Six polymorphisms in genes involved in DNA double-strand break repair and chromosome synapsis: association with male infertility

Figures & data

Figure 1. Synaptonemal complex (SC) formation and repair of DSBs. (A) SC formation. TEX11 and other elements form the SC. TEX11 could contribute to the elongation or stabilization of the SC. (B) DSBs repair. Recombination is initiated by DSBs formation. After DSBs formation, TEX15 regulates DNA repair proteins onto DSBs to insure 5′ to 3′ resection. Then TEX11, MLH1, and MLH3 may be involved in crossover formation. MLH1 and MLH3 also take part in DNA mismatch repair. DSBs: DNA double-strand breaks; TEX11: testis expressed gene 11; TEX15: testis expressed gene 15; MLH1: mutL homolog 1; MLH3: mutL homolog 3.

Table 1. Semen parameters of the study groups.

	Patients (316)
Characteristics	Azoospermia (244)	Oligozoospermia (72)	Controls (298)
Age (years)	29.40 (±5.74)	29.00 (±5.05)	29.88 (±5.46)
Semen parameters:
Ejaculate volume (ml)	–	3.42 (±1.87)	3.54 (±1.64)
Total sperm/ejaculate (10^6)	–	32.83 (±13.45)	135.99 (±61.21)
Sperm density (10^6/ml)	–	12.72 (±5.21)	52.67 (±23.71)
Motility (%)	–	26.96 (±11.83)	36.40 (±10.72)

Data are expressed as means ± standard deviations.

Figure 2. Sequencing results of the six single nucleotide polymorphisms (SNPs). (A) Sequencing results of the TEX11 rs6525433; (B) Sequencing results of the TEX11 rs4844247; (C) Sequencing results of the TEX15 rs323344; (D) Sequencing results of the TEX15 rs323346; (E) Sequencing results of the MLH1 rs1800734; (F) Sequencing results of the MLH3 rs175080. TEX11: testis expressed gene 11; TEX15: testis expressed gene 15; MLH1: mutL homolog 1; MLH3: mutL homolog 3.

Table 2. Allele frequencies of TEX11, TEX15, MLH1, and MLH3 among the infertile group and controls.

Gene	SNP	Geno-type	Infertile men n (%)	Controls n (%)	HWE	Odds ratio	95% Confidence interval	p Value
TEX11	rs6525433	T	208 (65.8)	222 (74.5)
		C	108 (34.2)	76 (25.5)		1.517	1.070–2.150	0.019^a
	rs4844247	C	255 (80.7)	256 (85.9)
		T	61 (19.3)	42 (14.1)		1.458	0.949–2.240	0.084
TEX15	rs323344	AA	277 (87.7)	268 (89.9)	0.360
		AC	39 (12.3)	30 (10.1)		1.258	0.759–2.084	0.372
	rs323346	TT	253 (80.1)	237( (79.5)	0.792
		CT	56 (17.7)	58 (19.5)		0.904	0.602–1.360	0.629
		CC	7 (2.2)	3 (1.0)		2.186	0.559–8.551	0.343
		CT + CC	63 (19.9)	61 (20.5)		0.967	0.652–1.435	0.869
		T	562 (88.9)	532( (89.3)
		C	70 (11.1)	64 (10.7)		1.035	0.723–1.483	0.850
MLH1	rs1800734	CC	50 (15.8)	50 (16.8)	0.093
		CT	165 (52.2)	161 (54.0)		1.025	0.655–1.604	0.915
		TT	101 (32.0)	87 (29.2)		1.161	0.714–1.887	0.547
		CT + TT	266 (84.2)	248 (83.2)		1.073	0.699–1.646	0.749
		C	265 (41.9)	261 (43.8)
		T	367 (58.1)	335 (56.2)		1.079	0.861–1.353	0.510
MLH3	rs175080	CC	193 (61.1)	222 (74.5)	0.495
		CT	116 (36.7)	72 (24.2)		1.853	1.364–2.634	0.001^a
		TT	7 (2.2)	4 (1.3)		2.013	0.580–6.981	0.361
		CT + TT	123 (38.9)	76 (25.5)		1.862	1.319–2.628	<0.001^a
		C	502 (79.4)	516 (86.6)
		T	130 (20.6)	80 (13.4)		1.670	1.232–2.265	<0.001^a

TEX11: testis expressed gene 11; TEX15: testis expressed gene 15; MLH1: mutL homolog 1; MLH3: mutL homolog 3; SNPs: single nucleotide polymorphisms; HWE: Hardy-Weinberg equilibrium; ^asignificant p values were noted between infertile group and the controls.

