Changes of haematic parameters, redox status and mitochondrial complex activity in the heart and liver of broilers fed with different density diets under low ambient temperature

Abstract

This experiment was conducted to investigate the influence of dietary nutrient density on haematic parameters, oxidative status and mitochondrial complex activity in the heart and liver of broilers under low ambient temperature. Eight-day-old male ROSS-308 chickens were randomly divided into two treatments fed with normal (control) and high metabolizable energy (ME) and crude protein density (H) diets. A high nutrient density diet increased body weight gain and reduced the feed conversation ratio during the first 3 weeks. Increased ascites-related mortality (weeks 4 to 6), right ventricle/total ventricle (week 6), blood haemoglobin (weeks 2 and 4) and mean corpuscular haemoglobin (week 2) were observed in treatment H. Levels of malonaldehyde and protein carbonylation were increased at week 4, and activities of glutathione peroxidase at week 4 and CuZn superoxide dismutase and catalase at week 6 were decreased in the heart; only malonaldehyde (week 6) was increased in the liver in treatment H. Relative mRNA expression of hypoxia inducible factor-1 (heart) was increased and heme oxygenase-1 (heart and liver) was decreased at week 4 in broilers fed with high ME and protein diet. Activities of mitochondrial complex III and IV (week 6) in the heart, and complex I (week 6) and complex III and IV (week 4) in the liver were decreased in treatment H. In conclusion, high levels of dietary ME and protein resulted in oxidative stress and high incidence of ascites in broilers under low ambient temperature. Heart dysfunction was primarily attributed to ascites development, in which oxidative injury and inhibition of mitochondrial complex activity were involved.

Introduction

Ascites (“water belly”) is a metabolic disorder, characterized by hypoxaemia, pulmonary hypertension (PHS), and fluid accumulation in the abdominal cavity. It mostly occurs in fast-growing broiler chickens due to the high demand for oxygen. High altitude, poor ventilation, low ambient temperature and rapid growth rate are known to accelerate ascites development (Wideman, 2001; Baghbanzadeh & Decuypere, 2008). Anoxia is the pivotal factor attributed to ascites development (Julian, 2000). The relative deficiency of oxygen exchange increases the workload of the cardiopulmonary system and central venous congestion (Luger et al., 2003). Those cardiovascular changes cause serial physiological reactions such as higher blood viscosity, hypertension, and cardiopulmonary failure (Baghbanzadeh & Decuypere, 2008; Moller et al., 2009). Although the pathological process has been known for many years, the detailed mechanism is not yet clear. Ascites causes an important economic loss in the broiler industry, affecting an estimated 4.7% of broilers worldwide (Maxwell & Robertson, 1997). It was reported that 5% of broilers and 20% of roaster birds die of ascites (Balog et al., 2003). Thus it is of practical significance to clarify the mechanism for development of preventive measures to control ascites.

Oxidative stress is an imbalance between oxidation and anti-oxidation that tends to oxidation. It was widely accepted that oxidative stress was positively related to ascites. Reactive oxygen species, mainly derived from mitochondria, can directly simulate vascular remodelling and pulmonary hypertension (Herget et al., 2000; Bautista-Ortega et al., 2010). Broilers exposed to a high-level energy diet were more susceptible to oxidative stress and to developing ascites (Cardoso et al., 2010). On the contrary, feed restriction can decrease oxidative damage and ascites mortality (Pan et al., 2005; Ozkan et al., 2010). Ascites mortality was also dramatically reduced by adding anti-oxidative substances (vitamin E, vitamin C, lipoic acid, etc.) into the diet (Al-Taweil & Kassab, 1990; Bottje et al., 1995; Diaz-Cruz et al., 2003; Fathi et al., 2011). However, some reports showed no impact of antioxidants on ascites mortality in broilers (Bottje et al., 1997; Arreita Acevedo et al., 1999; Villar-Patino et al., 2002; Ozkan et al., 2007). The present study aimed to investigate the status of oxidative stress and its relation with ascites development based on haematic parameters, redox status and mitochondrial complex activity in broilers fed with different metabolizable energy (ME) and protein density diets under low ambient temperature.

Materials and Methods

Bird management and diet

The design and conduct of this study were approved by the Institutional Animal Care and Use Committee of China Agricultural University. Three hundred and ninety-two 8-day-old male broiler chickens (Ross 308) were randomly divided into two treatments with 14 pens of 14 birds each, and exposed to normal (Control) and high ME diets (H). The room temperature was maintained at 35°C during the first week, 33°C in the second week, and ranged from 14 to 20°C in the third week. No artificial ventilation was operated throughout whole period of the experiment. Chickens were reared on plastic wire floors (2.4 m×0.6 m× 0.6 m) and freely accessed feed and water. Feeds were provided as crumbles during the first week and subsequently substituted with whole pellets. The light programme was 23 h light:1 h dark. Chickens were vaccinated for Newcastle disease and infectious bronchitis on days 7 and 21, and infectious bursal disease on days 14 and 28. Diets were formulated based on NY/T33-2004 of China. The apparent metabolizable energy (AME) /crude protein (calculated value) ratio was equal in starter (0.14) and finisher diets (0.16), respectively (Table 1).

