Abstract
Infectious laryngotracheitis virus (ILTV), an alphaherpesvirus, causes respiratory disease in chickens and is commonly controlled by vaccination with conventionally attenuated virus strains. These vaccines have limitations due to residual pathogenicity and reversion to virulence. To avoid these problems and to better control disease, attention has recently turned towards developing a novel vaccine strain that lacks virulence gene(s). Glycoprotein G (gG) is a virulence factor in ILTV. A gG-deficient strain of ILTV has been shown to be less pathogenic than currently available vaccine strains following intratracheal inoculation of specific pathogen free chickens. Intratracheal inoculation of gG-deficient ILTV has also been shown to induce protection against disease following challenge with virulent virus. Intratracheal inoculation, however, is not suitable for large-scale vaccination of commercial poultry flocks. In this study, inoculation of gG-deficient ILTV via eye-drop, drinking water and aerosol were investigated. Aerosol inoculation resulted in undesirably low levels of safety and protective efficacy. Inoculation via eye-drop and drinking water was safe, and the levels of protective efficacy were comparable with intratracheal inoculation. Thus, gG-deficient ILTV appears to have potential for use in large-scale poultry vaccination programmes when administered via eye-drop or in drinking water.
Introduction
Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus that causes acute respiratory disease in chickens and is economically important in poultry industries worldwide (Guy & Bagust, Citation2003). In intensive poultry systems, especially layer flocks, conventionally attenuated vaccines are commonly used to control ILTV. These vaccine strains have a number of limitations, including insufficient attenuation and the ability to revert to high levels of virulence following in-vivo passage (Guy et al., Citation1991; Bagust & Johnson, Citation1995; Bagust et al., Citation2000). In an effort to improve the control of ILTV, attention has turned towards developing a recombinant attenuated live vaccine that lacks virulence genes. Glycoprotein G (gG) has been recently identified as a virulence factor in ILTV. Deletion of gG from the ILTV genome resulted in the attenuation of clinical signs and the mortality rate and had an effect on weight gain in infected specific pathogen free chickens inoculated via the intratracheal route (Devlin et al., Citation2006b). The gG-deficient ILTV candidate vaccine strain was also significantly less pathogenic than the commercial A20 and SA-2 ILTV vaccine strains (Fort Dodge, Australia) following intratracheal inoculation. Intratracheal inoculation of gG-deficient ILTV provided protection against disease following challenge with virulent virus. The level of protection was equivalent to, or better than, the level of protection provided by the SA-2 ILTV vaccine strain (Devlin et al., Citation2007).
gG is conserved in most members of the alphaherpesvirus subfamily. In some other alphaherpesviruses, gG has been shown to function as a viral chemokine binding protein (vCKBP) in vitro (Bryant et al., Citation2003; Costes et al., Citation2005). The production of vCKBPs is an immune evasion mechanism employed by a number of viruses in the poxvirus and herpesvirus families (Alcami & Koszinowski, Citation2000). It is possible that gG in ILTV may function as a vCKBP in vivo and that the lack of gG contributes to the attenuation and immunogenicity of the gG-deficient ILTV candidate vaccine strain (Devlin et al., Citation2007). Birds develop a strong, albeit non-protective, antibody response to gG (Kongsuwan et al., Citation1993). Thus, gG-deficient ILTV has the potential to be used as a marked vaccine to allow the differentiation of vaccinated and naturally infected birds. This feature may be of benefit in future ILTV control or eradication programmes (Bagust & Johnson, Citation1995).
Although gG-deficient ILTV appears to have many features that make it desirable for use as an attenuated vaccine, the safety and protective efficacy of this mutant have only been investigated following intratracheal inoculation. This method of inoculation is not suitable for large-scale poultry vaccination. More practical methods of vaccine delivery in poultry include eye-drop inoculation, inoculation via aerosol spray and inoculation via drinking water. This study aimed to investigate the safety and protective efficacy of gG-deficient ILTV following administration by these routes.
