Sex differences in single IVF-derived bovine embryo cultured in chemically defined medium

Peer review under responsibility of Faculty of Veterinary Medicine, Cairo University.

Abstract

Single embryo culture is essential for culturing embryos derived from few oocytes obtained from elite cows through ultrasonography guidance. Bovine in vitro fertilization (IVF) and individual embryo culture is a challenge as it generally leads to impaired embryo development. In this study, we explored the embryonic development and the sex ratio of IVF-derived bovine embryo cultured individually in chemically defined two-step culture medium. Total 63 cumulus-oocyte complexes were collected, in vitro matured, in vitro fertilized and the resultant fertilized oocytes were randomly cultured individually (4 trials, 15–16 oocytes each) in microdrops of 5 µL of a chemically defined two-step culture medium. Blastocysts were counted in every trial (n = 32, 50.79%) and all of them were used for both genomic DNA and total RNA extraction, cDNA synthesis and PCR using specific primers for GAPDH, GDP6, XIST and SRY genes. Results showed significant difference in expression of XIST (positive expression in 11 blastocysts) and SRY (positive expression in 21 blastocysts) mRNAs, P < .05. This result supports the hypothesis of sexual dimorphism among the pre-implantation in vitro produced embryos and provides an efficient medium for single bovine embryos in vitro production.

Keywords:

• Blastocyst
• Bovine
• In vitro fertilization
• PCR
• Single embryo culture

1 Introduction

Single bovine embryo in vitro culture is a challenge but it is essential for culturing embryos derived from oocytes where obtained from elite cows through ultrasonography guidance. Several researchers reported the beneficial effect of group culture medium for bovine in vitro produced embryos [1–5], while the demand for improving single embryo culture is essentially needed for accurate study of the early embryonic development [6,7], and for toxicity screening [8–11]. Therefore, extensive research was performed to improve single embryo culture through co-culturing with somatic [10,12] or embryonic cells [13].

We have previously shown that in vitro embryonic development and the yield of cloned, transgenic embryos and viable calves were increased by using a two-step chemically defined medium for IVF-derived bovine embryos [14–18].

In the current study, we explored the embryonic development and the sex ratio of IVF-derived bovine embryo cultured individually in a chemically defined two-step culture medium using genomic DNA marker and RT-PCR.

2 Materials and methods

2.1 Chemicals

Unless otherwise stated, all chemicals and hormones were purchased from Sigma-Aldrich Corp. (St. Louis, MO, USA).

2.2 Oocyte collection and in vitro maturation (IVM)

Ovaries were collected from a slaughterhouse into NaCl solution 0.9% at 30–33 °C and transported to the laboratory within 2–3 h. Cumulus-oocyte complexes (COCs) from follicles 2–8 mm in diameter were aspirated using an 18-gauge needle attached to a 10 mL disposal syringe. The COCs with evenly-granulated cytoplasm and enclosed by more than three layers of compact cumulus cells were selected, washed three times in HEPES-buffered tissue culture medium-199 (TCM-199; Invitrogen, Carlsbad, CA, USA), supplemented with 10% FBS, 2 mM NaHCO3, and 1% penicillin–streptomycin (v/v). For IVM, COCs were cultured in four-well dishes (30–40 oocytes per well; Falcon, Becton-Dickinson Ltd., Plymouth, UK) for 24 h in 450 μL TCM-199 supplemented with 10% FBS, 0.005 IU/mL FSH (Antrin, Teikoku, Japan), 100 µM Cysteamine and 1 μg/mL 17β-estradiol at 39 °C in a humidified atmosphere of 5% CO2.

2.3 Sperm preparation, in vitro fertilization (IVF) and in vitro culture of embryos (IVC)

Motile spermatozoa were purified and selected using the Percoll gradient method [19]. Briefly, spermatozoa were selected from the thawed semen straws by centrifugation on a Percoll discontinuous gradient (45–90%) for 15 min at 1500 rpm. The 45% Percoll solution was prepared with 1 mL of 90% Percoll (Nutricell, Campinas, SP, Brazil) and 1 mL of capacitation-TALP (Nutricell) [20]. The sperm pellet was washed two times with capacitation-TALP by centrifugation at 1500 rpm for 5 min. The active motile spermatozoa from the pellet used for insemination of matured oocyte (At 24 h of IVM). Following maturation, COCs were randomly distributed in 30 μL microdrops of IVF-TALP medium (Nutricell) and were then inseminated (day 0) with 1–2 × 10⁶ spermatozoa/mL for 18 h. Each microdrop contained two COCs and overlaid with mineral oil at 39 °C in a humidified atmosphere of 5% CO₂. In vitro culture (IVC) dishes were labelled and numbered to specifically monitor the individually cultured embryos. Presumptive zygotes were denuded and cultured individually in 5 µL two-step defined culture medium (first 5 days with stage-1 medium then transferred to the later stage medium [16]) overlaid with mineral oil and incubated at 39 °C in an atmosphere of 5% O₂, 5% CO₂ and 90% N₂. Cleavage and blastocyst rates were recorded on days 2 and 7, respectively.

