A disease complex associated with pigeon circovirus infection, young pigeon disease syndrome

Abstract

In order to collect more convincing data on the aetiological agent of young pigeon disease syndrome (YPDS), a comprehensive study was performed on pigeons in German lofts with or without outbreaks of YPDS. The investigations included examination of histories, clinical signs and pathology, as well as parasitological and microbiological analysis. Pigeons in their 4th to 12th week of life exhibited clinical signs at higher frequency and with greater severity than pigeons of other ages. Greenish liquid in the crop, proventriculus and ventriculus, and yellow fluid in the small intestine were seen more often in YPDS-affected pigeons. Escherichia coli and Klebsiella pneumoniae were isolated more frequently from these birds. Depletion of splenic and bursal lymphocytes was only seen in pigeons with YPDS. Inclusion bodies were present in various organs, especially the bursa of Fabricius. The genome of pigeon circovirus was detected in lymphoid tissues from all pigeons with YPDS. The results of this study indicate that YPDS is a multifactorial disease in which pigeon circovirus might be a crucial factor, possibly by inducing immunosuppression in infected birds.

Syndrome de la maladie du jeune pigeon, une maladie complexe associée à l'infection par le circovirus du pigeon

Dans le but d'obtenir davantage de données convaincantes sur l'agent étiologique du syndrome de la maladie du jeune pigeon (YPDS), une étude complète a été réalisée chez des pigeons dans des pigeonniers allemands présentant ou non des cas de YPDS. Les recherches ont inclus l'examen des commémoratifs, des symptômes et de la pathologie, ainsi que des analyses parasitologiques et microbiologiques. Les pigeons âgés de 4 à 12 semaines ont présenté des symptômes à une fréquence supérieure et avec une sévérité plus importante que les pigeons appartenant à d'autres tranches d'âge. Un liquide verdâtre dans le jabot, le proventricule et le ventricule, ainsi qu'un liquide jaune dans l'intestin grêle ont été observés plus souvent chez les pigeons atteints de YPDS. Escherichia coli et Klebsiella pneumoniae ont été isolés plus fréquemment chez ces animaux. Une déplétion des lymphocytes de la rate et de la bourse a été observée uniquement chez les pigeons présentant le YPDS. Des corps d'inclusion étaient présents dans différents organes, particulièrement dans la bourse de Fabricius. Le génome du circovirus du pigeon (PiCV) a été détecté dans les tissus lymphoïdes de tous les pigeons présentant le YPDS. Les résultats de cette étude indiquent que le YPDS est une maladie multifactorielle dans laquelle le PiCV serait un facteur crucial, probablement en induisant une immunodépression chez les animaux infectés.

Die Jungtaubenkrankheit, ein mit der Taubencircovirusinfektion assoziierter Krankheitskomplex

Zur Gewinnung von gesicherteren Erkenntnissen über das ätiologische Agens der Jungtaubenkrankheit (JTK) wurde in Deutschland eine umfassende Untersuchung von Tauben aus Schlägen mit mit und ohne JTK durchgeführt. Die Untersuchungen beinhalteten die Ermittlung der Anamnesen, der klinischen, pathologischen sowie parasitologischen und mikrobiologischen Befunde. Tauben im Alter zwischen der 4.–12 Lebenswoche hatten öfter und stärkere klinische Symptome als Tauben aus anderen Altersstufen. Grünliche Flüssigkeit im Kropf, Drüsen- und Muskelmagen und gelblich-flüssiger Inhalt im Dünndarm wurde bei Tauben mit JTK öfter gesehen. Escherichia coli und Klebsiella pneumoniae wurden häufiger aus diesen Tieren isoliert. Depletion von Milz- und Bursalymphozyten wurde nur bei Tauben mit JTK festgestellt. In verschiedenen Organen, insbesondere in der Bursa Fabricii, wurden Einschlusskörperchen beobachtet. Das Genom des Taubencircovirus wurde in den lymphatischen Geweben bei allen Tauben mit JTK nachgewiesen. Die Ergebnisse dieser Studie zeigen, dass die JTK eine multifaktorielle Erkrankung ist, bei der das Taubencircovirus, wahrscheinlich durch die Induzierung einer Immundepression, der entscheidende Faktor sein könnte.

Un síndrome asociado con circovirus de la paloma, el síndrome de las palomas jóvenes

Con el objetivo de recoger más datos sobre el agente etiológico del síndrome de las palomas jóvenes (YPDS), se llevó a cabo un estudio en palomas de Alemania con o sin brote de YPDS. Las investigaciones incluyeron el examen de las historias clínicas, síntomas clínicos y patología, así como los análisis parasitológicos y microbiológicos. Las palomas en su 4^a a 12^a semana de vida exhibían signos clínicos con una frecuencia más elevada y más graves que las palomas de otras edades. Los hallazgos que con más frecuencia se observaron en las palomas afectadas de YPDS fueron: líquido verduzco en el buche, proventrículo y ventrículo, y líquido amarillento en el intestino delgado. Se aislaron Escherichia coli y Klebsiella pneumoniae con más frecuencia de estas aves. La depleción de los linfocitos de la bolsa o esplénicos se observó únicamente en palomas con YPDS. Los cuerpos de inclusión se observaron en varios órganos, especialmente en la bolsa de Fabricio. Se detectó el genoma del circovirus de la paloma (PiCV) en tejidos linfoides de todas las palomas con YPDS. Los resultados de este estudio indican que el YPDS es una enfermedad multifactorial en la que PiCV podría ser un factor crucial, al inducir, posiblemente, inmunosupresión en aves infectadas.

