Simple sequence repeat (SSR) markers for New Zealand mānuka (Leptospermum scoparium) and transferability to kānuka (Kunzea spp.)

ABSTRACT

A multi-allelic genetic marker resource for future genetics studies in mānuka (Leptospermum scoparium) and its close relatives has been developed by mining simple sequence repeats (SSR) from a preliminary draft genome assembly of L. scoparium ‘Crimson Glory’. In total, 469 and 169 trinucleotide and dinucleotide repeats, respectively, were detected in a set of 89,619 predicted gene models. Polymerase chain reaction primer pairs were designed for 32 loci exhibiting high sequence similarity to Eucalyptus grandis. These 32 primer pairs were screened over a population of mānuka and 3 accessions of sympatric, related kānuka (genus Kunzea). The 15 polymorphic SSR markers that were successfully developed are now available for genetic analysis in Myrtaceae.

KEYWORDS:

• Myrtaceae
• Eucalyptus
• Leptospermum
• L. scoparium
• mānuka
• microsatellite
• DNA
• New Zealand

Introduction

Mānuka (also known as kahikatoa) (Leptospermum scoparium J.R. Forst. et G. Forst. var. scoparium; Myrtaceae) is one of the most widespread indigenous woody plants in New Zealand. Within New Zealand, mānuka ranges from the Three Kings Islands south through the main islands to Stewart Island and east to the Chatham Islands (Allan 1961). Throughout that range it occupies a wide altitudinal range and a diversity of life zones, including coastal, sub-alpine and geothermal areas, exhibiting a corresponding spatial variation of growth form and chemistry (Perry et al. 1997; Douglas et al. 2004; Stephens et al. 2005). To date, vital knowledge on mānuka genetic diversity is missing, including understanding about how populations are structured, evolve and reproduce across New Zealand. We need to develop an understanding of its New Zealand-wide genetic diversity, which is crucial not only for effective management of the mānuka plantings that are expected to drive the future growth of the mānuka honey industry, but also for the maintenance of the natural diversity of New Zealand mānuka. Genetic markers are useful tools for such analyses of genetic diversity, as well as for genetic mapping, seedling genotype certification and traceability, and certification of plant origin for nurseries.

Simple sequence repeats (SSR) are an attractive marker class for application in genetic diversity analysis, as they are multi-allelic and highly reproducible (Morgante & Olivieri 1993). An efficient way of developing SSR markers is to search for tandemly repeated motifs in sequence databases; numerous successful examples of SSR marker development from in silico searches of cDNA and whole genome sequences have been published in the last 15 years in a wide range of organisms (Varshney et al. 2005), including tree species of the Myrtaceae family (Faria et al. 2010).

We describe the search of a preliminary draft genome assembly of L. scoparium ‘Crimson Glory’ for SSR motifs and the development of a set of polymerase chain reaction (PCR) primer pairs that were screened over a population of New Zealand mānuka and three accessions of sympatric and phylogenetically related kānuka (Kunzea spp.) (de Lange 2014), to identify a set of polymorphic SSR markers suitable for genetic analysis of New Zealand Myrtaceae family members.

Material and methods

SSR detection in a draft mānuka genome

The predicted protein-coding gene models of a pre-release draft genome assembly of L. scoparium ‘Crimson Glory’ were searched for SSR motifs using Bioview (Crowhurst et al. 2006) and repeated motifs with more than 8 and 12 tri- and dinucleotide motifs respectively were selected. These sequences were then compared with the genomic sequence of Eucalyptus grandis and those with high similarity (BLASTN E value <10⁻²⁰) were identified.

