The Characterization of Human Oral Mucosal Fibroblasts and Their Use As Feeder Cells in Cultivated Epithelial Sheets

Figures & data

Figure 1.  Isolation of human oral mucosa middle interstitial tissue fibroblasts and analysis of differentiation.

(A) Phase-contrast micrographs showing temporal changes in clonal human oral mucosa middle interstitial tissue fibroblast growth in 0.8% methylcellulose culture for 2 weeks. Scale bar: 20 μm. (B) Hematoxylin and eosin staining on day 14 of (A). Scale bar: 20 μm. (C & D) Flow cytometry analysis of expression of CD56 (C) and PDGFRα (D). White histogram: isotype control; gray histogram: marker expression. Cell counts (number of cells) and fluorescence intensity are indicated on the ordinate and abscissa, respectively. (E) Association between differentiation and the expression of CD56 and PDGFRα. Ratios of CD56- and PDGFRα-positive cells are indicated on the ordinate and abscissa, respectively. Dots indicate each clone with (circles) or without (crosses) of one or more differentiated lineages. (F & G) Ratio of CD56- (F) or PDGFRα- (G) positive cells with (Dif+) or without (Dif-) differentiated lineage. Ratio of positive cells is indicated on the ordinate. Error bars and asterisks indicate SD (Dif+, n = 7; Dif-, n = 9) and p-values (CD56, p = 0.048; PDGFRα, p = 0.005), respectively.

Table 1.  Antibodies for flow cytometric analysis.

Antibody			Clone	Isotype	Company
Adhesion molecules	CD31	Platelet endothelial cell adhesion molecule-1	JC70A	Ms-IgG1	Dako Cytomation
	CD44	Hyaluronate receptor	2C5	Ms-IgG2a	R&D Systems, Inc.
	CD56	NCAM	N901[NKH-1]	Ms-IgG1	IOTest
	CD146	MCAM	128018	Ms-IgG1	R&D Systems, Inc.
	CD166	Alcam	105902	Ms-IgG1	R&D Systems, Inc.
Growth factors and cytokine receptors	CD105	Endoglin	166707	Ms-IgG1	R&D Systems, Inc.
	PDGFRα	Platelet-derived growth factor receptor alpha polypeptide, mesenchymal cell mitogen receptor	PRa292	Ms-IgG1	R&D Systems, Inc.
Hematopoietic markers	CD14	LPS receptor	RMO52	Ms-IgG2a	IOTest
	CD34	Hematopoietec stem cell marker	563	Ms-IgG1	BD
	CD45	Leukocyte antigen	2D1	Ms-IgG1	R&D Systems, Inc.
Others	CD73	5′-Terminal nucleotidase	AD2	Ms-IgG1	BD
	CD90	Thy-1	Rhy-1A1	Ms-IgG2a	R&D Systems, Inc.
	STRO-1	Bone marrow stromal cells, erythroid precursors and dental pulp	Stro-1	Ms-IgGM	R&D Systems, Inc.
	FSP-1	Fibroblast specific protein-1 (S100A4)	–	Rabbit IgG	Dako Cytomation

LPS: Lipopolysaccharide; MCAM: Melanoma cell adhesion molecule; NCAM: Neural cell adhesion molecule.

Table 2.  Antibodies for immunostaining and Western blot.

Antibody		Clone	Isotype	Company
Collagen type II	Fibril-forming interstitial collagen, articular cartilage marker	II-4C11	Ms-IgG1	MP Biomedicals
NFM	Neurofilament heavy chain, neuron-specific protein	NF-09	Ms-IgG2a	Abcam
βIII-tubulin	Tubulin b-4, neuron-specific marker	TuJ-1	Ms-IgG2a	R&D Systems, Inc.
Keratocan	Small leucin-rich proteoglycan, expressed cornea stroma	–	Goat IgG	SantaCruz
Keratin 3	Corneal epithelium differentiation marker and palate epithelium marker	AE5	Ms-IgG1	PROGEN
Keratin 12	Corneal epithelium differentiation marker	–	Rabbit IgG	TransGenic, Inc.
Collagen Type IV	Basement membrane collagen, basement menbrane component of corneal limbal epithelial cells	–	Goat IgG	Southern Biotec
Laminin	Extracelluar matrix, basement menbrane component of corneal epithelial cells	NU-01-LA3	Ms-IgG1	Cosmo Bio
Occludin	Tight junctions protein for barrier function of both epithelial and endothelial cells	OC-3F-10	Ms-IgG1	Invitrogen
ZO-1	Tight junctions-associated proteins link between the cytoskeleton and the tight junction	ZO1-1A12	Ms-IgG1	Invitrogen
Ki67	Nuclear protein expressed during all active phases of the cell cycle (G1, S, G2, M)	MIB-1	Ms-IgG1	Dako Cytomation
Ms-IgG1	Negative control mouse IgG1	DAK-GO1		Dako Cytomation
Ms-IgG2a	Negative control mouse IgG2a	DAK-GO5		Dako Cytomation
Goat IgG	Normal goat IgG	–		SantaCruz
Rabbit IgG	Normal rabbit IgG	–		Dako Cytomation