Introduction

A disease in young racing pigeons associated with high morbidity and mortality rates has been reported in parts of central Europe, particularly Germany, and has been designated young pigeon disease syndrome (YPDS) or young bird sickness. The designation “swollen gut syndrome” is also used by pigeon fanciers and veterinarians (Warzecha, 2002). Although first observed more than two decades ago, the aetiological agent of this disease has remained unknown.

In order to gain insight into the epidemiology of YPDS, a questionnaire was developed and distributed to German breeders of racing pigeons (Reitz et al., 2003; Schmidt et al., 2004). The information obtained included the number of pigeons, the type of pigeon loft, the feeding habits and drinking systems, the occurrence of YPDS and the clinical signs observed. A variety of clinical and pathological signs of YPDS have been described. The analysis of more than 1600 questionnaires revealed that pigeons were affected by YPDS mainly between 4 and 12 weeks post weaning. The clinical signs were not specific and included anorexia, depression, ruffled feathers, vomiting, diarrhoea, polyuria and a fluid-filled crop. Generally less than 20% of the young pigeons were affected and mortality rates were about 20%. However, in individual cases mortality rates of more than 50% were reported. Stressful conditions, such as long-distance transport or hot weather during races for young pigeons, may play a role in the induction of YPDS.

Various non-infectious causes, as well as infectious pathogens, including Spironucleus columbae, Escherichia coli and avian adenoviruses, have been considered to contribute to the pathogenesis of YPDS (Dorrestein et al., 1992; De Herdt et al., 1994; Warzecha, 2002). In order to collect more definitive data, a comprehensive study was performed on pigeons in 15 German lofts with clinical outbreaks of YPDS in 2003 or 2004 and these were compared with pigeons in three lofts that had not had clinical outbreaks of YPDS in 2004. The aim was to obtain knowledge about gross and histological pathological changes in pigeons with YPDS and to compare those with information gained from haematological, parasitological and microbiological examinations.

Attempts were made to isolate Chlamydophila spp. and viruses in different cell culture systems, and the presence of the genomes of pigeon herpesvirus (PiHV), fowl and pigeon adenoviruses (FAdV and PiAdV), avian polyomavirus (APV) and pigeon circovirus (PiCV) was investigated by polymerase chain reaction (PCR). PiHV infections have been reported frequently in young pigeons with respiratory disease characterized by rhinitis and conjunctivitis, but also cause mild diarrhoea (Gerlach, 1997), a sign observed in pigeons with YPDS. A potential role for adenoviruses in the pathogenesis of YPDS has been discussed previously (Dorrestein et al., 1992), and FAdV are known to induce diarrhoea in young pigeons (Hess et al., 1998). PiAdV, which can be differentiated from FAdV by cross-neutralization tests, has been identified recently (Hess et al., 1998). The presence of APV has not been investigated in pigeons before, but it does induce acute disease in young budgerigars (Müller & Nitschke, 1986) and is known to infect other species, including falcons, buzzards and chickens (Stoll et al., 1993; Johne & Müller, 1998). PiCV infection was first documented in 1986 in Canada (Woods et al., 1994) and more recently in other countries (Soike et al., 2001; Hattermann et al., 2002; Todd et al., 2002; Roy et al., 2003), but a specific association with disease has remained unclear.

Materials and Methods

Origin of pigeons and samples

Juvenile racing pigeons of both sexes (27 male, 24 female) were obtained from 18 lofts located in various parts of Germany. Of these, 45 were from 15 lofts with clinical outbreaks of YPDS diagnosed by referring veterinarians based on increased mortality rates among pigeons in their 3rd to 20th week of life and poor racing performance. All referring veterinarians were specialists in pigeon diseases and had many years of experience with YPDS. Six young racing pigeons from three lofts without YPDS were also examined. All pigeons hatched in 2003 or 2004. Lofts with salmonellosis (on the basis of assurances by referring veterinarians) were excluded from the study. A detailed history of each pigeon's husbandry and the course of the disease were reported by the owners.

Parts of the bursa of the Fabricius, spleen, thymus, liver, kidneys, lung, air sacs, trachea, heart, crop, proventriculus, ventriculus, small and large intestines, thyroid, parathyroid and adrenal glands, testis or ovary, bone marrow, brain and skin were collected using aseptic technique and were stored at −80°C. Blood samples were collected into tubes containing ethylenediamine tetraacetic acid (EDTA) and were stored at −20°C. Serum samples were collected and stored at −20°C.

