Association of rs6166 polymorphism with FSH receptor transcript variants and steroid production in human granulosa cell cultures

Figures & data

Figure 1.  The effect of the length of preculture before 24-hour-long stimulation with 3 IU/l rhFSH (A), rhFSH concentration in the culture medium during 24-hour-long stimulation after 7 days of preculture (B), and duration of stimulation with 0.5 IU/l rhFSH after 7 days of preculture (C) on changes in relative quantity of FSHR and LHCGR mRNA as compared to non-stimulated cells (based on pooled cells from 3 random patients, different for each analysis). rhFSH: recombinant human follicle stimulating hormone; FSHR: follicle stimulating hormone receptor; LHCGR: luteinizing hormone/chorionic gonadotropin receptor

Figure 2. Allele-specific PCR of FSHR gene in three different samples visualized on agarose gel. Genotypes of each individual are shown beneath the figure: band of 61 bp present or absent. Number one and two above each line stand for A and G allele, respectively. FSHR: follicle stimulating hormone receptor; M: molecular size marker (pBR322 DNA/BsuRI Digest, Fermentas)

Table 1. Characteristics of the patients (means [95% CI]) recruited to the study with respective p values (ANOVA).

	rs6166 genotype
	Asn/Asn (n = 10)	Asn/Ser (n = 8)	Ser/Ser (n = 4)	p
Age (years)	32.8 (30.7 – 34.9)	32 (28.9 – 35.1)	34.5 (28.6 – 40.38)	0.52
Length of stimulation (days)	9.8 (8.2 – 11.4)	10 (8.9 – 11.1)	9.5 (3.2 – 15.9)	0.94
Peak estradiol* (pg/ml)	2047.9 (1546 – 2547.9)	2041.3 (1248.1 – 2834.4)	1883.3 (734.2 – 3032.3)	0.85
Number of retrieved oocytes	8.2 (5.4 – 11)	8.4 (6 – 10.7)	7.3 (2.1 – 15.4)	0.88

* Peak estradiol: serum estradiol level on the day of hCG administration

Table 2. Normalized relative quantity (fold change [95% CI]) with levels of significance (p) of studied genes of interst (GOI) and follicle stimulating hormone receptor (FSHR) splicing variants.

GOI	Total (n = 22)	p	rs6166 genotype
			Asn/Asn (n = 10)	p	Asn/Ser (n = 8)	p	Ser/Ser (n = 4)	p
Total FSHR	1.9 (0.39 – 11.63)	0.001	2.26 (0.27-13.95)	0.018	1.89 (0.55 – 8.16)	0.015	1.42 (0.57 –3.87)	0.27
FSHR del ex2	1.58 (0.25 – 18.86)	<0.001	1.69* (0.23 – 25.86)	0.23	1.93* (0.45 – 7.04)	0.046	0.92* (0.31 – 2)	0.82
FSHR del ex6	1.04 (0.13 – 8.56)	0.89	0.87 (0.1 – 7.6)	0.74	1.35 (0.24 – 9.17)	0.42	0.79 (0.23 – 2.71)	0.61
FSHR del ex9	1.14 (0.12 – 10.84)	0.6	1.26 (0.08 – 15.17	0.64	1.35 (0.35 – 8.18)	0.33	0.73 (0.26 – 2.42)	0.42
FSHR ins ivs8	1.12 (0.17 – 8.92)	0.63	1.08* (0.13 – 12.7)	0.86	1.39* (0.31 – 5.82)	0.3	0.68* (0.19 – 2.84)	0.38
LHCGR	3.44 (0.43 – 22.43)	<0.001	3.39 (0.4 - 23.6)	0.003	3.73 (1.3 – 13.74)	0.001	2.8 (0.98 – 13.13)	0.050
CYP19a1	6.07 (1.05 – 57.42)	<0.001	6.84 (0.84 – 136.6)	<0.001	5.44 (1.46 – 46.9)	0.001	6.76 (1.62 – 17.41)	0.001

FSHR flanking exon 3 and 4 junction to cover maximum number of transcripts including all known splicing variants and full-length variant; FSHR del ex2, del ex6, del ex9: FSHR splicing variants lacking exon 2, 6, or 9, respectively; FSHR ins ivs8: FSHR variant with insertion of intron 2 fragment between exons 8 and 9; LHCGR: luteinizing hormone receptor covering maximum number of transcripts; CYP19a1: aromatase covering maximum number of transcripts; * pairwise comparison ([Asn/Asn + Asn/Ser] vs. Ser/Ser) p values < 0.05

Table 3. Sequences of primers and probes used for detection of analyzed transcripts of FSHR gene.

