An Integrated Versatile Lab-On-A-Chip Platform for the Isolation and Nucleic Acid-Based Detection of Pathogens

Figures & data

Figure 1.  MinoCard.

(A) Design of the cartridge. 1 – blister position, 2 – socket for a sample container, 3,5,6,8 – washing chambers (10 μl each), 4 – optionally washing or lysis chamber (20 μl), 7 – amplification chamber (50 μl), 9 – (optionally) hybridization chamber, 10 – waste chamber. T1–T4: positions of Peltier elements (on the external instrument). Ch1: 1.4 mm-wide channel, Ch2 – 0.4 mm-wide channel. (B) Attachment of a sample container (a syringe or a special container) to the socket.

Figure 2.  MinoLyzer.

(A) Schematic diagram of the modules of the MinoLyzer with the microfluidic cartridge. (B) The functional prototype of the instrument.

Figure 3.  Detection of S. enteritidis via loop-mediated isothermal amplification performed after the immunomagnetic pathogen isolation.

(A) On-chip real-time optical detection. (B) Reference samples processed in LightCycler^®.

Figure 4.  Detection of E. coli DNA after the immunomagnetic preconcentration, lysis and PCR on the chip.

(A) On-chip real-time optical detection. (B) Off-chip analysis of PCR products in gel electrophoresis.

S1-S3: Sample replicates; NC: Negative control (no template); PC: Positive control (0.5 ng E. coli DNA).

Figure 5.  Generation of the pH gradient (referred to the color scale left) for the DNA binding, washing and elution in the valve-free cartridge.

Figure 6.  Detection of E. coli in the full assay (bacteria preconcentration, lysis, DNA purification and PCR) on the chip.

(A) On-chip real-time optical detection. (B) Off-chip analysis of PCR products in gel electrophoresis.

*Expected position of specific PCR product (152 bp).

F1–F3: Sample replicates; NC: Negative control (no template); PC: Positive PCR control in thermocycler (5 ng E. coli DNA).

Table 1. Reaction mixes for the DNA amplification.

Reagent	Provider	Concentration	Volume, μl	Primer sequence, 5′–3′	Ref.
LAMP
Primer FIP-F2	Eurogentec, Germany	20 μM	2.25	GCGCGGCATCCGCATCAATA-TGCCCGGTAAACAGATGAGT	([16] for the six listed LAMP primers)
Primer BIP-B2	Eurogentec, Germany	20 μM	2.25	GCGAACGGCGAAGCGTACTG-TCGCACCGTCAAAGGAAC	–
Primer B3	Eurogentec, Germany	10 μM	0.25	CGGCAATAGCGTCACCTT	–
Primer F3	Eurogentec, Germany	10 μM	0.25	CGGCCCGATTTTCTCTGG	–
Primer Loop-F	Eurogentec, Germany	10 μM	2.5	GGCCTTCAAATCGGCATCAAT	–
Primer Loop-B	Eurogentec, Germany	10 μM	2.5	GAAAGGGAAAGCCAGCTTTACG	–
MgSO4, molecular biology grade	Sigma Aldrich, Germany	300 mM	0.5		–
dNTPs	PeqLab, Germany	10 mM each	3		–
Isothermal amplification buffer	New England Biolabs, Germany	10×	2.5		–
Bst polymerase	New England Biolabs, Germany	2 U/μl	2		–
EvaGreen™	Biotium, USA	20×	1		–
S. enteritidis DNA for positive control	Isolated with QIAamp DNA Mini Kit; Qiagen, Germany	63.9 ng/μl	2		–
Water, PCR grade	Jena Bioscience, Germany	-	to 25 μl^†		–
PCR
LightCycler^® 480 SYBR Green I Master Mix	Roche, Germany	2×	10		–
Forward primer uidA	Eurogentec, Germany	10 μM	1	GTTACGTCCTGTAGAAAGCCC	[17,18]
Reverse primer uidA	Eurogentec, Germany	10 μM	1	AAAACTGCCTGGCACAGCAATT	[17,18]
E. coli DNA for positive control	Isolated with QIAamp DNA Mini Kit; Qiagen, Germany	0.5 ng/μl	1		–
Water, molecular biology grade	Jena Bioscience, Germany	-	to 20 μl^†		–

^†Volumes were proportionally scaled up to 200 μl to fill the cartridge lane.

LAMP: Loop-mediated isothermal amplification.

Chen S, Wang F, Beaulieu JC, Stein RE, Ge B. Rapid detection of viable salmonellae in produce by coupling propidium monoazide with loop-mediated isothermal amplification. Appl. Environ. Microbiol. 77(12), 4008–4016 (2011).

 PubMed Web of Science ®Google Scholar

Maheux AF, Picard FJ, Boissinot M, Bissonnette L, Paradis S, Bergeron MG. Analytical comparison of nine PCR primer sets designed to detect the presence of Escherichia coli/Shigella in water samples. Water Res. 43(12), 3019–3028 (2009).

 PubMed Web of Science ®Google Scholar

Bej AK, DiCesare JL, Haff L, Atlas RM. Detection of Escherichia coli and Shigella spp. in water by using the polymerase chain reaction and gene probes for uid. Appl. Environ. Microbiol. 4, 1013–1017 (1991).

 Google Scholar