Clinical examination

After 1 day of hospitalization, clinical examinations, including total and differential white blood cell counts (WBCC) were performed (Campbell, 1997; Scope, 2003). Reference haematological values were: WBCC, 10×10³ to 30×10³/µl, 15 to 50% heterophils, 25 to 70% lymphocytes, 1 to 5% monocytes, 0 to 1.5% eosinophils and 0 to 2% basophils (Vogel, 1992; Rupiper & Ehrenberg, 1994; Johnson-Delaney & Harrison, 1996).

Postmortem examination

Pigeons were euthanized, after initial anaesthesia by intramuscular injection with ketamine (40 mg/kg body weight) and diazepam (5 mg/kg body weight), by intravenous injection of potassium chloride (2 mmol/kg body weight) and necropsies were performed (Latimer & Rakich, 1994).

Stained impression smears prepared from the liver, spleen, lung, bone marrow, and small and large intestines were examined (DiffQuik®; Dade Behring, Marburg, Germany) at 1000×magnification.

Histopathological examination

Sections of the organs collected were fixed in 10% neutral buffered formalin for at least 24 h. Formalin-fixed samples were dehydrated, embedded in paraffin wax and sectioned at 4 µm for examination by light microscopy. All sections were stained with haematoxylin and eosin (Laboratory Protocols, Veterinary Pathology, University of Bristol, UK: http://www.bris.ac.uk/Depts/PathAndMicro/cpl/lablinks.html).

Parasitological examination

Samples from the crop and small and large intestines were collected immediately after opening of the carcasses and examined microscopically for flagellates under 200×and 400×magnification.

Small and large intestinal contents were mixed with saturated sodium chloride solution at a 1:1 ratio and allowed to stand for 15 min. A semiquantitative evaluation of five microscopic fields was performed at 200×magnification.

Microbiological examination

Swabs for bacteriological and mycological culture were taken from the liver, lung, heart, kidneys, and small and large intestines. Bacteriological cultures were performed on Columbia agar supplemented with defibrinated sheep blood and brilliant green agar (Oxoid, Wesel, Germany) and incubated at 38°C under aerobic conditions for 24 h, and microaerophilic (Anaerocult®C; Merck, Darmstadt, Germany) and anaerobic (Anaerocult®A; Merck) conditions for 72 h. Differentiation of bacteria was carried out using a Chrystal™ Tube (BD Biosciences, Heidelberg, Germany). Antimicrobial susceptibility testing was performed using agar diffusion tests and minimum inhibitory concentrations were determined.

Mycological cultures were performed on Sabouraud's dextrose agar (Oxoid) and incubated at 38°C for 72 to 120 h. For detection of Salmonella species, samples of the liver and the intestinal contents were inoculated into selenite lactose medium (Oxoid) and the cultures were incubated at 38°C for 48 h. Samples were subcultured on Salmonella Shigella agar (Oxoid) at 38°C for 24 h. Suspicious colonies were screened with polyvalent antibody against Salmonella serogroups A to E (Enterocolon Anti-Salmonella I (A to E); SIFIN, Berlin, Germany) in an agglutination test (Cohen et al., 1984).

Detection of Chlamydophila spp

Buffalo green monkey cells were cultured in Eagle's minimal essential medium (MEM) supplemented with 5% foetal calf serum (FCS) (Kaleta & Taday, 2003). For the isolation of Chlamydophila spp., buffalo green monkey cell cultures in 24-well plates were inoculated in duplicate with 0.1 ml spleen and liver homogenates and were incubated at 37°C for 2 h. The inoculum was then replaced with 1 ml MEM containing 2% FCS and 2 µg/ml cycloheximide and the cultures were incubated at 37°C for 3 days. Cultures were passaged three times, and for the third passage the cells were grown on coverslips and examined for the presence of Chlamydophila spp. using Gimenéz staining (Kaleta & Taday, 2003). The presence of red inclusion bodies was regarded as positive.

Virus isolation

Chicken embryo cells and chicken embryo liver cells were prepared from 10-day-old and 12-day-old embryonated specific pathogen free chicken eggs (Valo; Lohmann, Cuxhaven, Germany), respectively, and grown as monolayers to 80% confluence.

Approximately 0.2 g each organ sample was homogenized in 2 ml MEM by sonication. The homogenate was centrifuged for 10 min at 1800×g. Cell cultures were inoculated with 0.2 ml supernatant and incubated at 38°C for 1 h. MEM containing 2% FCS was then added to the cultures, which were then incubated at 38°C. The cultures were examined daily for cytopathogenic effects. Each culture was passaged at least three times by removing cells from the plate by pipetting, sonication and centrifugation at 1800×g for 10 min. A 0.2 ml sample of the cell-free supernatant was used to inoculate fresh cells. Cell cultures showing cytopathogenic effects were harvested in the same manner and were stored at −80°C.

Electron microscopy

Supernatants of cell cultures (5 ml samples) showing cytopathic changes were concentrated by ultracentrifugation (2 h, 150 000×g), negatively stained with 2% (w/v) uranyl acetate and examined using a Siemens Elmiscope 101.

Haemagglutionation inhibition assay

Red blood cells from specific pathogen free chickens were sedimented by low-speed centrifugation of a blood sample containing EDTA and were washed twice with phosphate-buffered saline (PBS). The cells were treated with 0.2% glutaraldehyde for 30 min at room temperature, followed by five washings with PBS. The red blood cells were stored as 10% suspensions in PBS at 4°C for several weeks without showing haemolysis.