Materials and Methods
Virus strains and propagation
The gG-deficient ILTV strain was generated from the virulent Australian CSW-1 ILTV strain as previously described (Devlin et al., Citation2006b). Virus was propagated in primary chick embryo kidney cells, harvested from 17-day-old to 18-day-old embryonated eggs by trypsin disaggregation. The chicken liver tumour cell line, LMH (Kawaguchi et al., Citation1987), was used for viral isolation. Cell monolayers were cultured as previously described (Devlin et al., Citation2006a).
Safety of glycoprotein-G-deficient ILTV
The safety of gG-deficient ILTV was investigated by comparing the clinical signs and weight gain in birds inoculated via eye-drop, drinking water or aerosol spray with the clinical signs and weight gain in uninfected birds (negative control group) and birds inoculated via the intratracheal route (positive control group). Fifty specific pathogen free chickens, 3 weeks of age, were weighed, wing-tagged and randomly allocated into five groups of 10 birds each. Each group was housed in a separate isolator and provided with irradiated feed and water ad libitum. The first group of 10 birds were inoculated intratracheally with 3000 plaque forming units (PFU) of gG-deficient ILTV suspended in 300 µl media. The second group of 10 birds were inoculated via eye-drop with 3000 PFU gG-deficient ILTV suspended in 30 µl media. The third group of 10 birds were inoculated via aerosol spray with 3000 PFU gG-deficient ILTV suspended in 180 µl. This was delivered in two spray applications of 90 µl, one spray was directed specifically towards the external nares of the bird and one spray was directed more generally to encompass the external nares, eyes and beak. The fourth group of 10 birds were administered the gG-deficient ILTV in drinking water. These birds were deprived of drinking water for 2 h and were then provided with 5 ml each of drinking water containing 0.25% skim milk powder and 3000 PFU gG-deficient ILTV. After 1 h this solution was removed, and irradiated drinking water was again made available ad libitum. The final group of 10 birds were not inoculated and remained as unvaccinated controls.
All birds were monitored daily for clinical signs of disease. At 4 days post-inoculation (d.p.i.) the severity of clinical signs in each bird was scored. Birds that showed no clinical signs were scored as 0. Birds showing mild dyspnoea (with the beak remaining closed) were scored as 1. Birds showing moderate dyspnoea (with open beak breathing) were scored as 2. Birds showing severe dyspnoea (with gasping), or that died suddenly, were scored as 3. All birds with severe dyspnoea were euthanized. Scores for clinical signs were compared between groups using a Mann–Whitney test. At 21 d.p.i. the birds were weighed. The mean percentage weight gain and standard deviation for each group were calculated. Weight gain was compared between groups using Student's t-test.
Protective efficacy of glycoprotein-G-deficient ILTV
The protective efficacy of gG-deficient ILTV, following vaccination by eye-drop, drinking water or aerosol spray, was investigated by challenging the previously inoculated birds with virulent ILTV and then comparing the clinical signs, weight gain, tracheal pathology and virus excretion with unvaccinated birds and birds that had been vaccinated intratracheally with gG-deficient ILTV. All birds were challenged 21 days after vaccination by the intratracheal inoculation of 4500 PFU virulent CSW-1 ILTV suspended in 300 µl media. At the time of challenge the birds were 6 weeks old.
Birds were monitored daily for signs of clinical disease and mortality as described previously. Clinical sign scores were compared between groups using a Mann–Whitney test. All birds were euthanized by exposure to halothane and weighed 7 days after challenge. The mean and standard deviation percentage weight gains for each group were calculated for the 7-day period following challenge and for the entire duration of the study (28 days). Weight gain was compared between groups using Student's t-test.
The larynx and trachea were removed aseptically. The mucosal surface of the trachea was examined for gross pathology. Gross pathology was scored from 0 (absent) to 4 (very severe) as previously described (Devlin et al., Citation2007). A transverse section of proximal trachea was collected and preserved in 10% neutral buffered formalin prior to histological examination. Sections were stained with haematoxylin and eosin and examined using light microscopy. The severity of the lesions as assessed by histopathological examination was scored from 0 (absent) to 5 (very severe) using a previously described system (Guy et al., Citation1990). A cumulative tracheal pathology score for each bird was calculated by summing the gross pathology and histopathology scores. Scores for tracheal pathology were compared between groups using a Mann–Whitney test.