2.4 Sex determination with genomic DNA and expression of sex-specific mRNA transcripts in single embryo by RT-PCR

Each blastocyst was washed in TALP medium then transferred into 5 μL of diethylpyrocarbonate (DEPC) treated water (Invitrogen) and stored at −80 °C. Individual embryos were transferred into 100 μL Trizol reagent and mixed very well then were divided (50 μL each) into genomic DNA or total RNA extraction procedures according to specific kits (Qiagen, Valencia, CA, USA) according to the manufacturer’s instruction [14,21]. Specific primers were used to amplify Y-specific segment from the extracted genomic DNA by PCR (Table 1). Different somatic cell lines were used [from transgenic male cow (Tet_M); brain of male cow (B-M); and from a female cow (Fem)] to examine the primers efficiency for Y-specific segment amplification. Reverse transcription was carried out at 50 °C for 50 min. Individual RT reaction was performed using random hexamer and superscript TM III reverse transcriptase (Invitrogen) in a 20 μL reaction. 10 ng cDNA subjected to reverse transcription-polymerase chain reaction (RT-PCR) using Maxime PCR PreMix kit-i-starTaq (Intron Biotech., Seoul, Republic of Korea) and 1 pM of forward and reverse primers. Duplex PCR was used for identification of SRY and XIST in the same cDNA sample. Primer sequences, annealing temperatures and approximate size of the amplified fragments are listed in Table 1. The PCR amplification carried out for one cycle of denaturation at 95 °C for 5 min and subsequent 42 cycles with denaturation at 95 °C, annealing for 30 s, extension at 72 °C for 45 s and final extension at 72 °C for 5 min. and then ten μL of PCR products were fractioned on 1% agarose gel (Intron Biotech.) and stained with RedSafe ^TM (Intron Biotech.).

Table 1 Primers used for reverse transcription PCR (RT-PCR) and genomic PCR analysis.

Gene	F	R	Size bp (Tm °C)	Accession No.
RT-PCR
G6PD	CAAGATGATGACCAAGAAGC	GGAGTGAAGATCCGCCAG	195 (55)	NM_001244135.1
XIST	TTGGCTTTTAGATTAATTTGATGAACAGCAT	CCCTTTAGACTAGGCCCATTTCATA	99 (60)	NR_001464.2
SRY	CGTCAAGCGACCCATGAACGC	TGGCACAACCATCCCTGTATG	329 (60)	EU294189.1
GAPDH	TGCACCACCAACTGCTTGGC	CACGTTGGGAGTGGGGACGC	267 (60)	NM_001034034.2
Genomic
Y-specific^*-1	CATGGCACACTCACAGACCAG	GTTTGGTAGGGGATGTCTGTAG	167 (55)	AB471782.1
Y-specific^*-2	CATGGCACACTCACAGACCAGA	GTTTGGTAGGGGATGTCTGTAGGAC	167 (55)	AB471782.1

* Y-specific: Y chromosome specific STS marker BovY4.

2.5 Statistical analysis

The percentage of male to female embryos was analyzed by Pearson’s chi-squared test. Value of P < .05 was considered statistically significant.

3 Results & Discussion

Cleavage rate of embryos was 90.4% (n = 57/63) and the blastocyst ratio was 50.79% (n = 32/63). This result clearly clarify that chemically defined medium significantly improved the development of single bovine embryos when compared with undefined medium, such as modified synthetic oviductal fluid (mSOF) reported in previous studies [1,4,5,22] that showed detrimental effects of single embryo culture in undefined medium conditions. Among the 32 studied blastocysts, genomic DNA analysis for Y-chromosome specific STS marker BovY4 showed clearly positive bands in 19 blastocysts while it was faintly amplified in embryo #17 (Fig. 1). This result might indicate the minute amount of isolated genomic DNA from blastocyst by the current protocol or the differences in cell numbers between the isolated blastocysts [14] that will affect the yield of the isolated genomic DNA. On the other hand, RT-PCR showed expression of mRNA transcripts of GAPDH and G6PD in all examined blastocysts. Moreover, significant difference in sex ratio was observed (P = .02); XIST mRNA was expressed in 11 blastocysts (34.4%), SRY was expressed in 21 blastocysts (65.6%). Fig. 2 is representing the expression of SRY and XIST mRNA transcripts in nine embryos randomly selected from the resultant blastocysts. This result might indicate a sexual dimorphism and difference in tolerance of blastocysts of different sexes. A result coincides with Pegoraro et al. [23] who also observed that the percentage of male embryos was increased over female ones when embryos were co-cultured with feeder cells. Moreover, Mittwoch [24] demonstrated that XY embryos can grow faster than XX embryos in vitro. We showed that both genomic DNA a RNA can be isolated from single blastocysts, however due to the little amount of resultant DNA, we recommend improving the protocol of amplification of such minute amount of genomic DNA to give satisfactory results. Other researchers improved the DNA amplification used different kind of PCR protocol such as loop-mediated isothermal amplification (LAMP) [25,26].

Fig. 1 Representative image of gel electrophoresis showing validation of amplification of Y-specific segment by PCR. A. Validation of Primer 1 and 2 (Table 1) in genomic DNA isolated from different somatic cell lines; Tet_M (transgenic male cow); B-M (brain of male cow); and Fem (female cow). B. Positive amplification of Y-specific segment by primer 2 in embryos #1, and #19 with faint expression of #17. C. Positive amplification of Y-specific segment by primer 2 in embryos #24 #27 and #30. Neg means PCR reactions without cDNA template.

Fig. 2 Representative image of gel electrophoresis showing the expression of SRY and XIST transcripts in randomly selected 9 embryos (#1, 14, 17, 19, 21, 24, 27, 28, and 30) with their expression of GAPDH and G6DP transcripts.

The current study supports the beneficial effects of two-step defined culture medium for single IVF-derived bovine embryo culture which can reach ∼50% blastocyst formation and provides a cues for further studying the sexual dimorphism of early embryo in vitro development in bovine.

Competing interests

The author declares no conflicts of interest regarding the publication of this paper.

Acknowledgement

The authors extended their appreciation to Dr. Woojae Choi for his technical help.

Notes

Peer review under responsibility of Faculty of Veterinary Medicine, Cairo University.