Supramolecular Polymer Formation By Cyclic Dinucleotides and Intercalators Affects Dinucleotide Enzymatic Processing

Figures & data

Figure 1.  Structures of cyclic dinucleotides and intercalators.

Figure 2.  Cyclic diguanylic acid can bind to proteins as monomers, dimers or tetramers (dimer of a dimer).

(A) Crystal structure of cyclic diguanylic acid (c-di-GMP) bound to WspR I-site, DGC protein (protein data bank [PDB] code: 3I5A) [5]; (B) Crystal structure of c-di-GMP bound to YahA, PDE protein (PDB code: 4LJ3) [6]; (C) Crystal structure of c-di-GMP bound to BldD, transcriptional factor (PDB code: 4OAZ) [7].

Figure 3.  Different approaches to inhibit dinucleotide hydrolysis.

(A) Traditional approach to inhibiting c-di-NMP signaling; (B) unexplored approach to inhibiting c-di-NMP signaling via aggregate formation. ‘N’ in c-di-NMP, pNpN, NMP, NDP, NTP or cNMP refers to guanine or adenine base. White block indicates nucleobase. Blue and red shapes represent intercalators. Aggregated forms could be resistant to PDE cleavage.

c-di-NMP: Cyclic-di-nucleotide; cNMP: Cyclic nucleotide monophosphate; NDP: Nucleotide diphosphate; NTP: Nucleotide triphosphate; PDE: Phosphodiesterase; pNpN: Linear dinucleotide.

Figure 4.  Proposed cyclic diguanylic acid/intercalator complexes.

(A) Tetramer/thiazole orange complex and (B) Hexamer/thiazole orange complex. Blue and white indicate guanine, M⁺ represents as metal ion such as K⁺ and colored arrows indicate fluorescence. C-di-GMP can form G-quadruplex structures and intercalators could end-stack or intercalate into these structures.

C-di-GMP: Cyclic diguanylic acid.

Figure 5.  Complex formation between cyclic diguanylic acid and 3,6-diaminoacridine hydrochloride captured by atomic force microscopy image.

Condition: [c-di-GMP] = 100 μM, [ProF] = 100 μM, [K⁺] = 250 mM in 50 mM Tris-HCl (pH = 7.5) was left to stand overnight (12 h) and then diluted 20-times to give final concentrations of c-di-GMP (5 μM), ProF (5 μM) and K⁺ (12.5 mM), which was deposited on the mica plate for AFM imaging.

AFM: Atomic force microscopy; c-di-GMP: Cyclic diguanylic acid; ProF: 3,6-Diaminoacridine hydrochloride.

Figure 6.  Cyclic diguanylic acid/3,6-diaminoacridine hydrochloride polymer could be as long as 0.4 microns.

Figure 7.  Electrophoretic mobility shift assays using native gel.

100 μM unlabeled cyclic diguanylic acid (c-di-GMP) and 0.8 nM ³²P-c-di-GMP were incubated with various concentrations of ProF in the presence of 250 mM K⁺. Final concentration of ProF: lane 1 = 0 μM; lane 2 = 1 μM; lane 3 = 5 μM; lane 4 = 10 μM; lane 5 = 15 μM; lane 6 = 20 μM; lane 7 = 30 μM; lane 8 = 40 μM; lane 9 = 50 μM and lane 10 = 100 μM. (a) = high molecular weight aggregate and (b) = monomeric c-di-GMP.

ProF: 3,6-Diaminoacridine hydrochloride.

Figure 8.  Fluorescence melting of the complex formed between cyclic diguanylic acid and thiazole orange or 3,6-diaminoacridine hydrochloride in the presence of different cations.

Condition: [c-di-GMP] = 100 μM, [ProF or TO] = 10 μM, [Na⁺, K⁺ or Li⁺] = 250 mM in 50 mM Tris-HCl (pH = 7.5). The pH of Tris is known to slightly fluctuate with temperature. As a control, melting experiment was also performed in MOPS buffer and similar melting trend was also observed, see Supplementary Figure 6. The melting of ProF itself as control was included in Supplementary Information (see Supplementary Figure 7). (A) Melting of c-di-GMP/ProF polymer in the presence of Li⁺; (B) melting of c-di-GMP/ProF polymer in the presence of Na⁺; (C) melting of c-di-GMP/ProF polymer without added cation; (D) melting of c-di-GMP/ProF polymer in the presence of K⁺; (E) melting of c-di-GMP/TO polymer in the presence of Na⁺; (F) melting of c-di-GMP/TO polymer in the presence of K⁺.

c-di-GMP: Cyclic diguanylic acid; ProF: 3,6-Diaminoacridine hydrochloride; TO: Thiazole orange.