Haemagglutionation inhibition assays were performed to detect antibodies directed against paramyxovirus type 1 or influenza viruses with serotype 5 (H5) or 7 (H7) haemagglutinin. Aliquots of 25 µl of two-fold dilutions of pigeon sera were added to the wells of a U-shaped microtitre plate (Greiner, Frickenhausen, Germany). Four haemagglutination units of the virus preparation in 25 µl PBS were added to each well. The plates were incubated for 30 min at 37°C, then 50 µl of a 1% red blood cells suspension in PBS was added to each well and the plates were incubated for 30 min at room temperature. The haemagglutionation inhibition titres were defined as the reciprocal of the highest serum dilution that completely inhibited haemagglutination.

DNA extraction

Total DNA was extracted using the DNeasy Tissue Kit (Qiagen, Hilden, Germany), as recommended by the supplier, from samples of the liver, bursa of Fabricius, spleen, blood and serum. DNA was eluted twice in a total volume of 150 µl AE buffer (Qiagen) and stored at −20°C.

Polymerase chain reaction

The PCR primers used in this study are presented in Table 1. In addition to previously described primers for the detection of APV (Johne & Müller, 1998) and PiAdV DNA (Raue et al., 2002), three new sets were designed. For the detection of PiHV DNA, previously established nucleotide sequence data (R. Raue, unpublished data; Ehlers et al., 1999) were used to design primers amplifying a 242 base pair (bp) product of the DNA-dependent DNA polymerase gene. An alignment of published partial hexon sequences of all 12 FAdV reference strains (Meulemans et al., 2001 2004) was used to design primers binding to a conserved part of the pedestal region of the hexon gene that would amplify a PCR product of 181 bp. PiCV-specific primers were designed using a strategy described recently (Raue et al., 2004) based on published PiCV sequence data (Mankartz et al., 2000; Todd et al., 2001; Taras et al., 2003), and amplified a 206 bp region of the C1 gene, encoding the capsid protein. A PCR amplifying part of the cytochrome B gene was used as a control to detect the presence of inhibitors (Hattermann et al., 2002).

Table 1.  PCR primers used in this study

Target	Gene	Primer^a name	Sequence (5′ to 3′)	Size of product (bp)	Reference
PiHV	Polymerase	PiHV-s	gggacgctctgattaaggaat	242	–
		PiHV-as	cttggtgatcagcagcagcttg
FadV	Hexon	Hex-s	caggcccaaytacatcgg	181	–
		Hex-as	gtgatgacgsgacatcat
PiAdV	Fibre	PiAV F1-s	atcaactacgacaacgaaggc	967	Raue et al. (2002)
		PiAV F2-as	cggtagagttacggggaaatt
APV	T/t-antigen	APV-s	caagcatatgtccctttatccc	310	Johne & Müller (1998)
		APV-as	ctgtttaaggccttccaagatg
PiCV	Capsid	PiCV-s	ggtaactgaatgcgagcccatagt	206	–
		PiCV-as	tgacggagccagaaaatgggat
Pigeon genome	Cytochrome B	cytB-s	ccatccaacatctcagcatgatgaaa	359	Hattermann et al. (2002)
		cytB-as	gcccctcagaatgatatttgtcctca
^aThe orientation is sense (-s) or antisense (-as).

For the PCR reaction, a premix was prepared containing 5 u Taq DNA-polymerase (Peqlab, Erlangen, Germany), 5 µl of 10x reaction buffer (200 mM Tris–HCl, pH 8.55, 160 mM (NH₄)₂SO₄ and 20 mM MgCl₂), 10 mM each dNTP (Peqlab) and 100 pmol each primer (Table 1), and was mixed with 4 µl template DNA in a total volume of 50 µl. With the exception of the PCR amplifying the PiAdV DNA, the PCR commenced with an initial denaturation step of 5 min at 95°C, followed by 40 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec. The reaction was terminated after a final elongation step at 72°C for 5 min. The PCR for the detection of PiAdV DNA was performed as described previously (Raue et al., 2002). PCR products were separated in 2% or 1.5% agarose gels, stained with ethidium bromide and visualized by ultraviolet transillumination.

Statistical analysis

Statistical analysis was performed using the program SPSS, version 11.5.1. (SPSS Inc., Chicago, Illinois, USA). Differences between diseased and normal birds were examined for significance using contingency tables, Pearson's chi-squared test and Fisher's exact test.

Results

Clinical signs

Most of the pigeons (47/51) were presented alive and during the summer (11/18 lofts). Clinical signs were seen in 28/41 pigeons from YPDS-affected lofts, and included reluctance to fly, greenish to black diarrhoea, vomiting, anorexia, fluffed feathers, apathy (25/41), a fluid-filled crop (22/41), polyuria (5/41), yellow urates (5/41) and sneezing (2/41). Four pigeons from affected lofts died during transport. Clinical signs were not seen in any of the pigeons from lofts without a history of YPDS. A higher proportion of pigeons between 4 and 12 weeks of age had clinical signs (16/17) than pigeons of other ages (0/7 pigeons 3 to 4 weeks of age, P<0.0001; 12/23 pigeons 12 to 20 weeks of age, P=0.004) and also had more severe clinical signs.

