.15
PKSI 72 h−	12	6.23 ± 0.60	36.40 ± 12.85
TCE 7 days+	5	8.14 ± 0.25	46.80 ± 17.44
TCE 7 days−	10	7.30 ± 1.10	31.41 ± 11.40
PKSI 7 days+	3	7.66 ± 0.63	44.77 ± 2.50
PKSI 7 days−	12	6.07 ± 0.22	36.11 ± 15.66

+, −, TCE sensitization-positive (TCE+), TCE sensitization-negative (TCE−); PKSI pre-treatment but TCE sensitization-positive (PKSI+), and PKSI pre-treatment but TCE sensitization-negative (PKSI−) group values.

‡ PKSI: Representing outcomes in PKSI + TCE pre-treatment group.

a p < 0.05 vs solvent control;

b p < 0.05 vs corresponding TCE negative group;

c p < 0.05 vs corresponding PKSI positive group.

Figure 3. Plasma BK levels. Data shown are means ± SD. ^aValue significantly different vs solvent control group; ^bvs corresponding TCE- group; and ^cvs corresponding PKSI + group (all p < 0.05).

Figure 4. BK expression in kidney – by immunofluorescence [FITC]. (A) Blank control; (B–E) TCE + group at 24 h, 48 h, 72 h and Day 7, respectively; (F) solvent control group; (G–J) PKSI + group at 24 h, 48 h, 72 h and Day 7, respectively. Magnification 200×.

Figure 5. PK expression in kidney – by immunofluorescence [FITC]. (A) Blank control; (B–E) TCE + group at 24 h, 48 h, 72 h and Day 7, respectively; (F) solvent control group; (G–J) PKSI + group at 24 h, 48 h, 72 h and Day 7, respectively. Magnification 200×.

Figure 6. RT-PCR analysis of B1R and B2R in kidney. (A and B) Data for B1R and B2R, respectively. Expression levels were normalized against GAPDH. Data shown are means ± SD. ^aValue significantly different vs solvent control; ^bvs corresponding TCE group; and ^cvs corresponding PKSI + group (all p < 0.05).

Figure 7. Western blots of kidney B1R and B2R kinin receptors. (A) B1R and B2R protein expression in the kidney detected by Western blot. (B) Quantitative data; results are expressed as ratio of B1R and B2R vs GAPDH. Data shown are means ± SD. ^aValue significantly different vs solvent control (p < 0.05). ^bValue significantly different vs corresponding PKSI + group (p < 0.05).

Figure 8. C5b-9 expression in kidney (immunohistochemistry). (A) Blank control group; (B–E) TCE + group at 24 r, 48 h, 72 h and Day 7, respectively; (F) solvent control group; (G–J) PKSI + group at 24 h, 48 h, 72 h and Day 7, respectively. Magnification = 400×.

Table 4. C5b-9 deposition in renal tissue sections.

Group	n	C5b-9 score
Blank control	5	1.20 ± 0.20
Solvent control	5	1.28 ± 0.11
TCE 24 h+	7	3.63 ± 0.14^a^b
TCE 24 h−	8	1.42 ± 0.22
PKSI^‡ 24 hr+	4	3.14 ± 0.34^a^b
PKSI 24 h−	11	1.48 ± 0.25
TCE 48 h+	6	4.53 ± 0.18^a^b^c
TCE 48 h−	9	1.36 ± 0.37
PKSI 48 h+	3	3.23 ± 0.23^a^b
PKSI 48 h−	12	1.40 ± 0.25
TCE 72 h+	6	5.69 ± 0.28^a^bc
TCE 72 h−	9	1.42 ± 0.47
PKSI 72 h+	3	3.26 ± 0.23^a^b
PKSI 72 h−	12	1.38 ± 0.38
TCE 7 days+	5	1.86 ± 0.19^a^b
TCE 7 days−	10	1.36 ± 0.21
PKSI 7 days+	3	1.82 ± 0.26
PKSI 7 days−	12	1.50 ± 0.22

+, −, TCE sensitization-positive (TCE+), TCE sensitization-negative (TCE−), PKSI pre-treatment but TCE sensitization-positive (PKSI+) and PKSI pre-treatment but TCE sensitization-negative (PKSI−) group values.

‡ PKSI: Representing outcomes in PKSI + TCE pre-treatment group.

a p < 0.05 vs solvent control;

b p < 0.05 vs corresponding TCE negative group;

c p < 0.05 vs corresponding PKSI positive group.