Plant material and DNA extraction

Fresh leaf material was sampled from mānuka plants grown at Plant & Food Research, Palmerston North, New Zealand, and from kānuka plants growing in the wild. The 41 mānuka accessions (Table 1) comprised 33 open-pollinated seedlings collected from 5 regions across New Zealand (Canterbury, East Cape, Manawatu, Waikato and Northland) and 7 ornamental Leptospermum cultivars. The cultivar ‘Crimson Glory’ was included because this is the accession that was the subject of genome sequencing. In addition, one specimen of each of three kānuka species (Kunzea linearis, K. robusta and K. triregensis (de Lange 2014)) were included in the analysis. Leptospermum scoparium selections from the wild and named cultivars have mostly been shown to be diploid, although both triploid and tetraploid plants have been identified (Dawson 1990). The triploid cultivar ‘Martinii’ was included in this study.

Table 1. List of mānuka and kānuka accessions used for evaluating mānuka SSR.

DNA sample ID	Origin
1N44R	Canterbury
1N44T	Canterbury
1N44W	Canterbury
1N451	Canterbury
1N455	Canterbury
1N45D	Canterbury
1K881	East Cape
1K882	East Cape
1K883	East Cape
1K884	East Cape
1K885	East Cape
1N3XM	Manawatu
1N3XN	Manawatu
1N3XP	Manawatu
1N3XR	Manawatu
Veggie patch	Manawatu
Kahuterawa	Manawatu
1N404	Northland 1
1N403	Northland 1
1N409	Northland 1
1N40B	Northland 1
1N40G	Northland 1
1N40P	Northland 1
1N41F	Northland 2
1N41T	Northland 2
1N41V	Northland 2
1N41W	Northland 2
1N420	Northland 2
1N421	Northland 2
1N422	Northland 2
1N428	Northland 2
1N3ZF	Northland 1
1N3ZX	Northland 1
‘Andromeda’	Ornamental cultivar
‘Phoenix’	Ornamental cultivar
‘Crimson Glory’	Ornamental cultivar
‘Centaurus’	Ornamental cultivar
‘Ph 360’	Ornamental cultivar
‘Electric Red’	Ornamental cultivar
Leptospermum ‘Martinii’	Ornamental cultivar
L. aff. scoparium	Waikato
Kunzea triregensis	Manawa Tawhia (Three Kings Islands group)
K. robusta	Auckland
K. linearis	Auckland

Note: All plants except the kānuka selections are growing at the Plant & Food Research site in Palmerston North. The Canterbury accessions were purchased commercially and are a seedling population originally sourced from the Mid Canterbury region; East Cape accessions are clonal material of selections originally sourced from a private property in the Hicks Bay region of the East Coast; the Manawatu accessions are a seedling population sourced from a private property in the Linton region; the Northland accessions are two separate seedling populations purchased commercially (Northland 1 was originally sourced from the Far North region, Northland 2 was originally sourced from the Kaipara region); the plant from Waikato was collected by the Department of Conservation on a peat bog site; the named ornamental cultivars ‘Andromeda’, ‘Phoenix’, Cygnus’, ‘Ph 360’ and ‘Electric Red’ are cultivars bred by Plant & Food Research. ‘Crimson Glory’ was sourced commercially.

Genomic DNA was extracted using the Qiagen Plant mini kit. DNA extracts diluted 1:10 were used for PCR reactions and a subset of eight individuals (two accessions from Northland and East Cape and four ornamental cultivars) were used to evaluate PCR amplification success and marker polymorphism. The primer pairs with successful amplification were then screened over the 45 individual accessions of mānuka and kānuka.