A scraping was taken from each trachea for virus isolation on LMH cells (Devlin et al., Citation2006b). Virus detection by polymerase chain reaction (PCR) was also performed. DNA was extracted from each tracheal scraping using a Qiaex II kit (Qiagen). Mock DNA extractions from distilled water were also included for each experimental group to control for contamination. To confirm the success of DNA extraction, 2 µl of each extraction product was used as template in a PCR to amplify the cellular β-actin gene. This PCR utilized the forward primer Baf (TCTGGTGGTACCACAATGTACCCT) and the reverse primer Bar (CACAACCCACACGCAGCCCTG), which amplify a product of approximately 400 base pairs (Bagust et al., Citation2004). Following confirmation of the presence of cellular DNA, the extracted DNA was used in a PCR to detect ILTV. This PCR utilized the forward primer lf (GCTGGGCTGTTTGTCAGAGTA) and the reverse primer lr (GATGTCTCTTCAGACTTCG), which amplify a product of approximately 1 kb (Devlin et al., Citation2007).
Results
Safety of glycoprotein-G-deficient ILTV
The safety of gG-deficient ILTV was investigated by comparing the clinical signs and weight gain in birds inoculated via eye-drop, aerosol or drinking water with intratracheally inoculated birds and also with uninfected birds. The clinical signs, 4 days after inoculation, are summarized in . Mild dyspnoea was observed in one bird in the intratracheally inoculated group, one bird in the group inoculated via drinking water, two birds in the group inoculated via eye-drop and five birds in the group inoculated via aerosol. No other clinical signs were observed. The clinical scores of the birds vaccinated via aerosol were significantly higher than those of uninfected birds (P=0.032).
Table 1. Clinical scores and weight gain in uninfected birds and in birds inoculated with gG-deficient ILTV via intratracheal, eye-drop, aerosol or drinking-water routes
Weight gain 21 days after inoculation is also summarized in . There was no significant difference between the weight gains of uninfected birds or those inoculated via drinking water or eye-drop. Weight gain was lowest in birds inoculated via aerosol. The weight gain of birds in this group was significantly lower than those of uninfected birds and birds inoculated via drinking water (P=0.014 and P=0.003, respectively), but did not differ significantly from those of intratracheally inoculated birds. Intratracheally inoculated birds had an intermediate weight gain that was significantly less than those birds inoculated via drinking water (P=0.026), but not significantly different from those of birds in any other group.
Two mortalities (one sudden death and one by euthanasia) occurred between vaccination and challenge. These deaths occurred in the uninfected group (8 d.p.i.) and in the intratracheally inoculated group (10 d.p.i.) and were associated with renal pathology and injury inflicted by other birds, respectively. These deaths appeared to be unrelated to inoculation with ILTV. Thus, these deaths were excluded from the investigation into the safety of gG-deficient ILTV.
Protective efficacy of glycoprotein-G-deficient ILTV
The relative protective efficacy of gG-deficient ILTV following vaccination by eye-drop, drinking water or aerosol spray was investigated by challenging the previously inoculated birds with virulent ILTV and then comparing the clinical signs, weight gain, tracheal pathology and virus excretion with unvaccinated birds, and with birds that were vaccinated intratracheally with gG-deficient ILTV.