Gross lesions

Many of the birds from lofts with signs of YPDS (n=45) had a poor (33.3%) to very poor (15.7%) body condition, while the six pigeons from YPDS-free lofts all had good body condition. Gross lesions observed at necropsy are presented in Table 2. There was a significantly higher prevalence of greenish liquid in the crop, proventriculus and ventriculus of diseased birds (P=0.009) than in those of birds without clinical signs. Although food was offered to pigeons during the 1 day of hospitalization, pigeons with this finding had no food in the crop. Thus, the finding of greenish liquid in the crop, proventriculus and ventriculus was interpreted as a sign of anorexia. Yellow fluid was found in the small intestine in 13/45 pigeons with YPDS and 2/6 pigeons without YPDS. This was observed significantly more frequently in pigeons between 4 and 12 weeks of age (P < 0.0001). Gross lesions in the lung and air sacs (9/45), liver (8/45), kidney (6/45), heart (3/45), intestines (2/45), bursa of Fabricius (1/45) and pancreas (1/45) were seen only in pigeons from lofts with signs of YPDS.

Table 2.  Gross lesions in 45 pigeons with YPDS and in six pigeons without YPDS

		Proportion with lesion
Organ system	Type of gross lesions	With YPDS	Without YPDS
Gastrointestinal system and pancreas (total)		22/45	2/6
	Green fluid in the crop, proventriculus and ventriculus	22/45	0/6
	Yellow fluid in the small intestine	13/45	2/6
	Low-grade multifocal miliary white and firm nodules in the intestines	2/45	0/6
	High-grade multifocal white protruding lesions in the pancreas	1/45	0/6
Lung and abdominal air sacs (total)		9/45	0/6
	Mild enlargement unilateral, dirty-red in colour	2/45	0/6
	Bilateral diffuse brown in colour	2/45	0/6
	Multifocal miliar lesions with whitish, dry and friable contents	4/45	0/6
	Abdominal air sacs covered with yellow mucus	2/45	0/6
Liver (total)		8/45	0/6
	Mild enlargement	6/45	0/6
	Moderate enlargement, yellow, friable	1/45	0/6
	Low-grade multifocal whitish lesions	1/45	0/6
Kidneys (total)		6/45	0/6
	Diffuse green in colour	1/45	0/6
	Diffuse yellow in colour	4/45	0/6
	Moderate enlargement	1/45	0/6
Heart	Pericardium and epicardium covered with yellow caseous material adherent to serous membranes	2/45	0/6
	Low-grade multifocal submiliar white lesions in the myocardium	1/45	0/6
Lymphatic system	Splenomegaly	9/45	0/6
	Bursa of Fabricius filled with yellow crumbly material	1/45	0/6

WBCC and cytological finds

No necrosis or inclusion bodies were detected in the bone marrow of any birds, and no inclusion bodies were detected in erythrocytes or leukocytes of blood smears. The WBCC data are presented in Table 3. Pigeons with leukocytosis (8/40) originated from lofts with YPDS, but were more than 12 weeks old. Heterophilia (P=0.042), toxic heterophils (P=0.036) and monocytosis (P=0.017) were seen significantly more often in pigeons with leukocytosis. Depletion of lymphatic follicles in the bursa of Fabricius (P=0.009) and enteritis (P=0.003) occurred significantly more often in pigeons with heterophilia.

Table 3.  WBCC of 45 pigeons with YPDS and in six pigeons without YPDS

	Proportion affected
Haematological finding	With YPDS	Without YPDS
Leukocytosis	8/40 (24.45±16.1×10^3/µl)^a	0/6 (11.35±4.06×10^3/µl)
Leukopaenia	3/40 (24.45±16.14×10^3/µl)	3/6 (11.35±4.06×10^3/µl)
Reactive lymphocytes	4/40 (0.38±1.28%)	0/6 (0%)
Lymphopenia	11/40 (44.08±25.00%)	0/6 (60.50±12.29%)
Lymphocytosis	8/40 (44.08±25.00%)	1/6 (60.50±12.29%)
Heteropaenia	4/40 (45.48±23.72%)	0/6 (35.00±14.00%)
Heterophilia	16/40 (45.48±23.72%)	1/6 (35.00±14.00%)
Toxic heterophils	2/40 (0,10±0.50%)	0/6 (0%)
Monocytosis	19/40 (9.55±9.46%)	2/6 (6.17±7.06%)
Eosinophilia	2/40 (0.13±0.52%)	0/6 (0%)
^aMean value and standard deviation are presented in parentheses.

Histopathological lesions

Lymphocytic depletion and lymphocellular necrosis were observed in the spleens of 10/51 pigeons and in the bursa of Fabricius of 6/42 pigeons (Table 4). Multiglobular basophilic intranuclear and intracytoplasmatic inclusion bodies were seen in lymphocytes and macrophages in the bursa of Fabricius in 16/42 pigeons. They were also seen in lymphocytes and macrophages in the gut-associated lymphoid tissue of two pigeons, in the bronchus-associated lymphoid tissue and in the kidneys in one case each, and in the liver in 4/42 pigeons (Table 4). Multiglobular basophilic inclusion bodies were also seen in the bursa of Fabricius of one pigeon without YPDS. Inclusion bodies were seen more often in pigeons with green fluid in the crop, proventriculus and ventriculus (P=0.011).