Table 1.  Composition and nutritional level of experimental diets (%).

	Starter (days 1 to 21)		Grower (days 22 to 42)
Ingredient	Control	H	Control	H
Corn	50.85	47.40	56.07	54.43
Soybean meal	32.54	24.43	28.66	22.40
Corn protein	4.05	12.00	2.37	8.12
Wheat middling and red dog	6.00	6.00	6.00	6.00
Soybean oil	2.00	5.32	3.00	5.00
Limestone	1.25	1.29	1.24	1.27
Dicalcium phosphate	1.91	1.94	1.51	1.53
Lys·HCl	0.29	0.46	0.10	0.24
d,l-Met	0.16	0.10	0.11	0.06
Choline chloride (50%)	0.30	0.30	0.30	0.30
NaCl	0.30	0.30	0.30	0.30
Aureomycin	0.10	0.10	0.10	0.10
Antioxidants	0.02	0.02	0.02	0.02
Vitamin premix^a	0.03	0.03	0.02	0.02
Trace mineral premix^b	0.20	0.20	0.20	0.20
Nutritive value (calculated)
Apparent metabolizable energy (mcal/kg)	2.90	3.20	3.00	3.20
Crude protein^c	20.45	23.51	17.97	18.89
Lysine	1.25	1.25	1.00	1.00
Methionine	0.49	0.49	0.40	0.40
Threonine	0.79	0.81	0.71	0.72
Tryptophan	0.23	0.22	0.21	0.20
Calcium	1.00	1.00	0.90	0.90
Available phosphorus	0.45	0.45	0.38	0.38
^aSupplied per kilogram of diet: vitamin A, 12,500 IU; vitamin D3, 2500 IU; vitamin E, 30 IU; vitamin K3, 2.65 mg; thiamine, 2 mg; riboflavin, 6 mg; vitamin B12, 0.025 mg; biotin, 0.0325 mg; folic acid, 1.25 mg; pantothenate acid, 12 mg; niacin, 50 mg. ^bSupplied per kilogram of diet: copper, 8 mg; zinc, 75 mg; iron, 80 mg; manganese, 100 mg; selenium, 0.15 mg; iodine, 0.35 mg. ^cAnalysed value.

Growth performance

Body weight and feed intake (FI) were weighed as 14 replicates on days 21 and 42. From these data, the body weight gain (BWG), FI and feed conversation ratio (FCR) were calculated and corrected by mortality. Dead chickens were recorded daily and ascites and total mortality were calculated. All dead broilers were subjected to necropsy and those with accumulation of abdominal or pericardial fluid were diagnosed as ascites.

Sample procedure and measurements

At the age of weeks 2, 4, and 6, birds randomly selected from each pen were weighed and sacrificed by jugular vein slit after 8 h of fasting. Blood samples were collected into EDTA-K₃ anticoagulant tubes. Red blood cells, haemoglobin (HGB), haematocrit (HCT), mean corpuscular volume and mean corpuscular haemoglobin concentration (MCHC) in the blood were determined on the sampling day with an automatic blood analyser (Sysmex KX-21N, Kobe, Japan). After taking blood samples, the chickens were killed and the heart, liver, and lung were weighed to calculate organ indices (organ weight/body weight×100). The heart was then further divided and the ascites heart index was calculated by the ratio of right ventricle weight to total ventricle weight (RT/TV). Tissue samples of the heart and liver were quickly put into liquid nitrogen and stored at −80°C for determination of mRNA expression and redox parameters.

