Effects of Huangqi Maxingshigan decoction on infectious laryngotracheitis in chickens

Figures & data

Table 1 Animal treatment.

Group	n	ILTV dose, mL/bird	Herbal treatment, mL
I	40	0.3	0.4
II	40	0.3	0.4
III	40	0.3	–
IV	40	–	–

ILT, infectious laryngotracheitis. Group I, Huangqi Maxingshigan decoction group; group II, Ding Chuan San control; group III, model; group IV, blank control; herbal treatment was given 2 days after ILTV challenge.

Table 2 Primers used for semi-quantitative PCR and PCR conditions for RT-PCR analysis.

Genes	Accession n.	Primer sequences	Product size, bp	Cycles
β–actin	L08165	CAT CTA TCG TGG GTC GC	547	30
		CTC CTT GAT GTC ACG CAC
IFN-γ	NM_205149	GCT GAC GGT GGA CCT ATT	240	30
		CAA GTC GTT CAT CGG GAG
IL-4	AJ621249	AGGTTTCCTGCGTCAAGA	244	30
		TTCAAGGATCGTCTGGATGC

Table 3 Effect of modified Maxingshigan decoction on superoxide dismutases activity in ILT chickens (unit: U/L).

Group	57 day	67 day	77 day
I	399.66±81.70	459.96±70.60^b	479.14±37.47^b
II	395.65±29.26	438.63±66.04^b	447.02±44.92^b
III	396.83±83.20	430.35±71.15	435.31±50.95
IV	389.80±113.69	394.98±41.15^a	413.33±21.66^a

ILT, infectious laryngotracheitis. Group I, Huangqi Maxingshigan decoction group; group II, Ding Chuan San control; group III, model; group IV, blank control;

a,b values in the same column with different letters are significantly different (P<0.05).

Table 4 Effect of modified Maxingshigan decoction on malondialdehyde content in ILT chickens (unit: U/mL).

Group	57 day	67 day	77 day
I	4.98±0.33	4.91±0.78^b	4.51±0.91^b
II	4.86±0.50	4.82±1.27^b	4.57±0.82^b
III	4.98±1.32	4.90±2.53	4.88±1.21^a
IV	4.52±0.42	4.36±0.61^a	4.27±0.56^b

ILT, infectious laryngotracheitis. Group I, Huangqi Maxingshigan decoction group; group II, Ding Chuan San control; group III, model; group IV, blank control;

a,b values in the same column with different letters are significantly different (P<0.05).

Table 5 Analysis results of IFN-γmRNA level in different groups.

Group	57 day	67 day	77 day
I	0.7691±0.0504	0.9518±0.0801^a	1.183±0.1566^A
II	0.721±0.0123	0.7908±0.0044	0.8160±0.0012^B
III	0.6819±0.0214	0.6988±0.0211^b	0.7123±0.0102^B
IV	0.7912±0.0505	0.7905±0.0024	0.8046±0.0023^B

Group I, Huangqi Maxingshigan decoction group; group II, Ding Chuan San control; group III, model; group IV, blank control;

a,b,A,B values in the same column with different letters are significantly different, P<0.05, P<0.01, respectively.

Figure 1 The electrophoretogram results of IFN-mRNA level in different groups, by semi-quantitative RT-PCR analysis. M: 2000bp ladder of DNA markers.

Table 6 Analysis results of IL-4 mRNA level in different groups.

Group	57 day	67 day	77 day
I	I0.9269±0.0602^B	0.8999±0.0404	0.8036±0.0349^Bc
II	0.9165±0.0434^B	0.9065±0.0434	0.8609±0.0091^Bd
III	0.9650±0.0541^B	0.9453±0.0369	0.9269±0.0602^Ba
IV	0.7169±0.0198^A	0.7086±0.0645	0.7036±0.0349^Ab

Group I, Huangqi Maxingshigan decoction group; group II, Ding Chuan San control; group III, model; group IV, blank control;

a,b,A,B values in the same column with different letters are significantly different, P<0.05, P<0.01, respectively.

Figure 2 The electrophoretogram results of IL-4 mRNA level in different groups, by semi-quantitative RT-PCR analysis. M: 2000 bp ladder of DNA markers.

Table 7 Results of IFN_-γ/IL-4 mRNA level in different groups.

Group	57 day	67 day	77 day
I	0.8174±0.0402	1.0111±0.0504^b	1.2068±0.0249^B
II	0.784±0.0434	0.9912±0.0434^b	1.0548±0.0191^B
III	0.6995±0.0641	0.7269±0.0269^a	0.7661±0.0402^A
IV	1.1394±0.0398	1.1714±0.0545^b	1.1914±0.0249^B

Group I, Huangqi Maxingshigan decoction group; group II, Ding Chuan San control; group III, model; group IV, blank control;

a,b,A,B values in the same column with different letters are significantly different, P<0.05, P<0.01, respectively.

Figure 3 Results of IgA secreting cells in different groups. In upper respiratory tract, the characteristic morphology of IgA secreting cells: rounded, with a nucleus surrounded by a ring of yellow-brown cytoplasma. These cells were present in the lamina propria, and submucosa of the upper respiratory tract, and also surround the glands, which showed unvarying regular pattern. (A,C), IgA secreting cells in control groups. (B,D), IgA secreting cells in Huangqi Maxingshigan decoction were significantly more than those in control groups; a: mucous gland; b: tracheal cartilages; c: lamina propria; d: submucosa; scale bar = (a, B) 100 µm; (C, D) 30 µm.

Table 8 Effect of sIgA content in ILT chickens (unit: pg/mL).

Group	57 day	67 day	77 day
I	25.79±3.78	27.36±5.20	28.97±3.43^b
II	24.52±4.35	27.27±3.88	23.83±3.23^a
III	25.91±2.64	29.59±3.94	29.20±4.34^b
IV	24.75±1.67	29.52±1.94	25.74±6.81

Group I, Huangqi Maxingshigan decoction group; group II, Ding Chuan San control; group III, model; group IV, blank control;

a,b values in the same column with different letters are significantly different (P<0.05).

Table 9 Results of IgA secreting cells in different groups.

Group	57 day	67 day	77 day
I	31.03±3.14^b	40.81±1.97^A	45.22±1.34^A
II	29.79±1.05^b	33.86±1.8^B	36.89±0.95^Ba
III	28.15±0.60	31.36±1.88^B	33.56±1.91^Bb
IV	15.76±12.8^a	22.33±1.53^C	21.36±1.53^C

Group I, Huangqi Maxingshigan decoction group; group II, Ding Chuan San control; group III, model; group IV, blank control;

a,b,A,B values in the same column with different letters are significantly different, P<0.05, P<0.01, respectively.