MiRNA-21

Figures & data

Table 2. List of deregulated miRNAs at > 1.5-fold in A549/CDDP vs. A549 cells

Upregulated		Downregulated
miRNA ID	Average fold change	miRNA ID	Average fold change
hsa-miR-21	1.61	hsa-miR-378	0.56
hsa-miR-31	4.71	hsa-miR-27a*	0.67
hsa-miR-96	1.64	hsa-miR-886–5p	0.35
hsa-miR-374b	1.52	hsa-miR-148b	0.43
hsa-miR-192	1.53	hsa-miR-520c-3p	0.64
hsa-miR-339–5p	1.54	hsa-miR-623	0.63
hsa-let-7b*	1.57	hsa-miR-302b*	0.64
hsa-miR-611	1.50	hsa-miR-943	0.64
hsa-miR-1308	2.56	hsa-miR-636	0.62
hsa-miR-1206	1.55	hsa-miR-886–3p	0.35
		hsa-miR-1184	0.64

Figure 1. Comparison between microarray and qRT-PCR. The bars indicate the fold change which was determined for the expression ratio of A549/CDDP vs. A549. Results from all seven comparisons are consistent.

Figure 2. Effects of miR-21 on drug sensitivity of NSCLC cells. (A) Effects of anti-miR-21 on A549/CDDP cells. Transfection of the A549/CDDP cells with anti-miR-21 increases their sensitivity to platinum treatment. (B) Effects of pre-miR-21 on A549 cells. Transfection of the A549 cells with pre-miR-21 decreases their sensitivity to platinum treatment.

Table 3. Comparison of several clinicopathologic factors and miR-21 expression level in 58 NSCLC patients undergone adjuvant platinum based chemotherapy

Factors	All patients (n = 58)	miR-21 expression		p value^a
		Higher expression	Lower expression
Age				0.426
< 60yr	33	15	18
≥ 60yr	25	14	11
Sex				0.291
Male	32	14	18
Female	26	15	11
Histological type^b				0.672
Squamous	24	11	13
Adeno	33	17	16
Differentiation				0.350
Well	5	1	4
Moderate	21	11	10
Poorly	32	17	15
p-TNM stage^c				0.633
StageI	16	7	9
StageII	15	7	8
StageIII	26	15	11
Lymphatic invasion				0.291
Yes	32	18	14
No	26	11	15
Chemotherapy response
Resistance	22	16	6	0.007*
sensitivity	35	13	22
Current status^d
Dead	9	6	3	0.467
Alive	47	22	25

a, Chi-square test. b,one patient with adenosquamous carcinoma was excluded in this test. c,one patient atTNM stage IV was excluded in this test. d, two patients with unknown survival status were excluded in this test.

Figure 3. Kaplan-Meier estimation of Disease Free Survival time (DFS) of NSCLC. (A) DFS analysis of patients according to the miR-21 relative expression. The expression levels of miR-21 in 58 patients were measured by Real-time PCR. High expression is based on the median values of miR-21 relative expression. High miR-21 expression (p = 0.008) had a significant relationship with patient’s shorter DFS. (B) DFS analysis of patients according to their clinical stage. Patients were classified as either early or late clinical stage. Clinical stage had a significant relationship with patient’s DFS (p = 0.026). (C) DFS analysis of patients according to their lymph node status. Patients classified as either lymph node metastasis positive or negative. Lymph node metastasis was found to be strongly associated with poor outcome (p = 0.007). Log-rank p values are from Kaplan-Meier analysis. (D) DFS analysis of patients according to the miR-21 relative expression in plasma samples of 32 patients. The increased expression level of miR-21 in plasma is marginally associated with shorter DFS (p = 0.138).

Table 4. Univariate and multivariate analysis for factors related to DFS using the COX proportional hazard model

Factor		Univariate analysis		Multivariate analysis
		HR (95% CI)	P value	HR (95% CI)	P value
miR-21	High vs low	3.265 (1.276–8.357)	0.014*	2.820(1.091–7.285)	0.032*
TNM stage	III vs II vs I	2.090 (1.153–3.791)	0.015*	1.367(0.485–3.857)	0.554
Sex	Female vs male	0.996 (0.430–2.308)	0.993
Age	> = 60 vs < 60 y	0.717 (0.301–1.710)	0.453
Histological grade	III vs II vs I	1.745(0.836–3.642)	0.138
Tumor diameter	> = 5cm vs < 5cm	1.687 (0.716–3.976)	0.232
Lymph node status	Positive vs negative	3.532 (1.300 -9.595)	0.013*	2.027(0.346–11.853)	0.433
Histological type	Squamous vs adeno	1.045(0.440–2.483)	0.920

Table 5. Correlation of miR-21 expression levels between plasma samples and corresponding primary tumor tissue samples

	Tumor
	High miR-21	Low miR-21	Case number
Plasma
High miR-21	11	5	16
Low miR-21	5	11	16
Case number	16	16	32

Correlation coefficient, 0.375, p = 0.034.

Figure 4. Expression of PTEN and BCL-2 in the A549 and A549/CDDP cells assessed by western blot after transfected with either scrambled or pre-miR-21 and anti-miR -21 expression. (A) The effects of miR-21 on the expression of PTEN and BCL-2 in A549 cells. Transfection of A549 cells with pre-miR-21 resulted in a decrease of PTEN levels and an increase of Bcl-2. (B) The effects of miR-21 on the expression of PTEN and BCL-2 in A549/CDDP cells. Transfection of A549/CDDP cells with anti-miR-21 resulted in an increase of PTEN levels and a decrease of Bcl-2. Sham: A549 or A549/CDDP without transfection; Negative control: A549 or A549/CDDP with transfection of Anti-miR and Pre-miR.

Table 1. RT primers for amplification of the human mature miRNAs used in validation of microRNA microarray results

miRNA name	RT primer
U6	5′CGCTTCACGAATTTGCGTGTCAT3′
miR-374b	5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCACTTA3′
miR-31	5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAGCTAT3′
miR-21	5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCAACAT3′
miR-378	5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCCTTCTG3′
miR-886–5p	5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCCGCTT3′
miR-886–3p	5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAAGGGTC3
miR-520c-3p	5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACCCTC3′