Table 4.  Main histological findings in 45 pigeons with YPDS and in six pigeons without YPDS

Finding	Liver	Intestines	Kidneys	Lung	Spleen	Bursa of Fabricius
Extramedullar haematopoiesis	27/45^a (0/6)^b	–^c	16/45 (2/6)	–	–	–
Inflammation	16/45 (3/6)	11/45 (0/6)	7/45 (0/6)	9/45 (0/6)	–	2/45 (0/6)
Haemosiderosis	19/45 (0/6)	–	5/45 (0/6)	–	7/45 (0/6)	–
Fatty degeneration	10/45 (2/6)	–	1/45 (0/6)	–	–	–
Depletion of lymphocytes	–	–	–	–	10/45 (0/6)	6/45 (0/6)
Activated BALT^d	–	–	–	27/45 (4/6)	–	–
Oedema	–	–	–	7/45 (0/6)	–	–
Multiglobular inclusion bodies in lymphocytes and macrophages	4/45 (0/6)	2/45 (0/6)	1/45 (0/6)	1/45 (0/6)	–	15/45 (1/6)
^aNumbers of pigeons with YPDS showing the histological finding per total number of pigeons with YPDS.
^bNumbers of pigeons without YPDS showing the histological finding per total number of pigeons without YPDS.
^cNot detectable in pigeons either with or without YPDS.
^dBronchus-associated lymphoid tissue.

Findings from histological examinations are summarized in Table 4. The livers of 46/51 pigeons had predominantly perivascular lympho-histiocytic and heterophilic infiltrates, hepatocellular necrosis, activation of Kupffer cells, bile duct hyperplasia, anisokaryosis, haemosiderosis, extramedullary haematopoiesis and fatty degeneration. Focal nephritis and haemosiderotic tubulonephrosis were also seen. Pigeons with clinical signs (P=0.029), green fluid in the crop, proventriculus and ventriculus (P=0.001) or inclusion bodies in the bursa of Fabricius (P=0.047) were more often affected by haemosiderosis. In contrast, none of the pigeons from YPDS-free lofts had haemosiderosis in the liver, kidneys or spleen.

Mild to severe catarrhal duodenitis (4/51), mild acute catarrhal to purulent enteritis (3/51), and severe multifocal granulomatous enteritis (4/51) were seen. Enteritis was seen significantly more often in pigeons with depletion of splenic lymphocytes (P=0.027). Fungal pneumonia and airsacculitis (5/51) or bacterial septicaemia (4/51), purulent epicarditis and pericarditis (1/51) or non-suppurative myocarditis (3/51), non-suppurative pancreatitis (3/51), encephalitis or neuritis (3/51) and purulent thymitis (1/51) were also seen.

Microbiological findings

Microbiological findings are summarized in Table 5. No salmonella were isolated from the liver or intestines of any pigeon. However, E. coli was isolated from 36/51 pigeons. It was isolated more frequently from pigeons with clinical signs (P=0.05) and from pigeons between 4 and 12 weeks of age (P=0.011). The most common site of isolation was the large intestine. It was isolated from all 12 pigeons with hepatocellular degeneration (P=0.011). In pigeons with clinical signs, E. coli was also isolated more often from the small intestine (P=0.009) and from pigeons with histopathological changes in the gut (P=0.015).

Table 5.  Bacteria and fungi isolated from 45 pigeons with YPDS and six pigeons without YPDS