Clinical signs were observed from day 3 to day 6 after challenge and are summarized in . No clinical signs were observed in birds vaccinated intratracheally or by eye-drop. Clinical signs were observed in one bird in the group inoculated via drinking water. This bird showed mild dyspnoea 3 days after challenge and then died suddenly 4 days after challenge. Two birds had clinical signs in the group vaccinated via aerosol. One bird had mild dyspnoea 4 days after challenge only. The second bird had moderate dyspnoea on days 4 and 5 after challenge and mild dyspnoea on day 6 after challenge. Seven birds had clinical signs in the unvaccinated group. On day 3 after challenge, mild dyspnoea was observed in three birds and moderate dyspnoea in two birds. A haemorrhagic nasal discharge was also observed in two of these birds. On day 4 post challenge, mild dyspnoea was observed in two birds, moderate dyspnoea in three birds and severe dyspnoea (requiring euthanasia) in two birds. Five days after challenge, moderate dyspnoea was observed only in one bird and mild dyspnoea in three birds. No clinical signs were observed in this group of birds from day 6 after challenge.
Table 2. Clinical scores 3 to 6 days post challenge in unvaccinated birds and in birds vaccinated with gG-deficient ILTV via intratracheal, eye-drop, aerosol or drinking-water routes
Postmortem analyses of the three birds that died 4 days after challenge revealed severe ILTV-induced tracheal pathology. Virus was detected by both PCR and isolation in the tracheal scrapings from all of these birds. The tracheal pathology, virus detection and weight gain results from these birds were excluded from further analyses, which were all performed at 7 days post challenge.
The tracheal pathology scores at day 7 after challenge are presented in . The histopathology and cumulative pathology scores in birds vaccinated intratracheally or via drinking water were significantly lower that those of unvaccinated birds and birds vaccinated via aerosol. Birds vaccinated via eye-drop had intermediate histopathology and cumulative pathology scores that were not significantly different from those of other groups. There was no difference between groups in the gross pathology scores. No ILTV was detected by virus isolation in the tracheas of any of the birds at day 7 after challenge, and was only detected by PCR in one bird from the eye-drop vaccinated group. The cellular gene β-actin was detected by PCR in all tracheal scraping DNA extracts. These results are presented in . No PCR products resulted from the reactions that used contamination control extracts as a template.
Table 3. Tracheal pathology scores 7 days after challenge in unvaccinated birds and in birds vaccinated with gG-deficient ILTV via intratracheal, eye-drop, aerosol or drinking-water routes
Table 4. Virus isolation and PCR results 7 days after challenge in unvaccinated birds and in birds vaccinated with gG-deficient ILTV via intratracheal, eye-drop, aerosol or drinking-water routes
Weight gains over the 7 days following challenge are summarized in . Weight gain was greatest in intratracheally vaccinated birds and in birds vaccinated via eye-drop. The birds vaccinated via eye-drop had a significantly greater weight gain than unvaccinated birds (P=0.001) and the birds vaccinated by aerosol (P<0.001). Birds vaccinated via drinking water had intermediate weight gains that were significantly greater than those of unvaccinated and aerosol vaccinated birds (P=0.006 and P=0.001, respectively) but significantly less than those of birds vaccinated via the intratracheal route (P=0.008). Weight gains were the lowest in the unvaccinated birds and birds vaccinated by aerosol. The weight gains in aerosol vaccinated birds were significantly less than those of birds in all other vaccinated groups, including intratracheally vaccinated birds (P<0.001).
Table 5. Weight gain over the 7 days following challenge, and over the entire study (28 days), in unvaccinated birds and in birds vaccinated with gG-deficient ILTV via intratracheal, eye-drop, aerosol or drinking-water routes
Weight gains for the entire 28 days of the study (encompassing vaccination and challenge periods) are also summarized in . Weight gains were greatest in birds vaccinated via eye-drop and drinking water and in birds vaccinated via the intratracheal route. The weight gains in these three groups were not significantly different but were significantly greater than the weight gains of unvaccinated birds (P=0.047, P=0.027 and P=0.019, respectively) and of birds vaccinated via aerosol (P<0.001, P<0.001 and P<0.001, respectively).
