Expression of stem cell markers: OCT4, KIT, ITGA6, and ITGB1 in the male germinal epithelium

Figures & data

Figure 1.  Example of live cells images taken in an inverted microscope after individual cell isolation by micromanipulation. SC: Sertoli cells; SGA: spermatogonia: type-1 spermatogonia elongated and fusiform (arrows) and type-2 spermatogonia elongated (white arrowhead) and round (black arrowhead); ST1: primary spermatocytes; CD34⁺: umbilical cord blood CD34⁺ cells. Bars: = 20 μm (SC, SGA, ST1) and = 10 µm (CD34⁺)

Figure 2.  Reverse transcriptase-polymerase chain reaction characterization of OCT4, KIT, ITGA6, ITGB1, and CD3D in human testicular and hematopoietic cells. The subsequent code was employed to assign testicular and hematopoietic cells: SG: spermatogonia; ST1: primary spermatocytes; SC: Sertoli cells; DGC: diploid germ cell suspensions; W: whole-testicular cell suspensions; CD34⁺: umbilical cord blood CD34⁺ cells; Ly: lymphocytes. MW indicates the molecular weight marker of 100bp (Invitrogen). No bands were detected in the negative control (N). Human beta actin (ACTB) was used as house-keeping gene. OCT4: octamer-binding transcription factor 4; KIT: v-Kit Hardy-Zuckerman 4 Feline Sarcoma Viral Oncogene Homolog; ITGA6: integrin alpha 6; ITGB1: integrin beta 1; CD3D: CD3 delta

Figure 3.  Immunocytochemical localization of OCT4, KIT, ITGA6, and ITGB1 in adult human testicular cells and hematopoietic cells. The subsequent code was employed to assign testicular and hematopoietic cells: SG: spermatogonia; ST1: primary spermatocytes; SC: Sertoli cells; CD34⁺: umbilical cord blood CD34⁺ cells; Ly: lymphocytes. Replacement of primary antibody with phosphate buffered saline (PBS) in Ly provided the negative controls. OCT4: octamer-binding transcription factor 4; KIT: v-Kit Hardy-Zuckerman 4 Feline Sarcoma Viral Oncogene Homolog; ITGA6: integrin alpha 6; ITGB1: integrin beta 1

Figure 4.  Immunohistochemical localization of cell markers in paraffin sections of adult human testis. A, B inset-section without hematoxylin counterstaining) OCT4; C, inset) KIT; D) ITGA6; E, inset) ITGB1; and F) example of a negative control with primary antibody omission. BL: basal lamina; PTC: peritubular cells; SC: Sertoli cells; SG: spermatogonia; Ad: spermatogonia A-dark; Ap: spermatogonia A-pale; ST1: primary spermatocytes; Sa: round spermatids; Sd: elongated spermatids; Sz: spermatozoa; De: scaled cells in the lumen of the seminiferous tubule; Lu: lumen of the seminiferous tubule. Scale bars = 5 µm (B, C, E), 10 µm (D, F), and 20 µm (A).

Table 1. Marker positivity (+) in germ cells and Sertoli cells.

Marker	Method	SG type-1Ad	SG type-2Ap	ST1	SC
OCT4	RT-PCR	+	+	+	+
	IC	+	+	+	+
	IH	+	+	+	+
KIT	RT-PCR	-	-	+	+
	IC	-	+	+	+
	IH	-	+	-	-
ITGA6	RT-PCR	+	+	+	+
	IC	-	+	+	+
	IH	+	+	+	+
ITGB1	RT-PCR	-	-	+	+
	IC	-	+	+	+
	IH	-	+	+	+

OCT4: octamer-binding transcription factor 4; KIT: v-Kit Hardy-Zuckerman 4 Feline Sarcoma Viral Oncogene Homolog; ITGA6: integrin alpha 6; ITGB1: integrin beta 1; IC: immunocytochemistry; IH: immunohistochemistry; SG: spermatogonia; Ad: spermatogonia A-dark (IH); Ap: spermatogonia A-pale (IH); ST1: primary spermatocytes; SC: Sertoli cells

Table 2. Forward and reverse primers used for RT-PCR.

Gene	GenBank access no.	Forward primer (5' → 3')	Reverse primer (5' → 3')	length (bp)	Ta (°C)	References
ATCB	BC004251	agcctcgcctttgcgga	ctggtgcctggggcg	174	56	Honke et al. [2002]
CD3D	NM_000073	gggaacggtgggaacactgc	aaagcaaggagcagagtggc	225	55	Ziyyat et al. [1999]
OCT4	NM_002701	acacctggcttcggatttcg	ggcgatgtggctgatctgct	783	62	Ohbo et al. [2003]
KIT	BC071593	ctgaacacgcacctgctgaa	aagcatcgttgctattgggaat	480	60	Ohbo et al. [2003]
ITGA6	NM_000210	cagatcccggcctgtg	acctggaggcatatcccacat	111	61	Shinohara et al. [1999]
ITGB1	X07979	gatcagttcagtttgctgtgt	tccttcctgtaaaaatgttga	139	58	Shinohara et al. [1999]

ATCB: human beta actin; CD3D: CD3 delta; OCT4: octamer-binding transcription factor 4; KIT: v-Kit Hardy-Zuckerman 4 Feline Sarcoma Viral Oncogene Homolog; ITGA6: integrin alpha 6; ITGB1: integrin beta 1; Abbreviations: bp: base pairs; RT-PCR: reverse transcription-polymerase chain reaction; Ta: annealing temperature