SSR amplification and electrophoresis

PCR amplifications of SSR markers were carried out as follows: Reactions were 10 µL in volume, containing 2 µL of DNA, 1 × PCR buffer (Invitrogen, Waltham, MA, USA), 1.3 mM MgCl₂, 0.1 mM of each dNTP, 0.1 µM reverse primer, 0.1 µM forward primer with extended M13 tail, 0.1 µM universal M13 primer fluorescently labelled with HEX, FAM, NED or PET and 0.44 U of Taq Polymerase (Invitrogen). Thermal cycling was carried out in a GeneAmp® Perkin Elmer 9700 (Applied Biosystems, Foster City, CA, USA) instrument as follows: an initial denaturation was carried at 95°C for 1 min, followed by 10 touchdown cycles of 95°C for 2 min 45 s, annealing from 60°C to 55°C with a 0.5°C decrease per cycle for 55 s and 72°C for 1 min 39 s and then 35 cycles of 95°C for 2 min 45 s, 55°C for 55 s and 72°C for 1 min 39 s. PCR products were pooled by mixing the PCR products from four markers labelled with different colours. Eight microlitres HiDi (Applied Biosystems) and 0.1 µL of GeneScan^™ 500 Liz® size standard (Applied Biosystems) were added to each pooled reaction, denatured for 5 min at 95°C and run on an Applied Biosystems 3500 Genetic Analyzer (Applied Biosystems). The data were analysed using SoftGenetics GeneMarker v.2.2.0 software (SoftGenetics LLC, State College, PA, USA http://www.softgenetics.com/GeneMarker.html).

SSR analysis and genetic diversity parameters

SSR data were manually scored as diploid genotypes and formatted into the POPGENE v1.31 (https://sites.ualberta.ca/~fyeh/popgene.html) format using the software CONVERT v1 (Glaubitz 2004). POPGENE v1.31 was used to calculate the number of alleles (N) as well as the expected and observed heterozygosity (He and Ho).

Results

SSR selection from mānuka gene sequences

Out of 89,619 ab initio gene models in a pre-release draft assembly of the mānuka genome, 469 exhibited more than 8 trinucleotide repeats and 169 had more than 12 dinucleotide repeats. A set of 32 gene models with high sequence similarity to the E. grandis genome assembly scaffolds (BLASTN E value < 10⁻²⁰) and spanning all 11 E. grandis chromosomes were selected for PCR primer design and for further evaluation (Table 2).

Table 2. List of PCR primers designed for mānuka SSR.