Discussion
gG-deficient ILTV is the first recombinant ILTV vaccine candidate to have been directly compared against conventionally attenuated commercial vaccine strains (Devlin et al., Citation2007) and to be assessed following delivery via methods suitable for mass vaccination (present study). Only a small number of other ILTV recombinants—with deletions or disruptions in the glycoprotein J, thymidine kinase, UL0 or UL47 genes—have had in vivo phenotypes that may make them suitable for vaccine use (Schnitzlein et al., Citation1995; Han et al., Citation2002; Veits et al., Citation2003; Fuchs et al., Citation2005; Helferich et al., Citation2007). These recombinants are yet to be compared with commercial vaccine strains and have only been investigated following individual inoculation in high doses. There has been some concern that a significant decrease in immunogenicity and protective efficacy may result from the inoculation of highly attenuated ILTV recombinants via methods suitable for mass vaccination (Devlin et al., Citation2007; Helferich et al., Citation2007). These concerns were realized for aerosol inoculation of gG-deficient ILTV but not for inoculation by eye-drop or via drinking water.
Aerosol and spray inoculation of ILTV vaccine strains have not enjoyed high levels of success. In previous studies, SA-2 ILTV delivered via atomizer has been associated with severe respiratory disease, decreased feed and water consumption, and lesions in the lungs and air sacs (Purcell & Surman, Citation1974). Inoculation of SA-2 ILTV via fine or coarse spray has been associated with some signs of respiratory disease, low levels of mortality and marked ocular pathology (Clarke et al., Citation1980). However, aerosol inoculation was included in this study as gG-deficient ILTV has been shown to be significantly less pathogenic than SA-2 ILTV following intratracheal inoculation (Devlin et al., Citation2007). It was hypothesized that this might translate to an acceptable level of attenuation to allow aerosol spray inoculation. This was not the case. Further improvements may be achieved by manipulating the droplet size in the administered aerosol. However, given the high level of safety and protective efficacy of gG-deficient ILTV delivered via eye-drop and drinking water, future studies are likely to focus on these routes.
In this study, the protective efficacy was investigated by challenging vaccinated birds with virulent virus, and then comparing the resulting weight gains, clinical signs, tracheal pathology and tracheal viral excretion. Assessing protective efficacy by the response to challenge, rather than relying on analysis of the concentration of serum antibodies, is a superior method for investigating ILTV vaccine efficacy, as there is generally a poor correlation between ILTV antibody titres and protection against disease (Jordan, Citation1981; Fahey & York, Citation1990). Weight gain and clinical sign scores following challenge have previously been identified as sensitive parameters for measurement of protective efficacy (Devlin et al., Citation2007). However, tracheal pathology has been shown to have a poor correlation with other measures of virulence (Guy et al., Citation1990; Devlin et al., Citation2006b, Citation2007; Kirkpatrick et al., Citation2006). In this study, the experimental end-point was extended to 7 days after challenge (instead of 4 days after challenge, as had been used previously) in order to ensure that the course of clinical disease had progressed to the recovery stage and to therefore ensure that weight gain and clinical sign scores reflected the full course of disease. At 7 days after challenge some differences in tracheal pathology scores between groups were apparent, but virus had largely been cleared from the trachea, with ILTV detected only in the trachea of one bird. In all cases, the virus detected in the tracheas of the birds (at 4 and 7 days after challenge) was the challenge strain, as determined by differential PCR (results not shown).
The safety and protective efficacy of gG-deficient ILTV delivered by the different methods of administration is likely to be influenced by the anatomical sites in which viral replication is established following vaccination. Following intratracheal and eye-drop inoculation, ILTV has been isolated from the nasal cavity, as well as the eye (eye-drop vaccination), and the larynx and trachea (intratracheal vaccination) (Robertson & Egerton, Citation1981). Following spray vaccination, ILTV has been consistently isolated from the nasal cavity, but other organs, including those of the lower respiratory tract, can also be affected (Purcell & Surman, Citation1974; Clarke et al., Citation1980). The re-isolation of ILTV following vaccination by drinking water is not as consistent. Virus has often been isolated from the nasal cavity, and occasionally from the trachea and larynx (Robertson & Egerton, Citation1981). Protection against ILTV following drinking water vaccination is believed to rely upon contamination of the nasal cavity with vaccine virus during the act of drinking (Robertson & Egerton, Citation1981). This contamination would seem to occur frequently, but not necessarily in every instance. This may account for the single death that occurred in the group vaccinated via drinking water in this study.