Table 3. Allele frequencies of TEX11, TEX15, MLH1, and MLH3 among the azoospermic group and controls.

Gene	SNP	Geno-type	azoospermia n (%)	Controls n (%)	Odds ratio	95% Confidence interval	p Value
TEX11	rs6525433	T	164 (67.2)	222 (74.5)
		C	80 (32.8)	76 (25.5)	1.425	0.981–2.070	0.062
	rs4844247	C	198 (81.1)	256 (85.9)
		T	46 (18.9)	42 (14.1)	1.416	0.896–2.238	0.135
TEX15	rs323344	AA	212 (86.9)	268 (89.9)
		AC	32 (13.1)	30 (10.1)	1.348	0.794–2.290	0.267
	rs323346	TT	195 (79.9)	237 (79.5)
		CT	45 (18.4)	58 (19.5)	0.943	0.612–1.454	0.790
		CC	4 (1.7)	3 (1.0)	1.621	0.358–7.328	0.706
		CT + CC	49 (20.1)	61 (20.5)	0.976	0.641–1.487	0.911
		T	435 (89.1)	532 (89.3)
		C	53 (10.9)	64 (10.7)	1.013	0.689–1.489	0.948
MLH1	rs1800734	CC	39 (16.0)	50 (16.8)
		CT	129 (52.9)	161 (54.0)	1.027	0.637–1.658	0.912
		TT	76 (31.1)	87 (29.2)	1.120	0.666–1.883	0.669
		CT + TT	205 (84.0)	248 (83.2)	1.060	0.671–1.675	0.804
		C	207 (42.4)	261 (43.8)
		T	281 (57.6)	335 (56.2)	1.058	0.831–1.347	0.650
MLH3	rs175080	CC	145 (59.4)	222 (74.5)
		CT	94 (38.5)	72 (24.2)	1.999	1.379–2.898	<0.001^a
		TT	5 (2.1)	4 (1.3)	1.914	0.505–7.246	0.493
		CT + TT	99 (40.6)	76 (25.5)	1.994	1.385–2.873	<0.001^a
		C	384 (78.7)	516 (86.6)
		T	10421.3)	80 (13.4)	1.747	1.268–2.406	<0.001^a

TEX11: testis expressed gene 11; TEX15: testis expressed gene 15; MLH1: mutL homolog 1; MLH3: mutL homolog 3; SNPs: single nucleotide polymorphisms; ^asignificant p values were noted between azoospermia group and the controls.

Table 4. Allele frequencies of TEX11, MLH1, and MLH3 among the oligozoospermic group and controls.

Gene	SNP	Geno-type	Oligozoo-spermia	Controls n (%)	Odds ratio	95% Confidence interval	p Value
TEX11	rs6525433	T	44 (61.1)	222 (74.5)
		C	28 (38.9)	76 (25.5)	1.859	1.082–3.192	0.023^a
	rs4844247	C	57 (79.2)	256 (85.9)
		T	15 (20.8)	42 (14.1)	1.604	0.833–3.090	0.155
TEX15	rs323344	AA	65 (90.3)	268 (89.9)
		AC	7 (9.7)	30 (10.1)	0.962	0.405–2.288	0.930
	rs323346	TT	58 (80.6)	237 (79.5)
		CT	11 (15.3)	58 (19.5)	0.775	0.383–1.569	0.478
		CC	3 (4.1)	3 (1.0)	4.086	0.804–20.769	0.100
		CT + CC	14 (19.4)	61 (20.5)	0.938	0.491–1.793	0.846
		T	127 (88.2)	532 (89.3)
		C	17 (11.8)	64 (10.7)	1.113	0.630–1.965	0.713
MLH1	rs1800734	CC	11 (15.3)	50 (16.8)
		CT	36 (50.0)	161 (54.0)	1.016	0.482–2.143	0.966
		TT	25 (34.7)	87 (29.2)	1.306	0.593–2.878	0.561
		CT + TT	61 (84.72)	248 (83.2)	1.118	0.550–2.275	0.758
		C	58 (40.3)	261 (43.8)
		T	86 (59.7)	335 (56.2)	1.155	0.798–1.673	0.445
MLH3	rs175080	CC	48 (66.7)	222 (74.5)
		CT	22 (30.5)	72 (24.2)	1.413	0.799–2.500	0.233
		TT	2 (2.8)	4 (1.3)	2.313	0.412–12.990	0.298
		CT + TT	24 (33.3)	76 (25.5)	1.461	0.839–2.544	0.179
		C	118 (81.9)	516 (86.6)
		T	26 (18.1)	80 (13.4)	1.421	0.875–2.310	0.154

