A comparison of the inhibitory effect of nano-encapsulated helenalin and free helenalin on telomerase gene expression in the breast cancer cell line, by real-time PCR

Figures & data

Table I. Forward (F) and reverse (R) primer sequences, and product size base pairs (bp) of the Housekeeping genes β-actin and telomerase.

Oligonucleotide	Location	Sequence	PCR product size (bp)
hTERT Forward primer Reverse primer	2165F 2362R	5′CCGCCTGAGCTGTACTTTGT3′ 5′CAGGTGAGCCACGAACTGT3′	198
Beta-actin Forward primer Reverse primer	787F 917R	5′TCCCTGGAGAAGAGCTACG 3′ 5′GTAGTTTCGTGGATGCCACA 3′	131

The level of expression of the hTERT gene was analyzed through the real-time PCR technique, using the SYBR Green PCR Master Mix TAKARA and Rotor-gene TM 6000 apparatus, according to the proposed protocol.

Figure 1. FT-IR spectra of PLGA-PEG copolymer nanoparticles.

Table II. FT-IR bands of PLGA-PEG copolymer.

Copolymer	IR bands (cm)^−1	Description*
PLGA-PEG	2924, 2852	CH2, CH3
	1745	C = O from ester
	1097	C–O–C from PEG
	2954	C–H from PEG
	3000–3100	COOH end groups of PLGA

Figure 2. ¹H NMR spectrum of the PEG-PLGA copolymer.

Figure 3. The SEM nanographs of helenalin-loaded PLGA–PEG copolymer nanoparticles (A) PLGA-PEG-helenalin (B) PLGA-PEG.

Table III. The values of encapsulation efficiency achieved for helenalin and the presence of PEG- PLGA with different molecular weights.

Formulation no.	Polymer type	Encapsulation efficiency (EE%)	Particle size (nm)
F1	PLGA-PEG2000,10	64.2 ± 3.5	77
F2	PLGA-PEG2000,30	72.3 ± 4.6	55

Figure 4. (A) The comparison of the cytotoxic effect of free helenalin (left) and NC-helenalin (right) on T47D cells over a 24-h exposure. This graph shows that both free helenalin and NC-helenalin have not IC50 in the 24-h exposure on T47D cells, within the concentration limits. (B) The comparison of the cytotoxic effect of free helenalin (left) and NC-helenalin (right) on T47D cells over a 48-h exposure. This graph shows that free helenalin has no IC50 in the 48 h exposure for T47D cells within the concentration limits, but NC-helenalin has IC50 in 48 h (0.16 μM). (C) A comparison of the cytotoxic effect of free helenalin (left) and NC-helenalin (right) on T47D cells over a 72-h exposure. This graph shows that the IC50 of free helenalin is about 1.3 μM and that of NC-helenalin is about 0.14 μM, over a 72-h exposure for T47D cells.

Figure 5. (A) Amplification column for hTERT expression in free helenalin. (B) Amplification column for hTERT expression in NC− helenalin.