Comparative proteomic analysis of primordial follicles from ovaries of immature and aged rats

Figures & data

Table 1. Differentially expressed proteins identified by MALDI-TOF/TOF MS.

Spot no. on gel	Protein identity	Swiss-Prot accession number #	Swiss-Prot code	Nominal mass (Da)	Calculated pI	Mascot Score %	Greater than this score is significant (p < 0.05)	No of matched peptides	Sequence coverage (%)	Fold change	Species
Down-regulated in aged primordial follicles
1	78 kDa glucose-regulated protein	P11021	GRP78	72476	5.07	207	51	16	33	−3.14	Rattus norvegicus
2	Heat shock cognate 71 kDa protein	P63018	HSP7C	71059	5.37	95	51	14	29	−3.22	Rattus norvegicus
3	Fidgetin-like protein 1	Q6GX84	FIGL1	74904	6.60	155	51	19	32	−3.9	Rattus norvegicus
4	60 kDa heat shock protein, mitochondrial	P63039	CH60	61091	5.91	108	51	9	23	−2.4	Rattus norvegicus
5	Protein disulfide-isomerase A3	P11598	PDIA3	57052	5.88	79	51	16	36	−3.1	Rattus norvegicus
6	Calreticulin	P18418	CALR	48140	4.33	83	51	10	26	−3.8	Rattus norvegicus
10	Aldose reductase	P07943	ALDR	36238	6.26	84	51	9	43	−4.8	Rattus norvegicus
Up-regulated in aged primordial follicles
7	Zinc finger CCCH domain-containing protein 1	Q6TQE1	ZCH18	105706	7.98	80	51	7	7	11.28	Rattus norvegicus
8	Bcl-2-related ovarian killer protein	Q792S6	BOK	23731	9.32	97	51	12	42	20.88	Rattus norvegicus
9	Aldehyde dehydrogenase	P11884	ALDH2	56975	6.63	70	51	11	27	2.29	Rattus norvegicus
11	Peroxiredoxin-2	P35704	PRDX2	21944	5.53	78	51	8	43	6.9	Rattus norvegicus
12	Thioredoxin-dependent peroxide reductase, mitochondrial	Q9Z0V6	PRDX3	21649	5.81	78	51	3	14	6.2	Rattus norvegicus
13	Carbonic anhydrase 1	B0BNN3	CAH1	28340	6.86	61	51	7	47	2.0	Rattus norvegicus

Table 2. PANTHER GO classification of differentially expressed proteins.

		Number of genes
GENEONTOLOGY (GO) term	GO ID/pathway accession	Ref list^a	Target list^b	Expected^c	Over/under represened (+/−)	p Value
Panther pathway
Apoptosis signaling pathway	P00006	127	3	0.07	+	4.83E-05
Parkinson disease	P00049	117	2	0.07	+	2.00E-03
Leucine biosynthesis	P02749	12	1	0.01	+	6.86E-03
GO molecular process complete
Response to stress	0006950	2645	9	1.52	+	1.39E-02
Regulation of cell death	0010941	1456	8	0.84	+	2.11E-03
Regulation of programmed cell death	0043067	1350	8	0.77	+	1.18E-03
Regulation of apoptotic process	0042981	1334	8	0.77	+	1.07E-03
Cellular response to stress	0033554	1311	7	0.75	+	2.06E-02
Negative regulation of cell death	0060548	896	6	0.51	+	3.89E-02
Negative regulation of programmed cell death	0043069	819	6	0.47	+	2.32E-02
Negative regulation of apoptotic process	0043066	806	6	0.46	+	2.11E-02
Response to ketone	1901654	226	4	0.13	+	4.97E-02
Response to reactive oxygen species	0000302	199	4	0.11	+	3.01E-02
Protein folding	0006457	157	4	0.09	+	1.18E-02
Chaperone-mediated protein folding	0061077	44	3	0.03	+	1.56E-02
GO molecular function complete
Ubiquitin-like protein ligase binding	0044389	243	4	0.14	+	2.01E-02
Ubiquitin protein ligase binding	0031625	238	4	0.14	+	1.85E-02
Unfolded protein binding	0051082	69	3	0.04	+	1.81E-02
Misfolded protein binding	0051787	12	2	0.01	+	4.99E-02
Peroxiredoxin activity	0051920	8	2	0	+	2.22E-02
Thioredoxin peroxidase activity	0008379	4	2	0	+	5.56E-03

^aNumber of genes in the reference list that map to this PANTHER classification category. ^bNumber of genes in the target genes list that map to this PANTHER classification category. ^cExpected value is the number of genes that could be expected in target genes list for this PANTHER category based on the reference list. A p-value < 0.05 was considered to be significant.

Figure 1. Two dimensional patterns of proteins from primordial follicles isolated from immature (A) and aged (B) rat ovaries. Proteins were separated in the first dimension on an IPG strip pH 3–10 and in the second dimension on a 10% acrylamide SDS-gel, followed by staining with coomassie stain. An equal quantity (250 µg) of total protein extracts was loaded in each gel. The gels were scanned and the images were analyzed using Dymension 2D gel image analysis software (Syngene, Cambridge, UK). The distribution of 13 differentially expressed spots is numbered and correspond to Table 1.

Figure 2. Cropped and enlarged images of 2D gels showing differentially expressed protein spots and graph showing the expression of differentially expressed protein spots. (A) Cropped and enlarged images of 2D gels showing differentially expressed spots. (B) Graph showing the expression of differentially expressed protein spots. Expression is displayed as the average normalized spot volume ratio. The normalized spot volume represents the relative abundance of protein within a spot; the ratio of normalized spot volumes between corresponding spots in a gel equates to changes in abundance of protein within that spot.

Figure 3. Semi-quantitative RT-PCR for FIGNL1 and BOK. Total RNA isolated from immature and aged rat primordial follicles, reverse transcribed, and the complementary DNA subjected to semi-quantitative RT-PCR in a linear range of amplification with GAPDH as an internal control. Representative image of three independent experiments are shown in Panel A. A graphical representation of results is presented in Panel B. Data from three independent experiments were expressed as arbitrary densitometric units (mean ± SEM). *p < 0.05 compared with immature rat primordial follicles.

Table 3. List of primers used for semi-quantitative RT-PCR.

Gene	Primers (5′–3′)	Size (in bp)	Annealing temp (°C)
FIGNL1	FP: GAGATTGATGAAGCTGCCCG RP: GTAGCGATGTCAGCAGTGTG	242	60
BOK	FP: CAGTCTGAGCCTGTGGTGAC RP: CCAGGGTCTTGCGTACAAAT	196	60
GAPDH	FP: CTCATGACCACAGTCCATGC RP: TTCAGCTCTGGGATGACCTT	155	60