The Use of Quantitative Real Time Polymerase Chain Reaction to Quantify Some Rumen Bacterial Strains in an In Vitro Rumen System

Figures & data

Table 1. PCR primers used for quantification of selected rumen bacteria by real-time PCR.

Target	Primer sequences (5’ to 3’)	References	Annealing Product	temperature size
Butyrivibrio fibrisolvens	F:ACACACCGCCCGTCACA R:TCCTTACGGTTGGGTCACAGA	Klieve et al., 2003	60°C	64bp
Ruminococcus albus	F:CCCTAAAAGCAGTCTTAGTTCG R:CCTCCTTGCGGTTAGAACA	Koike and Kobayashi, 2001	55°C	175bp
Streptococcus bovis	F:ATGTTAGATGCTTGAAAGGAGCAA R:CGCCTTGGTGAGCCGTTA	Klieve et al., 2003	60°C	90bp
Megasphaera elsdenii	F:AGATGGGGACAACAGCTGGA R:CGAAAGCTCCGAAGAGCCT	Stevenson and Weimer, 2007	54°C	95bp

F, forward primer; R, reverse primer.

Table 2. Effect of rumen inoculum origin, type of substrate and sampling time on the pH, volatile fatty acids and neutral detergent fibre digestibility (measured at only 48 h of fermentation) in an in vitro system.

		Rumen inoculum				Significance						RSE
		Cows		Bulls
	Forage:concentrate	75:25	25:75	75:25	25:75	L	S	T	LxS	LxT	SxT
	Sampling time, h
pH	0	7.18	7.24	6.88	6.92	<0.001	0.766	<0.001	0.699	0.383	0.158	0.08
	24	6.93	6.82	6.51	6.47
Total VFA, mmol/L	0	29.60	32.10	61.90	71.40	<0.001	0.365	0.003	0.054	0.129	0.730	9.08
	24	57.80	51.14	68.84	88.70
Acetic acid, mmol/100 mmol	0	76.90	76.30	63.90	65.00	0.014	0.318	0.044	0.873	0.671	0.256	4.32
	24	72.70	67.91	62.80	57.73
Propionic acid, mmol/100 mmol	0	15.50	15.50	23.80	23.20	<0.001	0.231	0.179	0.852	0.073	0.137	2.04
	24	18.02	20.51	21.00	24.60
Butyric acid, mmol/100 mmol	0	7.50	8.20	12.40	11.80	0.029	0.440	0.017	0.658	0.354	0.453	2.41
	24	9.12	11.57	16.20	17.66
NDFD, %
Meadow hay (forage 1)	48	48.8	47.1	43.4	42.5	<0.001	0.097	-	0.607	-	-	1.81
Meadow hay (forage 2)	48	66.3	66.8	57.4	56.6	<0.001	0.586	-	0.298	-	-	2.05
Soya bean meal, extract	48	55.4	64.5	60.0	62.0	0.628	0.021	-	0.123	-	-	5.37
Corn meal	48	90.5	89.9	88.1	89.4	0.018	0.493	-	0.117	-	-	1.36

L, inoculum origin; S, type of substrate; T, sampling time; interaction LxSxT, P>0.10; RSE, residual standard error; VFA, volatile fatty acids; NDFD, neutral detergent fibre digestibility.

Table 3. Effect of rumen inoculum origin, type of substrate and sampling time on the absolute abundance of target rumen bacteria determined by real-time PCR (expressed as 16S rRNA copies/mL) in fermentation fluid from an in vitro system.

	Rumen inoculum				Significance						RSE
		Cows		Bulls
	Forage:concentrate	75:25	25:75	75:25	25:75	L	S	T	LxS	LxT	SxT
	Sampling time, h
Butyrivibrio fibrisolvens, ×10^9	0	4.43	3.96	1.48	1.21	<0.001	0.223	0.110	0.351	0.082	0.734	0.76
	24	3.39	2.09	1.41	1.43
Ruminococcus albus, ×10^7	0	0.77	0.16	0.06	0.91	0.265	0.067	0.004	0.017	0.293	0.028	0.40
	24	1.86	0.33	1.80	1.34
Streptococcus bovis, ×10^7	0	0.12	0.09	0.08	0.07	0.034	0.187	0.003	0.026	0.362	0.615	0.04
	24	0.27	0.14	0.11	0.17
Megasphaera elsdenii, ×10^4	0	-	-	0.86	1.15	-	0.972	0.150	-	-	0.684	0.83
	24	-	-	1.98	1.74

L, inoculum origin; S, type of substrate; T, sampling time; interaction LxSxT, P>0.10; RSE, residual standard error.

KlieveA.V. HennesseyD. OuwerkerkD. ForsterR.J. MackieR.I. AttwoodG.T. 2003. Establishing populations of Megasphaera elsdenii YE 34 and Butyrivibrio fibrisolvens YE 44 in the rumen of cattle fed high-grain diets. J. Appl. Microbiol. 95:621-630.

 PubMed Web of Science ®Google Scholar

KoikeS. KobayashiY. 2001. Development and use of competitive PCR assays for the rumen cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus flavefaciens. FEMS Microbiol. Lett. 204:361-366.

 PubMed Web of Science ®Google Scholar

StevensonD.M. WeimerP.J. 2007. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl. Microbiol. Biotechnol. 75:165-174.

 PubMed Web of Science ®Google Scholar