Allelic discrimination of genetic human prion diseases by real-time PCR genotyping

Figures & data

Figure 1 PRNP genotypes vs Ct (M129-178/200 wildtype, circles; M129-178/200 mutant, squares; V129-178/200 wildtype, triangles and V129-178/200 mutant, rhombus and negative controls, NC).

Figure 2 Amplification plots (cycle vs ΔRn) in a StepOne Real-Time PCR System of the different PRNP genotypes (M129-178/200 wildtype in red, M129-178/200 mutant in green, V129-178/200 wildtype in blue and V129-178/200 mutant in magenta). ΔRn is an indicator of the magnitude of the signal generated by the PCR reaction.

Figure 3 Performance of the allelic discrimination protocol for the M129V-D178N genetic background as a function of the initial DNA amount vs Ct (M129-178 wildtype, circles; M129-178 mutant, squares; V129-178 wildtype, triangles; V129-178 mutant, rhombus).

Figure 4 Performance of the allelic discrimination protocol for the M129V-E200K genetic background as a function of the initial DNA amount vs Ct (M129-200 wildtype, circles; M129-200 mutant, squares; V129-200 wildtype, triangles; V129-200 mutant, rhombus).

Table 1 Nucleotide sequence and characteristics of the primers used for PRNP genotyping

Primer	Positions	Orientation	Nucleotide sequence 5′-3′	Genotype	Tm (°C)	G + C (%)	Length (bp)
1	25819–25834	Forward	GGCCTTGGCGGCTACA	M129	57.8	69	16
2	25820–25834	Forward	GCCTTGGCGGCTACG	V129	55.8	73	15
3	25981–26004	Reverse	CTTGATTGTGATATTGACGCAGTC	D178	57.5	42	24
4	25981–26004	Reverse	CTTGATTGTGATATTGACGCAGTT	N178	57.0	38	24
5	26047–26068	Reverse	CCATCATCTTAACGTCGGTCTC	E200	57.3	50	22
6	26047–26068	Reverse	CCATCATCTTAACGTCGGTCTT	K200	56.9	45	22

The polymorphic and mutated bases are in bold and underlined, respectively.

Table 2 Reaction mixtures and lengths of the amplification products expected for PRNP genotyping

Reaction	Forward	Reverse	Length (bp)
M129-D178	Primer 1	Primer 3	186
M129-N178	Primer 1	Primer 4	186
V129-D178	Primer 2	Primer 3	185
V129-N178	Primer 2	Primer 4	185
M129-E200	Primer 1	Primer 5	250
M129-K200	Primer 1	Primer 6	250
V129-E200	Primer 2	Primer 5	249
V129-K200	Primer 2	Primer 6	249