Royal jelly protects from taxol-induced testicular damages via improvement of antioxidant status and up-regulation of E2f1

Figures & data

Figure 1. Effect of royal jelly on taxol (TXL)-induced changes in body weight gain (BWG) (A) and testis to body weight ratio (TW/BW) (B). Data is given as mean ± SD (n = 8). *: indicates a significant difference between the control and TXL-received groups; #: represents significant differences between the TXL-received non-treated and treated with various dose levels of RJ.

Figure 2. Effect of royal jelly (RJ) on taxol (TXL)-induced malondialdehyde (MDA) level (A), total thiol molecules (TTM) content (B), and nitric oxide (NO) concentration (C) in the testis. Data is given as mean ± SD (n = 8). *: indicates a significant difference between the control and TXL-received groups; #: represents significant differences between the TXL-received non-treated and treated with various dose levels of RJ.

Table 1. Effect of royal jelly (RJ) on taxol (TXL)-induced alterations in tubular differentiation index (TDI), repopulation index (RI), and seminiferous tubules diameter.

Parameters	TDI (%)	RI (%)	Seminiferous tubules diameter (µm)
C	83.3 ± 2.9	96.7 ± 8.3	385 ± 26
TXL	36.3 ± 2.5*	37.5 ± 2.9*	202 ± 28*
T1	47.5 ± 5.0#	56.7 ± 3.6#	238 ± 17*
T2	56.3 ± 8.5#	73.7 ± 13.5#	254 ± 15#
T3	72.5 ± 8.7#$	81.3 ± 5.2#$	276 ± 12#$
T4	81.7 ± 7.9	94.7 ± 8.9	341 ± 16

*indicates significant differences (p < 0.05) between the control and TXL-treated animals; #: represents remarkable difference between TXL-received non-treated and treated animals; $: shows significant differences between animals that received various dose levels of RJ. All data are presented as Mean ± SD and n = 8.

Figure 3. Effect of royal jelly on taxol-induced histopathological changes in the seminiferous tubules. C: control;TXL: taxol-received animals; T1, T2, T3: the TXL-treated animals which received various dose levels of RJ; T4: received RJ only; spermatozoids (black arrow), cytoplasmic residues (black arrow head), spermatids (white arrow), spermatocyte I (white arrow head), spermatogonium (blue arrow), Sertoli cell (blue arrow head), tunica albuginea (yellow arrow), pyknotic spermatocyte I (yellow arrow head), cell shrinkage (green arrow), ring from condensation of chromatin around the nuclear periphery of spermatids (green arrow head), multinucleated giant cells (red arrow), and depletion areas (red arrow head). Hematoxylin and eosin staining; original magnification -100 X and scale bars = 100 µm, and high magnification 200 X and scale bars = 25 µm.

Table 2. Effect of royal jelly (RJ) on histological changes in the testis of taxol (TXL)-exposed rats.

Groups	Cell Shrinkage	Pyknotic cells	Depletion area
C	0.0^a	0.0^a	0.0^a
TXL	7.9 ± 1.3^b	8.2 ± 1.4^b	7.4 ± 1.6^b
T1	6.4 ± 1.6^b	6.8 ± 1.2^b	6.8 ± 1.8^b
T2	4.4 ± 0.8^c	4.8 ± 1.3^c	5.2 ± 1.2^c
T3	3.7 ± 1.1^c	4.2 ± 1.4^c	4.8 ± 1.2^b
T4	1.2 ± 0.6^d	0 ± 0^a	1.8 ± 0.6^d

^abcd: values in same column with different superscripts differ significantly (p < 0.05). Mean values ± SD are given.

Table 3. Effect of royal jelly on the taxol (TXL)-induced negative impact on sperm count, viability, motility, and DNA double strands integrity.

Parameters	Sperm count (×10^6)	Sperm Motility (%)	Sperm Viability (%)	DNA damage (%)
C	105.2 ± 9.2	81.9 ± 7.1	86.8 ± 8.4	5.0 ± 2.1
TXL	46.3 ± 3.8*	52.9 ± 3.7*	42.6 ± 6.3*	75.3 ± 7.4*
T1	61.1 ± 6.2^#	53.5 ± 1.8*	51.4 ± 5.5*	58.4 ± 3.3^#
T2	66.7 ± 9.6^#	63.5 ± 4.7^#	69.8 ± 9.6^#	40.9 ± 11.4^#$
T3	89.6 ± 7.3^#$	77.1 ± 2.9^#$	80.5 ± 9.3^#	19.3 ± 4.1^#$£
T4	125.5 ± 11.2	85.7 ± 6.1	91.5 ± 11.0	4.9 ± 1.7

*: indicates significant differences (p < 0.05) between the control (C) and TXL-treated animals; #: represents remarkable difference between TXL-received non-treated and treated animals and $£: show significant differences between animals that received various dose levels of RJ. All data are presented as Mean ± SD; n = 8.

Figure 4. Effect of taxol (TXL) and royal jelly on E2f1 (198 bp) (A) and GAPDH (167 bp) (B) mRNA levels in the testicular tissue. The levels of E2f1 and GAPDH mRNA were evaluated by semi-quantitative RT-PCR. (C) The density of E2f1 mRNA in the testis that were measured by densitometry and normalized to GAPDH mRNA expression level. Results were expressed as integrated density values (IDV) of E2f1 mRNA level. C: control; TXL: taxol-received animals; T1, T2, T3: The TXL-recieved animals which treated with various dose levels of RJ; T4: received RJ only. *indicates significant differences (p < 0.05) between the control (C) and TXL-treated animals; #represents remarkable difference between TXL-received non-treated and treated animals.

Table 4. Neuclotid sequences, anneling tempratures (AT), and product size for primers used in RT-PCR.

Target Gene	Primer Sequence (5′-3′)	Product Size (bp)	AT (°C)
E2f1	FWD: TTGACCCCTCTGGATTTCTG REW: CCCTTTGGTCTGCTCAATGT	198	58
GAPDH	FWD: GTTACCAGGGCTGCCTTCTC RVS: GGGTTTCCCGTTGATGACC	167	63