TEX11: testis expressed gene 11; TEX15: testis expressed gene 15; MLH1: mutL homolog 1; MLH3: mutL homolog 3; SNPs: single nucleotide polymorphisms; ^asignificant p values were noted between oligospermia group and the controls.

Table 5. Interaction analyses for TEX11 rs6525433 and rs4844247 among the infertile group and controls.

rs6525433	rs4844247	Cases, n (%)	Controls, n (%)	OR (95% CI)	p Value
T	C	207 (65.5)	219 (73.5)	1.000
T	T	1 (0.3)	3 (1.0)	0.353 (0.036–3.417)	0.624
C	C	48 (15.2)	37 (12.4)	1.373 (0.859–2.194)	0.185
C	T	60 (19.0)	39 (13.1)	1.628 (1.042–2.542)	0.031

TEX11: testis expressed gene 11; OR: Odds ratio; CI: Confidence interval.

Table 6. Interaction analyses for MLH1 rs1800734 and MLH3 rs175080 among the infertile group and controls.

rs1800734	rs175080	Cases, n (%)	Controls, n (%)	OR (95% CI)	p Value
CC	CC	30 (9.5)	37 (12.4)	1.000
CC	CT/TT	20 (6.3)	13 (4.4)	1.897 (0.812–4.431)	0.137
TC/TT	CC	163 (51.6)	185 (62.1)	1.087 (0.642–1.838)	0.757
TC/TT	CT/TT	103 (32.6)	63 (21.1)	2.016 (1.135–3.582)	0.016

MLH1: mutL homolog 1; MLH3: mutL homolog 3; SNPs: single nucleotide polymorphisms; OR: Odds ratio; CI: Confidence interval.

Table 7. Primers and conditions used for genotyping analysis of examined polymorphisms.

SNP ID	Location	Primer sequence (5′–3′)	Annealing temperature	Fragment length (bp)
rs6525433	Xq13.1	F:AAATGCTAACTGTTGCTTTT R:CCCACGATACCTACTGACTC	20 cycles: starting at 65°C (decreasing 0.5°C per cycle); 10 cycles: 55°C for 30s	451 bp
rs4844247	Xq13.1	F:CTGCCACTGCACATAAGAAC R:AAGAATACTGATTGCCACCT	20 cycles: starting at 58°C (decreasing 0.4°C per cycle); 10 cycles: 50°C for 30s	396 bp
rs323344	8p12	F:CCTGATGCTACATCCAACTCAT R:CATAGGTCACACAAAGGCGA	20 cycles: starting at 58°C (decreasing 0.4°C per cycle); 10 cycles: 50°C for 30s	477 bp
rs323346	8p12	F:ATACAGGCAACTGTGATTCAGG R:TTCATTATCCCAAGGACGAAT	20 cycles: starting at 58°C (decreasing 0.4°C per cycle); 10 cycles: 50°C for 30s	545 bp
rs1800734	3p21.3	F:GTCCAGCCGCCGAATAACCC R:CCTGAGAAGCGCCAAGCACC	20 cycles: starting at 65°C (decreasing 0.5°C per cycle); 10 cycles: 55°C for 30s	446 bp
rs175080	14q24.3	F:ACCAATCTCAGTCTTCAAGTTGAACCTG R:ATCATCCCCATTGTTTGAGTTTCTCTTT	20 cycles: starting at 58°C (decreasing 0.4°C per cycle); 10 cycles: 50°C for 30s	341 bp