Marker name	SSR motif type	Number of repeated motifs in draft genome (‘Crimson Glory’)	Forward primer	Reverse primer	E. grandis scaffold	Location in E. grandis scaffold (bp)	Screening test results manuka
6972563	CCT	10	GTGGGTTGGTCATTGGAGA	ACTGGCACCGACGTAGAAGA	scaffold_1	40242876–40242272	Polymorphic
6975442	AG	13	CCTAATCGAAAGGAGCTGGA	ACAAAAGACACGACCCCAAA	scaffold_1	30321759–30321987	Polymorphic
6945482	CCA	10	AAGGAGCCCATCACTTGGA	CACTGCTGGTATTGGTGTGG	scaffold_2	47399146–47398240	Monomorphic
6968127	CTT	9	AGAGGCCGTGAGAGATGAAG	AACTTGTGACGTGCTGGTTG	scaffold_2	17107282–17107574	No amplification
6987098	GAA	13	GACGACGAGATTAGGGCTTG	AGCTCTGGCTCTGCTGTTTC	scaffold_2	51135586–51136959	Polymorphic
6995519	CT	13	TCTCTTAGCCACAACGAGCA	GTGCAATGACCACACCTCAC	scaffold_2	58021227–58021356	No amplification
6951308	TGG	9	ATTCTGATGGTGGTGCTGGT	ACCCGTCTTGACCGTTGTT	scaffold_3	13953173–13952344	Polymorphic
6952965	CT	16	CAGGGCGTGAACACAGATAA	AGGTTCCAAGCAAAGCAAAA	scaffold_3	56602465–56603147	No amplification
6978403	CT	13	AAGCCCTCTGCTCTCTCTCT	CAATGCTATAATGGGTGTCTGG	scaffold_3	51480494–51480859	Monomorphic
7004869	CT	16	TGACGGAGGTGCAATGTAGT	GAACGTGTTGGGCTTCTTGT	scaffold_4	30136535–30136027	Complex
7005484	AG	16	ACCCGGAGAGCAACTACAAC	GTGAGCTGAGGATGAACCAA	scaffold_4	25440646–25440858	Polymorphic
6955425	CT	14	CCAGAGCTTCCTCCACTTTTT	TGGCAGTCAACAAGGGTCTC	scaffold_5	32324692–32324065	Polymorphic
6984761	AC+CT	9+13	GCCTTGAGGTTGACTTCTCTTC	GTTTGCATGTGCGGGTGT	scaffold_5	51633344–51634194	Polymorphic
6954377	AAG	9	AAGAGGAGGGGAACCAAGAA	GCTTGCCTCAACATAGTCTCC	scaffold_6	41092994–41093171	Monomorphic
6959589	TC	14	GGTCTCTCGAACTCCACTTCTC	ATGGCTGCGTTGATGTAGGT	scaffold_6	39078866–39078365	Polymorphic
6961052	AAG	10	GAATGGAAATGCGATGTGAA	ATGCACCCTCTGATGACTCC	scaffold_6	47890917–47891774	Polymorphic
6948731	CTT	9	AATCCACGAGGCCAATTTC	CTGGGACACCGAAACCTTCT	scaffold_7	46336360–46334997	No amplification
6961590	GAA	9	GAATGCTCGTGGCTTTCTG	CCCCTTCTCTCGATTTCCTC	scaffold_7	50617915–50617561	Polymorphic
6974669	TC	14	TTACAAGTTCGTGCGGCTAA	CTGGTGCAACCTTTTGTGAA	scaffold_7	45853840–45853475	No amplification
6974683	CT	16	GACAGTAGCCACAACCCACA	AAACGGACGGAAAATGAAGA	scaffold_7	47365358–47365021	Polymorphic
6969338	CT	13	CATGGAAGACATTGGGACCT	CCCATAAGATCAGAACCATCC	scaffold_8	10259482–10257972	No amplification
6972057	CAA	9	CTTTCTTTTCGACCCCACAG	GCCGAGGTCTTATCATTCGT	scaffold_8	25405477–25405954	Polymorphic
6973002	AG	15	CTAATGGAGAGTGGGCGTTG	GAAAATGGAGGCTTGATGGA	scaffold_8	16484496–16482472	Polymorphic
6978963	GAA	9	GGATGATGCAAAAATCACCA	TTCTTCTCCCCCATAACAACA	scaffold_8	64273164–64274808	Polymorphic
6948775	CTC	11	GCATTCCACTTTTCGATCCT	TTACAAGCTCGACCATCAACC	scaffold_9	26348853–26348677	Monomorphic
6964948	TCC	10	CATCCCCTCCTCTCACTCAA	CGTCTTCATCCCAGAAATCA	scaffold_9	38503622–38503937	No amplification
6983534	CCA	11	CAGAAGCGGACGAAGAATG	ATATGTATGGGTGGGAGTGG	scaffold_9	14777160–14775937	Polymorphic
6964527	AG	16	CCCCGACACAAAACCTCAA	GCAAGCACGAAGACGAAAC	scaffold_10	25956348–25956729	Monomorphic
6966895	AAG	10	AGCCAGAGCAAGAAAGCATC	CGCTGGAGAACTCAAACAAG	scaffold_10	12279066–12279618	No amplification
6969224	CT	14	CATGGCTGTCAAAGGTCAAA	TGGCGCAAGATAGTGTTTCC	scaffold_10	12667771–12667013	No amplification
7008432	AAG	12	ACCGCAACACAAAAGGAGAA	TGTCCTCCATCGTCCTGTAA	scaffold_10	19761967–19761712	No amplification
6957092	CT	15	ACAGTGAAGGGGATCGAGAA	GAAACCACAAAATCGCAAGG	scaffold_11	24256554–24257676	Monomorphic

SSR evaluation in NZ mānuka and kānuka

Of the 32 PCR primer pairs evaluated, 22 yielded PCR products. Of these 22, 1 PCR primer pair yielded a complex profile with multiple PCR fragments indicating nonspecific amplification and was discarded. The remaining 21 markers were screened over the 42 mānuka accessions. Of these markers, 15 were polymorphic and 6 were monomorphic. The number of alleles per locus ranged from 4 to 18, the expected heterozygosity ranged from 0.47 to 0.90 and the observed heterozygosity ranged from 0.31 to 0.93 (Table 3).