This study has clearly identified that gG-deficient ILTV has the potential to be used in mass-vaccination programmes when delivered via eye-drop or drinking water. Additional studies, beyond the scope of this current investigation, will be needed to reveal the extent to which gG-deficient ILTV is suitable for use under field conditions when delivered by these methods. Future studies to optimize dose rates and timing, as well as studies into virus excretion over time and the duration and breadth of immunity compared with conventionally attenuated vaccines under the same conditions, will all be needed to determine the field efficacy of this gG-deficient ILTV vaccine candidate strain.
Acknowledgements
The authors gratefully acknowledge the assistance of Dr Amir H. Noormohammadi, Ms Cheryl Colson, Ms June Daly and Ms Suzanne Medwell. The first author received support from a Science and Innovation Award for Young People in Agriculture, Fisheries and Forestry from the Bureau of Rural Science (Australia). This project was also supported by the Australian Research Council and Bioproperties (Australia) Pty. Ltd.
References
- Alcami , A. and Koszinowski , U.H. 2000 . Viral mechanisms of immune evasion . Trends in Microbiology , 8 : 410 – 418 .
- Bagust , T.J. and Johnson , M.A. 1995 . Avian infectious laryngotracheitis: virus–host interactions in relation to prospects for eradication . Avian Patholology , 24 : 373 – 91 .
- Bagust , T.J. , Jones , R.C. and Guy , J.S. 2000 . Avian infectious laryngotracheitis . Revue scientifique et technique (International Office of Epizootics) , 19 : 483 – 492 .
- Bagust , T.J. , Fenton , S.P. and Reddy , M.R. 2004 . Detection of subgroup J avian leukosis virus infection in Australian meat-type chickens . Australian Veterinary Journal , 82 : 701 – 706 .
- Bryant , N.A. , Davis-Poynter , N. , Vanderplasschen , A. and Alcami , A. 2003 . Glycoprotein G isoforms from some alphaherpesviruses function as broad-spectrum chemokine binding proteins . The EMBO Journal , 22 : 833 – 846 .
- Clarke , J.K. , Robertson , G.M. and Purcell , D.A. 1980 . Spray vaccination of chickens using infectious laryngotracheitis virus . Australian Veterinary Journal , 56 : 424 – 428 .
- Costes , B. , Ruiz-Arguello , M.B. , Bryant , N.A. , Alcami , A. and Vanderplasschen , A. 2005 . Both soluble and membrane-anchored forms of Felid herpesvirus 1 glycoprotein G function as a broad-spectrum chemokine-binding protein . Journal of General Virology , 86 : 3209 – 3214 .
- Devlin , J.M. , Browning , G.F. and Gilkerson , J.R. 2006a . A glycoprotein I- and glycoprotein E-deficient mutant of infectious laryngotracheitis virus exhibits impaired cell-to-cell spread in cultured cells . Archives of Virology , 151 : 1281 – 1289 .
- Devlin , J.M. , Browning , G.F. , Hartley , C.A. , Kirkpatrick , N.C. , Mahmoundian , A. , Noormohammadi , A.H. and Gilkerson , J.R. 2006b . Glycoprotein G is a virulence factor in infectious laryngotracheitis virus . Journal of General Virology , 87 : 2839 – 2847 .
- Devlin , J.M. , Browning , G.F. , Hartley , C.A. and Gilkerson , J.R. 2007 . Glycoprotein G deficient infectious laryngotracheitis virus is a candidate attenuated vaccine . Vaccine , 25 : 3561 – 3566 .
- Fahey , K.J. and York , J.J. 1990 . The role of mucosal antibody in immunity to infectious laryngotracheitis virus in chickens . Journal of General Virology , 71 : 2401 – 2405 .