Table 3.  Primer sequences and product size of reverse transcription polymerase chain reaction.

Primer		Sequence (5′→3′)	Product size (bp)
ALP	Alkaline phosphatase, hydrolase enzyme	GGCGGCAGACTTTGGTTT	552
		CCCGTGGCAACTCTATCTT
OPN	Osteopontin, bone sialoprotein 1	TGGCTAAACCCTGACCCATCTC	548
		TAACTGTCCTTCCCACGGCTGT
PPAR-γ2	Peroxisome proliferator-acticated receptor-gamma2, adipocyte-specific transcription factor	GGTCAGCGGGAAGGACTTTA	516
		GATCCAGTGGTTGCAGATTA
Leptin	Adipose-derived hormones	GCCAGAGTTCCTTCCCTTAA	508
		CAAGCTGTGCCCATCCAAAA
Aggrecan	Chondroitin sulfate proteoglycan 1	TCCTGGAAGCTCTTCTCAGT	510
		ATGCCCAAGACTACCAGTGG
BMP-6	Bone morphogenetic protein-6, chondrogenic marker	CTCGGGGTTCATAAGGTGAA	451
		ACCGCATAACATGGGGCTTC
Nestin	Neural stem cell marker, type VI intermediate filament	GCGTTGGAACAGAGGTTGGAG	385
		GCACAGGTGTCTCAAGGGTAG
NFH	Neurofilament heavy chain, neuron-specific protein	TGAACACAGACGCTATGCGCTCAG	398
		CACCTTTATGTGAGTGGACACAGAG
βIII-tubulin	Tubulin β-4, neuron-specific marker	GTCTTACGAGGAGCTGCAGACGCA	233
		CCACATAGCTGCAGCTTGCCATCT
ALDH3A1	Aldehyde dehydrogenase 3 family member A1	ACTCAGCAGGACGAGCTCTAC	495
		GGGTCACAGAGGATGTAGTC
Lumican	SLRP family/Class II subfamily of proteins	CCACAACAACCTGACAGAGTGT	488
		CAAGTTGATTGACCTCCAGG
Keratocan	Cornea-specific KSPG	CCTCCAAGATTACCAGCCAA	367
		TTCCATCCAGACGGAGGTAG
Keratin 3	Corneal epithelium differentiation marker and palate epithelium marker	GACAATAATCGTTCCCTGG	434
		TTGCGGTAGGTGGCGATCT
Keratin12	Corneal epithelium differetiation marker	CAACGACATGAGGGCGCA	481
		AATTGACTGTGCTTGAGA
Keratin14	Stratified squamous epithelial marker	ACTACCTGCAGCCGCCAGTT	1417
		CAGTTCTTGGTGCGAAGGAC
Collagen type IV	Collagen type IV, basement membrane component	ATACCTGGAAGGGCAAGAGAA	484
		TGGCACCGGCTGATTTTCTGG
Laminin	Extracellular matrix protein	TGCGAGCATGTCAGGATTTC	961
		TCAGTTCCAACTCTCCCATTG
GAPDH	Glyceraidehyde-3-phosphate dehydrogenase, internal control	ACCACAGTCCATGCCATCAC	452
		TCCACCACCCTGTTGCTGTA

KSPG: Keratan sulfate proteoglycan; SLRP: Small leucine-rich proteoglycan.

Figure 2.  Induction of differentiation into mesenchymal cells.

