Hypoglycemic activities of lyophilized powder of Gynura divaricata by improving antioxidant potential and insulin signaling in type 2 diabetic mice

Figures & data

Table 1 mRNA primer design of the key enzymes in pancreatic tissue

Gene	Primer sequences (5' to 3’)	Product length (bp)
AKT-F	TGTCTGCCCTGGACTACTTGC	166
AKT-R	GGCGTTCCGCAGAATGTC	166
PI3K-F	AAGCCATTGAGAAGAAAGGACTG	176
PI3K-R	ATTTGGTAAGTCGGCGAGATAG	176
PDK-1-F	CTGGGCGAGGAGGATCTG	132
PDK-1-R	CACAGCACGGGACGTTTC	132
β-actin-F	GAGACCTTCAACACCCCAGC	263
β-actin-R	ATGTCACGCACGATTTCCC	263

Fig. 1 Effect of GD on the body weight of diabetic mice 7–10 weeks old. ad means oral administration. Treatment group L: 1.2% GD-treated diabetic group; treatment group H: 4.8% GD-treated diabetic group. Data are expressed as mean±SD. *p<0.05 and **p<0.01, respectively, versus the normal group; ^# p<0.05 versus the diabetic model group.

Fig. 2 Effect of GD on FBG levels of diabetic mice. FBG: fasting blood glucose; treatment group L: 1.2% GD-treated diabetic group; treatment group H: 4.8% GD-treated diabetic group. Data are expressed as mean±SD. **p<0.01, versus the normal group; ^# p<0.05 and ^## p<0.01, respectively, versus the diabetic model group.

Table 2 Effects of GD on the GSH-Px as well as T-SOD activities and MDA levels in mice

Groups	Dose	GSH-Px (U/mgprot)	T-SOD (U/mgprot)	MDA (nmol/mgprot)
Normal	—	1216.84±7.33	100.29±0.52	0.47±0.09
Diabetes model	—	694.87±165.24**	63.01±0.12**	1.04±0.01**
Experimental	Treatment group L	733.75±4.24	95.55±0.73^##	0.52±0.09^##
	Treatment group H	1145.65±6.00^##	96.67±10.80^#	0.67±0.21^#

Treatment group L: 1.2% GD-treated diabetic group; Treatment group H: 4.8% GD-treated diabetic group. Data are mean±SD. **p<0.01 versus the normal group; ^# p<0.05 and ^## p<0.01, respectively, versus the diabetic model group.

Fig. 3 Effect of GD on the serum insulin level in diabetic mice. After 4 weeks of GD treatment in high-fat diet and STZ-induced type 2 diabetic mice, the serum insulin level was measured in mice during the fasting state. Treatment group L: 1.2% GD-treated diabetic group; treatment group H: 4.8% GD-treated diabetic group. Data are expressed as mean±SD. **p<0.01, versus the normal group; ^# p<0.05 and ^## p<0.01, respectively, versus the diabetic model group.

Table 3 Effect of GD on blood lipids and liver glycogen levels in diabetic mice

Groups	Dose	TG (mmol/L)	CHOL-C (mmol/L)	HDL-C (mmol/L)	Liver glycogen (mg/g)
Normal	—	1.36±0.12	2.85±0.08	2.13±0.30	5.36±1.25
Diabetes model	—	1.87±0.77	3.14±0.55	1.94±0.30	1.64±0.26*
Experimental	Treatment group L	1.27±0.57	2.74±0.20	1.83±0.43	3.41±1.07
	Treatment group H	1.53±0.52	2.91±0.22	2.26±0.43	2.31±0.57

Treatment group L: 1.2% GD-treated diabetic group; Treatment group H: 4.8% GD-treated diabetic group. Data are mean±SD. *p<0.05 versus the normal group.

Fig. 4 Effect of GD on AKT, PI3K and PDK-1 mRNA expressions in pancreatic tissues of diabetic mice. The mRNA relative expressions of AKT, PI3K, and PDK-1 were tested using qPCR. Treatment group L: 1.2% GD-treated diabetic group; treatment group H: 4.8% GD-treated diabetic group. Data are mean±SD. *p<0.05 and **p<0.01, respectively, versus the normal group; ^# p<0.05 and ^## p<0.01, respectively, versus the diabetic model group.

Fig. 5 Effect of GD on AKT, P-AKT, PI3K, and PDK-1 protein expressions in pancreatic tissues of diabetic mice. (A) Western blot analysis of AKT, P-AKT, PI3K, and PDK-1 protein expressions. (B) Quantitative analysis of AKT, P-AKT, PI3K and PDK-1 protein expressions. Treatment group L: 1.2% GD-treated diabetic group; Treatment group H: 4.8% GD-treated diabetic group. Data are given by mean±SD. *p<0.05 and **p<0.01, respectively, versus the normal group; ^# p<0.05 and ^## p<0.01, respectively, versus the diabetic model group.