SREBP pathway genes as candidate markers in country ham production

Figures & data

Table 1 Genes analyzed, primers, PCR annealing temperature, restriction enzymes used, PCR-RFLP fragment sizes and allele frequencies in a study of the association between genetic markers and fresh and dry-cured ham processing characteristics.

Marker^*	dbSNP accession No.	Primer	Primer sequence (5′ – 3′)	Fragment size (bp)	Annealing temp. (°C)	Restriction enzyme	Fragment sizes (bp) and allele frequency (%)
SREBF1	120258595	SREBF-F	ATG CCT GCC TGC CCT AAC	503	60	Nla III	503 (allele G: 29.7%)
c.1158+118A>G	SREBF-R	GCC ATC TGT CCT CTT TGC TG	373+130 (allele A: 70.3%)
SCAP	120258596	SCAP-F	GTG TTG GAG GCT CAG GAG AG	381	62	Bg lII	381 (allele C: 60.8%)
c.2616C>T	SCAP-R	AGG AAA GCT GCC TTC ATC CT	246+135 (allele T: 39.2%)
MBTPS1	120258599	MBTPS1-F	GAACCAACTGGACCAACGAG	363	59	Dde l	345+18 (allele T: 74.9%)
c.736+78C>T	MBTPS1-R	CGGACTCTCCAAGTCTGAGG	228+117+18 (allele C: 25.1%)

* The genes analysed were: Sterol regulatory element binding transcription factor 1 (SREBF1), SREBF chaperone (SCAP) and membrane-bound transcription factor peptidase, site 1 (MBTPS1).

Table 2 P-values for the effects of SREBF1, SCAP and MBTPS1 on fresh and cured ham traits.

Traits	SREBF1	SCAP	MBTPS1	SREBF1×SCAP	SREBF1×MBTPS1	SCAP×MBTPS1
Cured weight, kg	ns	ns	<0.05	ns	<0.05	ns
Yield, %	ns	ns	<0.05	ns	<0.05	ns
Circumference, cm	ns	ns	<0.05	<0.10	<0.01	ns
Lipid percentage, %	ns	ns	<0.10	ns	ns	ns
Fresh Hunter a	<0.05	ns	ns	ns	ns	ns
Cured Hunter L	<0.10	ns	ns	ns	ns	ns
Cured Hunter b	ns	ns	<0.05	ns	<0.01	ns
Moisture, %	ns	ns	ns	ns	ns	<0.05
Salt content, %	ns	ns	ns	<0.05	ns	ns

Green weight, Depth (cm), Marbling, Firmness, pH, Dry matter (%), Fresh Hunter L and b and Cured Hunter a were not significant at P<0.05.

Table 3 Genotypic least square means (± standard errors) for SREBF1, SCAP and MBTPS1 in fresh and cured ham traits.

		SREBF1			SCAP			MBTPS1
Traits	GG	AG	AA	CC	CT	TT	TT	TC	CC
Cured weight, kg	7.32±0.09	7.25±0.05	7.31±0.03	7.31±0.04	7.27±0.05	7.32±0.09	7.21±0.03^a	7.31±0.03^b	7.38±0.11^ab
Yield, %	78.71±0.94	77.95±0.50	78.59±0.36	78.50±0.41	78.09±0.49	78.66±0.94	77.46±0.07^a	78.51±0.36^b	79.28±1.20^a^b
Circumference, cm	72.00±0.72	71.74±0.38	72.06±0.28	72.09±0.31	71.59±0.37	72.12±0.72	71.67±0.21^a	72.59±0.28^b	71.54±0.92^ab
Lipid percentage, %	2.46±0.34	2.37±0.18	2.38±0.13	2.46±0.15	2.37±0.18	2.39±0.35	2.11±0.10^a	2.50±0.13^b	2.61±0.44^ab
Fresh Hunter a	7.12±0.55^a	8.14±0.30^ab	8.63±0.21^b	8.09±0.29	7.85±0.30	7.94±0.51	8.08±0.18	8.01±0.37	7.80±0.60
Cured Hunter L	44.20±0.90	43.71±0.48	42.58±0.35	43.25±0.39	43.84±0.48	43.39±0.90	43.02±0.26	43.27±0.36	44.20±1.15
Cured Hunter b	5.86±0.19	5.65±0.10	5.52±0.07	5.60±0.08	5.67±0.10	5.75±0.19	5.47±0.06^a	5.66±0.07^b	5.89±0.24^ab
Moisture, %	63.86±0.59	64.65±0.31	64.55±0.23	64.19±0.26	64.00±0.31	64.88±0.59	64.48±0.17	64.13±0.23	64.46±0.76
Salt content, %	5.40±0.39	5.28±0.21	5.26±0.15	5.57±0.17	5.41±0.20	4.97±0.39	5.48±0.11	5.29±0.15	5.18±0.50

a.b Mean values with different letters were significantly different; P<0.05.