Publication Cover
Mitochondrial DNA Part A
DNA Mapping, Sequencing, and Analysis
Volume 27, 2016 - Issue 5
87
Views
2
CrossRef citations to date
0
Altmetric
Mitogenome Announcement

The complete mitochondrial genome of Cleithenes herzenstein and its phylogenetic analysis

, , , , &
Pages 3663-3665 | Received 03 Jul 2015, Accepted 18 Jul 2015, Published online: 02 Sep 2015
 

Abstract

The complete mitochondrial genome of Stewartia sinensis was obtained with long PCR approach. Amplification primers were designed according to mitogenome sequences of some other fish species. PCR reactions were according to Kong et al. (Citation2009). The complete mitochondria sequence of Cleithenes herzenstein was deposited in GenBank under the accession number KT223828. Structural and evolutionary analyses were also performed. The length of the complete mitochondrial DNA sequence was 17 175 bp, consisting of 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. Other than D-loop, another non-coding region named ‘‘OL’’ region was found (). The ‘‘OL’’ region (CTTTTTCCCGCCTAGTTTAACCAGTAAAAGGCGGGAA) is 38 bp and has the potential to fold into a stem-loop secondary structure. Most of the genes were encoded on the heavy strand (H strand) except for ND6 and eight tRNA genes (). The base composition and gene arrangement of C. herzenstein mitogenome was identical to typical vertebrate. For sequence alignment, the mitogenome sequence of C. herzenstein was 96% and 95% similar to that of Platichthys stellatus and Verasper moseri, respectively.

Declaration of interest

The authors report that they have no conflicts of interest. The authors alone are responsible for the content and writing of the paper. This work was supported by grants from Finance special program of Tianjin and The transformation project of Tianjin Agricultural Achievements.

Log in via your institution

Log in to Taylor & Francis Online

PDF download + Online access

  • 48 hours access to article PDF & online version
  • Article PDF can be downloaded
  • Article PDF can be printed
USD 61.00 Add to cart

Issue Purchase

  • 30 days online access to complete issue
  • Article PDFs can be downloaded
  • Article PDFs can be printed
USD 6,822.00 Add to cart

* Local tax will be added as applicable

Related Research

People also read lists articles that other readers of this article have read.

Recommended articles lists articles that we recommend and is powered by our AI driven recommendation engine.

Cited by lists all citing articles based on Crossref citations.
Articles with the Crossref icon will open in a new tab.