(A) ALP staining, (B) ARS staining, (C) oil red O staining, (D) safranin O staining and (E) immunohistochemistry of Coll II in noninduced (upper panel) and induced (lower panel) human oral mucosa middle interstitial tissue fibroblasts. Scale bars: 50 μm. Reverse transcription-PCR analysis shows (F) osteogenic (ALP, OPN), (G) adipogenic (PPAR-γ, leptin) and (H) chondrogenic (BMP-6, aggrecan)-specific gene expression. Primers used are listed in Table 3. GAPDH was used as an internal control. Left lane: noninduced human oral mucosa middle interstitial tissue fibroblasts; right lane: induced human oral mucosa middle interstitial tissue fibroblasts.

ALP: Alkaline phosphatase; ARS: Alizarin red S; Aggr: Aggrecan; Coll II: Collagen type II; GAPDH: Glyceraldehyde-3-phosphate dehydogenase; OPN: Osteopontin; PPAR-γ: Peroxisome proliferator-activated receptor-γ.

Figure 3.  Expression of characteristic human oral mucosa middle interstitial tissue fibroblasts markers by flow cytometry.

Antibodies for flow cytometric analysis are listed in Table 1. White histogram: isotype control; gray histogram: marker expression indicated at the upper right of each panel. Cell counts (number of cells) and fluorescence intensity are indicated on the ordinate and abscissa, respectively. Numbers in panels indicate the positive rate.

Figure 4.  Expression of early neural crest (Twist1, Sox9, Snail1 and Snail2), ectomesenchymal (MSX2 and DLX6) and neural markers.

(A–I) Real-time PCR of early neural crest (Twist1, Sox9, Snail1, Snail2, CD56 and PDGFRα), ectomesenchymal (MSX2 and DLX6) and neural stem cell (nestin) markers. Y-axis indicates relative expression compared with the control group levels (hMSCs), which were normalized to 1. Error bars indicate SD (n = 4). (J) Phase-contrast images of noninduced (upper panel) and induced (lower) hOMFs. (K & L) Immunocytochemical staining of βIII-tubulin (K) and NFM (L). Noninduced (upper panel) and induced (lower) hOMFs. Nuclei were stained with 4′,6-Diamidino-2-phenylindole (DAPI). Scale bars: 50 μm.

hMSC: Human mesenchymal stem cell; hOMF: Human oral mucosa middle interstitial tissue fibroblast; NFM: Neurofilament medium.

Figure 5.  Differentiation of human oral mucosa middle interstitial tissue fibroblasts into cells with a keratocyte phenotype.

(A) Illustrated cultivation methods of hOMFs with hLE cells and hLS cells. (B) Comparison of keratocyte phenotype in each cell type by reverse transcription PCR. GAPDH was used as an internal control. (a) hOMFs alone. (b) hOMFs cocultured with hLE. (c) hOMFs cocultured with hLS. (d) hLS cocultured with hOMFs.

GAPDH: Glyceraldehyde-3-phosphate dehydogenase; hLE: Human limbal epithelial cell; hLS: Human limbal stromal cell; hOMF: Human oral mucosa middle interstitial tissue fibroblast.

Figure 6.  Cultivation of human limbal epithelial sheets with two types of feeder cells.

(A) Illustrated cultivation methods of human limbal epithelial sheets. (B) Phase-contrast micrographs of epithelial sheets with 3T3 (left panel) and hOMF (right panel) feeder cells. Scale bars: 50 μm. (C) Photographs of both types of human limbal epithelial sheets. (D) Macroscopic view of both types of human limbal epithelial sheets after removing culture inserts. (E) Comparison of both types of human limbal epithelial sheet phenotypes by reverse transcription polymerase chain reaction. GAPDH was used as an internal control. (F) Histochemical comparison of the phenotypes of both types of human limbal epithelial sheets. Arrowheads indicate occludin expression. Scale bars: 50 μm. (G) Comparison of CFE in each sheet. Colonies were stained with rhodamine B after 2 weeks.

CFE: Colony-forming efficiency; GAPDH: Glyceraldehyde-3-phosphate dehydogenase; H.E.: Hematoxylin & eosin; hOMF: Human oral mucosa middle interstitial tissue fibroblast; SHEM: Supplemental hormonal epithelial medium.