Bacteria and fungi	Liver	Lung	Heart	Kidneys	Small intestine	Large intestine
Escherichia coli	14/45^a (0/6)^b	13/45 (1/6)	13/45 (0/6)	12/45 (1/6)	23/45 (2/6)	32/45 (5/6)
Klebsiella pneumoniae	13/45 (0/6)	12/45 (1/6)	8/45 (0/6)	9/45 (0/6)	10/45 (1/6)	10/45 (1/6)
Klebsiella oxytoca	2/45 (0/6)	2/45 (0/6)	2/45 (0/6)	3/45 (0/6)	3/45 (0/6)	3/45 (0/6)
Enterobacter cloacae	6/45 (0/6)	4/45 (0/6)	4/45 (0/6)	4/45 (0/6)	6/45 (2/6)	5/45 (1/6)
Enterobacter sakazakii	0/45 (3/6)	0/45 (2/6)	1/45 (1/6)	1/45 (1/6)	1/45 (1/6)	2/45 (2/6)
Pseudomonas aeruginosa	–^c	–	2/45 (0/6)	–	–	2/45 (0/6)
Pseudomonas putida	2/45 (0/6)	2/45 (0/6)	2/45 (0/6)	2/45 (0/6)	–	–
Flavimonas oryzihabitans	2/45 (0/6)	2/45 (0/6)	2/45 (0/6)	1/45 (0/6)	1/45 (0/6)	2/45 (0/6)
Brevundimonas diminuta	–	–	–	0/45 (1/6)	0/45 (1/6)	–
Serratia plymuthica	1/45 (0/6)	1/45 (0/6)	1/45 (0/6)	1/45 (0/6)	4/45 (0/6)	2/45 (0/6)
Acinetobacter lwoffii	–	–	–	–	2/45 (0/6)	1/45 (0/6)
Citrobacter freundii	–	1/45 (0/6)	–	1/45 (0/6)	–	2/45 (0/6)
Enterococcus avium	1/45 (0/6)	1/45 (0/6)	1/45 (0/6)	1/45 (0/6)	2/45 (0/6)	2/45 (0/6)
Micrococcus lylae	–	–	–	–	2/45 (0/6)	1/45 (0/6)
Corynebacterium renale	0/45 (1/6)	0/45 (1/6)	–	–	0/45 (1/6)	0/45 (1/6)
Candida spp.	2/45 (0/6)	2/45 (0/6)	2/45 (0/6)	1/45 (0/6)	3/45 (0/6)	5/45 (0/6)
Aspergillus spp.	–	6/45 (0/6)	–	–	–	–
Mucor spp.	–	1/45 (0/6)	–	–	–	–
^aNumbers of pigeons with YPDS showing bacteria or fungi per total number of pigeons with YPDS.
^bNumbers of pigeons without YPDS showing bacteria or fungi per total number of pigeons without YPDS.
^cNot detectable in pigeons either with or without YPDS.

Klebsiella pneumoniae, Enterobacter cloacae and Enterobacter sakazakii were isolated from both pigeons from lofts with YPDS and pigeons from lofts without YPDS (Table 5). Serratia plymuthica, Klebsiella oxytoca, Pseudomonas aeruginosa, Pseudomonas putida, Flavimonas oryzihabitans, Acinetobacter lwoffi, Citrobacter freundii, Enterococcus avium and Micrococcus lylae were isolated only from pigeons from lofts with YPDS, and Brevundimonas diminuta and Corynebacterium renale were isolated only from pigeons from lofts without YPDS.

Fungi were only isolated from pigeons from lofts with YPDS (Table 5). In these pigeons yeasts were isolated more often from birds with green fluid in the crop, proventriculus and ventriculus (P=0.034), and with inclusion bodies in the bursa of Fabricius (P=0.023).

Parasitological observations

S. columbae was seen in the intestines of 14/51 pigeons, and was significantly more common in pigeons with inclusion bodies in the bursa of Fabricius (P=0.047). S. columbae and Trichomonas gallinae were detected in 8/51 pigeons, from both YPDS-free lofts and lofts with YPDS.

Eimeria spp. were seen in only one pigeon and helminths (Ascaridia spp. and Capillaria spp.) were seen in five birds. However, 23/51 birds carried pigeon lice (Columbicola columbae columbae), and 15/51 had feather mites (Falculifer rostratus and Megnina columbae).

Chlamydophila spp. Isolation

Chlamydophila spp. were not isolated from any of 40 pigeons from YPDS-affected lofts.

Virus isolation

Herpesviruses were isolated from the spleen and kidney homogenates of one pigeon and from cardiac and bursal homogenates from two other pigeons reared in the same loft. The presence of herpesviruses was confirmed by electron microscopy and PCR (data not shown).

No other viruses were isolated.

Serology

Of 40 serum samples from pigeons from YPDS-affected lofts, antibody titres against paramyxovirus type 1 of 2⁸, 2⁷ and 2⁶ were detected in one pigeon each, and titres of 2⁵, 2⁴ and 2³ were detected in three, two and two pigeons, respectively.

No antibodies against H5 or H7 influenza viruses were detected in any of the 40 sera.

Detection of virus-specific DNA

A clearly visible band of the expected size was obtained in the cytochrome B gene PCR with all samples, indicating the absence of PCR inhibitors (data not shown). Neither APV, FAdV nor PiAdV DNA was detected in any sample, but PiHV DNA was detected in 7/45 liver samples (Table 6) from pigeons from 5/15 lofts.

Table 6.  PCR for viral DNA on tissue from 45 pigeons with YPDS and six pigeons without YPDS

		Proportion positive
Virus DNA investigated	Source of samples	With YPDS	Without YPDS
APV	Liver	0/45	0/6
	Kidneys	0/7	Not done
FAdV	Liver	0/45	0/6
PiAdV	Liver	0/45	0/6
PiHV	Liver	7/45	0/6
PiCV	Liver	40/45	3/6
	Bursa of Fabricius	45/45	2/6
	Spleen	44/45	2/6
	EDTA-blood	2/3	0/6
	Serum	18/38	Not done

PiCV DNA was detected in the bursa of Fabricius of all pigeons from YPDS-affected lofts (Table 6), in 40/45 liver samples, and in 44/45 spleen samples. PiCV DNA was also detected in 3/6 pigeons from lofts without YPDS. However, the reduced intensity of bands suggested that smaller amounts of PCR product were obtained from these samples (Figure 1). The intensity of the cytochrome B-specific bands was the same in these samples as in the samples obtained from the pigeons with YPDS (data not shown).