Figure 9.  Kinetics of cyclic diadenylic acid/coralyne complex formation.

Condition: C-di-AMP (10 μM), KI (3 mM) and buffer (50 mM Tris-phosphate [pH 7.5]) were heated up at 95°C for 5 min. Coralyne (10 μM) was then added and mixed well. The sample was subject to fluorescence monitoring at 25°C over 5 min. Excitation: 420 nm and emission: 475 nm.

C-di-AMP: Cyclic diadenylic acid.

Figure 10.  Intercalator-mediated dinucleotide aggregation inhibits c-di-NMP cleavage.

(A) YybT cleavage of ³²P-c-di-AMP in the presence and absence of coralyne. (B) YybT cleavage of ³²P-c-di-GMP in the presence and absence of ProF. Condition: [YybT] = 1.5 μM, [c-di-GMP or c-di-AMP] = 10 μM (³²P labeled + unlabeled), [coralyne or ProF] = 10 or 30 μM, [KCl] = 10 mM in (B). (A) was done at 37°C for 20 min and (B) was done at 37°C for 30 min.

c-di-AMP: Cyclic diadenylic acid; c-di-GMP: Cyclic diguanylic acid; ProF: 3,6-Diaminoacridine hydrochloride.

Table 1  Intensity decay analysis of thiazole orange.

Thiazole orange	τi (ns)	fi	τavg (ns)^†	χ^2R	Relative intensity^‡	Relativeτavg
Water	2.63, 0.98, 4.57	1, 0.943, 0.057	2.63, 1.19	1.9, 1.24	0.85	1.59
1 M Na^+	2.47, <0.70>, 3.86	1, 0.984, 0.016	2.47, 0.75	2.9, 1.43	1.0	1.0
1 M Na^+ and 100 μM c-di-GMP	5.85, 4.21, 7.07	1, 0.354, 0.646	5.85, 6.06	4.2, 1.20	2445	8.08
1 M Na^+ and 25 μM hTel	3.94, 1.72, 5.04	1, 0.649, 0.351	3.94, 2.88	15.0, 1.32	530	3.84
1 M Na^+ and 25 μM c-Myc	3.54, 1.46, 5.07	1, 0.798, 0.202	3.54, 2.19	9.9, 1.47	315	2.92
1 M Na^+ and 25 μM dsDNA	2.33, 1.02, 3.06	1, 0.877, 0.123	2.33, 1.27	12.3, 1.53	370	1.69
100 mM Na^+	2.35, <0.70>, 3.96	1, 0.986, 0.014	2.35, 0.75	3.1, 1.91	0.8	1.0
100 mM Na^+ and 100 μM c-di-GMP	5.24, 2.56, 6.46	1, 0.447, 0.553	5.24, 4.72	11.3, 1.06	1380	6.29
100 mM Na^+ and 25 μM hTel	4.60, 1.97, 5.85	1, 0.569, 0.431	4.60, 3.64	15.2, 1.29	740	4.85
100 mM Na^+ and 25 μM c-Myc	3.53, 1.45, 5.03	1, 0.797, 0.203	3.53, 2.18	19.2, 1.75	340	2.91
100 mM Na^+ and 25 μM dsDNA	2.32, 1.01, 3.06	1, 0.879, 0.121	2.32, 1.26	13.5, 1.78	590	1.68

† Average lifetime τ_avg = Σ f_i τ_i, where the τ_i and f_i are decay times and fractional intensities, respectively.

‡ Intensity measured at excitation 473 nm with band pass filter 514/50 nm, normalized to intensity for sample TO in 1M Na⁺. Condition: [c-di-GMP] = 100 μM, [c-di-GMP] = 25 μM, [TO] = 3 μM, [Na⁺] = 100 mM or 1 M. hTel sequence (5′–3′): AGGGTTAGGGTTAGGGTTAGGG; c-Myc sequence (5′–3′): TGGGGAGGGTGGGGAGGGTGGGGA. dsDNA sequence (5′–3′): CGAATTTCAAAAGAAATTCG.

De N , NavarroMV, RaghavanRV, SondermannH. Determinants for the activation and autoinhibition of the diguanylate cyclase response regulator WspR. J. Mol. Biol.393(3), 619–633 (2009).

 PubMed Web of Science ®Google Scholar

Sundriyal A , MassaC, SamorayDet al. Inherent regulation of EAL domain-catalyzed hydrolysis of second messenger c-di-GMP. J. Biol. Chem.289(10), 6978–6990 (2014).

 PubMed Web of Science ®Google Scholar

Tschowri N , SchumacherMA, SchlimpertSet al. Tetrameric c-di-GMP mediates effective transcription factor dimerization to control Streptomyces development. Cell158(5), 1136–1147 (2014).

 PubMed Web of Science ®Google Scholar