- Fuchs , W. , Wiesner , D. , Veits , J. , Teifke , J.P. and Mettenleiter , T.C. 2005 . In vitro and in vivo relevance of infectious laryngotracheitis virus gJ proteins that are expressed from spliced and nonspliced mRNAs . Journal of Virology , 79 : 705 – 716 .
- Guy , J.S. and Bagust , T.J. 2003 . “ Laryngotracheitis ” . In Diseases of Poultry , 11th edn , Edited by: Saif , Y.M. , Barnes , H.J. , Glisson , J.R. , Fadly , A.M. , McDougald , L.R. and Swayne , D.E. 121 – 134 . Ames : Iowa State Press .
- Guy , J.S. , Barnes , H.J. and Morgan , L.M. 1990 . Virulence of infectious laryngotracheitis viruses: comparison of modified-live vaccine viruses and North Carolina field isolates . Avian Diseases , 34 : 106 – 113 .
- Guy , J.S. , Barnes , H.J. and Smith , L. 1991 . Increased virulence of modified-live infectious laryngotracheitis vaccine virus following bird-to-bird passage . Avian Diseases , 35 : 348 – 355 .
- Han , M.G. , Kweon , C.H. , Mo , I.P. and Kim , S.J. 2002 . Pathogenicity and vaccine efficacy of a thymidine kinase gene deleted infectious laryngotracheitis virus expressing the green fluorescent protein gene . Archives of Virology , 147 : 1017 – 1031 .
- Helferich , D. , Veits , J. , Teifke , J.P. , Mettenlieter , T.C. and Fuchs , W. 2007 . The UL47 gene of avian infectious laryngotracheitis virus is not essential for in vitro replication but is relevant for virulence in chickens . Journal of General Virology , 88 : 732 – 742 .
- Jordan , F.T.W. 1981 . “ Immunity to infectious laryngotracheitis ” . In Avian Immunology , Edited by: Ross , M.E. , Payne , L.N. and Freeman , B.M. 245 – 254 . Edinburgh : British Poultry Science Ltd .
- Kawaguchi , T. , Nomura , K. , Hirayama , Y. and Kitagawa , T. 1987 . Establishment and characterization of a chicken hepato-cellular carcinoma cell line, LMH . Cancer Research , 47 : 4460 – 4464 .
- Kirkpatrick , N.C. , Mahmoudian , A. , Colson , C.A. , Devlin , J.M. and Noormohammadi , A.H. 2006 . Relationship between mortality, clinical signs and tracheal pathology in infectious laryngotracheitis . Avian Pathology , 35 : 449 – 453 .
- Kongsuwan , K. , Johnson , M.A. , Prideaux , C.T. and Sheppard , M. 1993 . Identification of an infectious laryngotracheitis virus gene encoding an immunogenic protein with a predicted M(r) of 32 kilodaltons . Virus Research , 29 : 125 – 140 .
- Purcell , D.A. and Surman , P.G. 1974 . Aerosol administration of the SA-2 vaccine strain of infectious laryngotracheitis virus . Australian Veterinary Journal , 50 : 419 – 420 .
- Robertson , G.M. and Egerton , J.R. 1981 . Replication of infectious laryngotracheitis virus in chickens following vaccination . Australian Veterinary Journal , 57 : 119 – 123 .
- Schnitzlein , W.M. , Winans , R. , Ellsworth , S. and Tripathy , D.N. 1995 . Generation of thymidine kinase-deficient mutants of infectious laryngotracheitis virus . Virology , 209 : 304 – 314 .
- Veits , J. , Luschow , D. , Kindermann , K. , Werner , O. , Teifke , J.P. , Mettenleiter , T.C. and Fuchs , W. 2003 . Deletion of the non-essential UL0 gene of infectious laryngotracheitis (ILT) virus leads to attenuation in chickens, and UL0 mutants expressing influenza virus haemagglutinin (H7) protect against ILT and fowl plague . Journal of General Virology , 84 : 3343 – 3352 .