Table 3. Simple sequence repeat (SSR) polymorphism metrics in 42 mānuka accessions.

Marker name	Allele size range (bp)	Ng	Na	Ho	He	PIC	K. linearis	K. robusta	K. tririegensis
6951308	211–270	78	16	0.85	0.84	82.17	na	p	p
6987098	170–182	88	7	0.66	0.65	53.53	m	m	m
7005484	270–306	74	11	0.74	0.73	69.98	m	na	na
6961052	351–375	66	9	0.82	0.81	80.22	na	p	m
6959589	371–413	66	16	0.90	0.88	86.81	na	p	p
6955425	528–627	36	16	0.93	0.90	89.89	na	na	na
6961590	116–143	78	11	0.79	0.78	71.86	m	p	p
6974683	165–195	84	16	0.84	0.83	80.95	p	p	p
6973002	219–237	70	9	0.81	0.80	78.59	na	m	m
6972057	208–245	66	9	0.81	0.80	75.13	na	na	na
6975442	176–374	80	14	0.78	0.77	77.38	p	m	na
6984761	158–202	76	18	0.77	0.76	71.18	p	p	m
6983534	179–192	70	7	0.74	0.73	65.21	na	p	p
6972563	213–223	44	4	0.31	0.65	17.45	na	na	na
6978963	168–242	56	9	0.48	0.47	43.11	na	p	m

Ng, number of gametes; Na, number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; PIC, polymorphism information content; na, not available; p, polymorphic in Kunzea; m, monomorphic in Kunzea.

When the 15 polymorphic SSR were evaluated for transferability in three species of kānuka (Kunzea), 12 primer pairs amplified a PCR product in Kunzea and 9 exhibited two alleles, indicating that they are likely to be polymorphic.

Discussion

Our successful development of polymorphic SSR markers for mānuka was only possible because of the availability of a mānuka whole genome sequence that is close to completion at Plant & Food Research (A. Thrimawithana, unpublished). A pre-release version of this whole genome sequence of ‘Crimson Glory’, consisting of a fragmented assembly (i.e. the contigs are not assembled into pseudo-chromosome length scaffolds) and preliminary gene model predictions were used for SSR motif detection. As longer stretches of tandemly repeated motifs are more likely to yield polymorphic loci (Chagné et al. 2004), stringent criteria were applied for choosing a set of sequences to design PCR primers, and only motifs longer than eight and 12 repeats for tri- and dinucleotides respectively were selected. Following this approach, 15 out of the 22 loci amplifying a PCR fragment were polymorphic across 8 mānuka accessions.

The availability of a genome sequence for another member of the Myrtaceae family, Eucalyptus grandis (Myburg et al. 2014), enabled the identification of gene models containing SSR motifs. In addition, focusing on a sequence with high sequence similarity to Eucalyptus meant that the probability of amplifying orthologous PCR products in other Myrtaceae species was higher. Indeed, we observed that 12 out of 15 mānuka SSR markers cross-amplified in kānuka (Kunzea) and 9 exhibited more than 1 allele in their electrophoretic profiles, indicating that they are potentially polymorphic.

These new SSR markers will be useful for a range of molecular genetics analyses in mānuka, such as estimation of genetic diversity in wild populations, fingerprinting of cultivars, parentage analysis, genetic mapping and marker-trait association. A high priority will be given to developing an understanding of the regional structure of mānuka across New Zealand.

Acknowledgements

We thank Julie Ryan and Ian King (Plant & Food Research) for maintaining the plants, and Ed Morgan for donating an accession from his land in the Manawatu region. Associate editor: Dr Sonia Philosoph-Hadas.

Disclosure statement

No potential conflict of interest was reported by the authors.

Additional information

Funding

This research was funded by Plant & Food Research’s Ministry for Business Innovation and Employment Core funding “Discovery Science”.