Figure 1.  PiCV PCR products obtained from DNA from the bursa of Fabricius (BF), spleen (S), liver (L) and blood (B) from (1a) two pigeons from a loft with clinical signs of YPDS and (1b) two pigeons from a loft without disease. N, negative control; P, PiCV positive control; M, DNA size markers (phage lambda DNA digested with HaeIII).

PiCV DNA was detected in two of three blood samples and in 18/38 serum samples from pigeons from YPDS-affected lofts, indicating that infection was associated with viraemia in these birds (Table 6). Blood samples from six pigeons from lofts without YPDS did not contain detectable PiCV DNA (Table 6). The identity of the PCR products was confirmed by restriction endonuclease digestion and nucleotide sequencing (data not shown).

Discussion

YPDS is characterized by non-specific clinical signs, and pigeons are most frequently and severely affected between the age of 4 and 12 weeks (Reitz et al., 2003; Schmidt et al., 2004). Comparable results were obtained in our study.

As expected, the pathological and histopathological findings varied, probably reflecting the involvement of different secondary pathogens. S. columbae, suggested to be the causative agent, was detected in only 27.5% of the pigeons. However, the facultative pathogen E. coli was isolated from 36/45 pigeons affected with YPDS and other facultative pathogens were detected in the majority of cases, indicating that the immune system of these pigeons might be affected. This possibility was supported by the observation that lymphoid depletion and lymphocellular necrosis were observed in the spleen and bursa of Fabricius, and that intranuclear and intracytoplasmic inclusion bodies were detected most frequently in the bursa of Fabricius, and were also seen in lymphocytes and macrophages in the liver, intestines, kidneys and lung.

Such inclusion bodies have been demonstrated in the bursa of Fabricius of pigeons infected with PiCV (Woods et al., 1994; Shivaprasad et al., 1994; Woods & Latimer, 2000), and PiCV DNA was detected in most of the pigeons. Avian adenoviruses have been suggested as aetiological agents of YPDS, mainly because adenoviruses were isolated from affected pigeons (Dorrestein et al., 1992), but were not detected in any birds in our study. However, other potential pathogens were not sought in this earlier study.

APV were also not detected in our study. PiHV was detected by PCR and virus isolation, but the small number of infected birds did not correlate with the large number of pigeons with clinical signs and corresponds more closely with the expected prevalence in young pigeons (E.F. Kaleta, unpublished observations). PiCV DNA was detected in all pigeons from YPDS-affected lofts, but also in three of six pigeons from lofts without YPDS. This study and previous studies (Soike et al., 2001) indicate that the prevalence of PiCV infection is generally high in Germany. Comparable prevalences have been reported in the Czech Republic, Belgium and Northern Ireland (Todd et al., 2002; Taras et al., 2003).

Lymphatic tissues, such as the bursa of Fabricius and spleen, more frequently contained detectable PiCV DNA, while inclusion bodies in the bursa of Fabricius similar to those seen in our study have been seen in pigeons infected with PiCV (Shivaprasad et al., 1994; Abadie et al., 2001; Roy et al., 2003). Further investigations using in situ hybridization techniques will be needed to demonstrate that PiCV DNA is present in these inclusion bodies.

While all of the pigeons with clinical signs and some clinically healthy birds were infected with PiCV, only YPDS-affected pigeons had detectable PiCV DNA in their blood and serum, indicating that these birds were viraemic. Furthermore, there appeared to be less PiCV DNA in the organs of unaffected pigeons. Thus, the assay of blood samples may be useful for confirmation of the diagnosis of YPDS during the acute phase. However, further investigations are necessary to demonstrate the usefulness of this PCR for the diagnosis of YPDS. In particular, differences in the viral load in diseased and persistently infected pigeons need to be assessed.

The presence of large amounts of the PiCV genome in the lymphatic tissues and in the blood strongly suggests that PiCV infection plays an important role in the pathogenesis of YPDS, probably resulting in multifactorial disease in young pigeons with an immature immune system.

The exposure of these pigeons to stressful conditions, such as racing, overcrowding or hot weather, might result in enhanced viral replication, particularly in lymphatic tissues, resulting in cell lysis and/or apoptotic cell death, with depletion of lymphocytes in the bursa of Fabricius and other lymphatic tissues causing immunosuppression. However, most of the pigeons with YPDS in our study did not have leukopaenia. This might indicate that activation of the immune system has occurred as a result of the numerous secondary infections seen. Neither necrosis nor inclusion bodies were observed in the bone marrow, in contrast to findings in circovirus-infected parrots (H. Gerlach, personal communication), suggesting that the immune system might be able to recover after infection.

In conclusion, the results of our study indicate that YPDS is a multifactorial disease in which PiCV is a crucial factor, possibly inducing immunosuppression in infected birds.

Translations of the abstract in French, Germany and Spanish are available on the Avian Pathology website.

This study was supported by the “Verband Deutscher Brieftaubenzüchter e.V.”.

Additional information

Notes on contributors

Rüdiger Raue

Rüdiger Raue and Volker Schmidt contributed equally to this study