	Forward primer (5'-3')	Reverse primer (5'-3')	FAM Probe (5'-3')
Total FSHR	GATAGAGGCAGATGTGTTCTCCAA	GAAGGTTGGGAAGGTTCTGGAA	TTGGCCTTTTCAATTCTAATTTC
FSHR del ex2	AGAGCAAGGTGACAGAGATTCCT	TCACCTCCAAGACATCATTCTGAGA	ATGCCATTGAACTAGAGATC
FSHR del ex6	CACCTTCCAGATGTTCACAAGATTC	GTTCCATTGAATGCACAGTTGTGTA	CTTATTCAGCCATAGTAAAAC
FSHR del ex9	ACGGAGCCTCTGGACCA	AACTTCTTGCCTTAAAATAGATTTGTTGCA	ATGAAGCTCAGAGAGAATG
FSHR ins ivs8	GGAGGAACCGGAGTCTCTCT	GCAGGGAATGGATCCTTGTTCTT	CCTCATCCATAGATATTTC

Total FSHR: follicle stimulating hormone receptor assessed using primers flanking exon 3 and 4 junction to cover maximum number of transcripts including all known splicing variants and full-length variant; FSHR del ex2, del ex6, del ex9: FSHR splicing variants lacking exon 2, 6, or 9, respectively; FSHR ins ivs8: FSHR variant with insertion of intron 2 fragment between exons 8 and 9

Table 4. Normalized to total RNA steroid concentrations and relative increase in steroid concentration (median [interquartile range]) in the culture media of the luteinized granulosa cells.

	Total (n = 22)	rs6166 genotype
		AsnAsn (n = 10)	AsnSer (n = 8)	SerSer (n = 4)
Basal Estradiol^a (pg/1ng total RNA)	1718 (1339 - 3377)	2653 (1592 – 3627)	1459 (1380 – 3547)	1239 (1150 – 1749)
Δ estradiol^b (pg/1ng total RNA)	865 (147 - 1707)	824 (84 - 1707)	546 (71 – 1165)	1795 (865 – 6303)
Basal progesterone^a (ng/1ng total RNA)	22.76 (18.05 – 27.47)	23.95 (9.97 – 27.47)	25.43 (18.75 – 38.5)	20.9 (19.83 – 22.34)
Δ progesterone ^b (pg/1 ng total RNA)	42.3 (24.94 – 89.6)	33.7 (21.7 – 57.67)	48.2 (38.97 – 108.37)	71.07 (37.7 – 101.4)

^a assessed after 24 hours of incubation in serum-depleted, rhFSH-free environment on day 8 of the culture; ^b relative increase in steroid concentration after 24 hours of incubation in the presence of recombinant human follicle stimulating hormone (rhFSH) on day 8 of the culture as compared to non-stimulated cultures; p-values for the pairwise comparisons between genotype groups were not statistically significant

Table 5. Pearson correlation coefficients (r) with respective levels of significance (p) between normalized increase in steroid concentration and normalized relative quantity of studied genes of interest (GOI).

GOI	Estradiol (pg/ml)		Progesterone (ng/ml)
	r	p	r	p
FSHR	0.19	0.39	- 0.04	0.87
LHCGR	0.16	0.49	0.41	0.0558
CYP19a1	0.6	0.003	0.49	0.02

FSHR: follicle stimulating hormone receptor, LHCGR: luteinizing hormone/chorionic gonadotropin receptor, CYP19a1: aromatase