Redox status parameters

Slices of heart and liver samples (0.8 g) were homogenized in ice-cold saline (7.2 ml, 0.86%) using an Ika T10 basic Ultra-Turrax homogenizer (Ika, Staufen, Germany) and centrifuged at 1370×g at 4°C for 15 min. The supernatant phase was obtained to determine levels of malonaldehyde (MDA), protein carbonylation (PC), glutathione peroxidase (GSH-Px), copper zinc superoxide dismutase (CuZn-SOD), catalase (CAT) and protein concentration with colorimetric assay kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). The MDA level was measured with the thiobarbituric acid method (Richard et al., 1992). The compound 1,1,3,3-tetraethoxypropane was used as a positive control, and absolute ethanol as the negative control. Assays of PC content and activities of GSH-Px, CuZn-SOD and CAT contained a self-control for each sample. Total PC was determined using the 2,4-dinitrophenylhydrazine method (Oliver et al., 1987). The amount of carbonyls was expressed as nanomoles of carbonyl per milligram of tissue proteins using an absorption coefficient of 21.0/nM/cm at 370 nm. The GSH-Px activity was determined using a direct measurement of the remaining glutathione (GSH) after the enzyme-catalysed reaction. The GSH concentration was measured after reaction with 5,5-dithiobis-2-nitrobenzoic acid (Hafeman et al., 1974). One unit was defined as the amount of GSH-Px per milligram of protein tissue that would catalyse the conversion of 1 µmol/l GSH to oxidized GSH at 37°C in 1 min. CuZn-SOD activity was determined using a xanthine oxidase method based on the inhibitory effect on the rate of superoxide-dependent reduction of nitro blue tetrazolium (Oyanagui, 1984). One unit was defined as the amount of SOD per milligram of protein tissue that inhibits 50% of nitrite formation at 37°C. The CAT activity was determined with an ammonium molybdate method (Goth, 1991). The spectrophotometric assay of hydrogen peroxide was based on formation of its stable complex with ammonium molybdate. One unit of CAT activity was defined as the amount of CAT per milligram of protein tissue that would decompose 1 µmol hydrogen peroxide at 37°C in 1 sec. Protein quantification was performed by the Coomassie brilliant blue assay, with bovine serum albumen (BSA) as the standard (Sedmak & Grossberg, 1977).

RNA extraction and quantitative real-time polymerase chain reaction

Total RNA was isolated from individual heart and liver tissue using Trizol reagent according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, California, USA). The amount and quality of total RNA was evaluated using a biophotometer (AG 22331; Eppendorf, Hamburg, Germany). Only RNA of sufficient purity (absorbance ratio A260/280 > 1.8) was considered to reverse transcribe cDNA in a 20 µl volume containing 1 µg total RNA. Reverse transcription was carried with a reverse transcription kit according to the protocol of the manufacturer (Invitrogen Life Technologies). Individual cDNA was diluted 1:1 before amplification. A quantitative real-time polymerase chain reaction (PCR) assay was performed with the 7500 fluorescence detection system (Applied Biosystems, Foster City, California, USA) according to optimized PCR protocols using the SYBR^® Select Master Mix PCR kit (Applied Biosystems). Gene-specific primers of CuZn-SOD, manganese superoxide dismutase (Mn-SOD), cytosolic glutathione peroxidase (GPX1), heme oxygenase-1 (HO-1), hypoxia inducible factor-1 (HIF-1α) were used, and glyceraldehyde-3-phosphate dehydrogenase was used as an endogenous reference gene (Table 2). The PCR conditions were as follows: 50°C for 2 min, 95°C for 10 min, 40 cycles at 95°C for 15 sec, the annealing and extension temperature at 60°C for 1 min, and a final extension step of 72°C for 10 min. To confirm amplification specificity, the PCR products from each primer pair were subjected to a melting curve analysis and subsequent agarose gel electrophoresis. Gene expression was quantified using the comparative threshold cycle method (Heid et al., 1996) and the data were expressed as the relative value to the unchallenged group.

Table 2.  Primers used for quantitative real-time PCR analysis^a.

Target	Accession number	5′ primer	Product size (base pairs)	Reference
GPX1	HM_590226	F: AACCAATTCGGGCACCAG	122	(Yuan et al., 2012)
		R: CCGTTCACCTCGCACTTCTC
CuZn-SOD	NM_205064	F: TTCTCTTACCGGACCACACTG	128	(Doi et al., 2011).
		R: CACAAGCTAAACGAGGTCCAG
Mn-SOD	NM_204211	F: CACTCTTCCTGACCTGCCTTAC	400	(Li et al., 2004)
		R: TAGACGTCCCTGCTCCTTATTA
GAPDH	NM_204305	F: GGTGAAAGTCGGAGTCAACGG	108	(Druyan et al., 2007)
		R: CGATGAAGGGATCATTGATGGC
HO-1	NM_205344	F: GGTCCCGAATGAATGCCCTTG	137	(Druyan et al., 2007)
		R: ACCGTTCTCCTGGCTCTTGG
HIF-1α	NM_204297	F: AAAGAATTACAGAGTTGATGG	173	(Druyan et al., 2007)
		R: GTAGCCACCTTGTTTAGC
^aF, forward; R, reverse.

Respiratory complex activities

Heart and liver mitochondria were obtained by differential centrifugation procedures as described by Cawthon et al. (1999). The activities of the respiratory chain complexes were analysed using a spectrophotometer (Ultrospec 2100 Pro; Biochrom, Berlin, Germany) as described by Hatefi & Stiggall (1978), Iqbal et al. (2004) and Liu et al. (2007). The complex activities were expressed in units of activity per minute per milligram of mitochondrial protein.

Complex I activity

Mitochondria (100 µg protein) were incubated in reaction solution (50 mM Tris–HCl, 1.3 mM DCIP) at 37°C for 5 min. Adding 15 mM nicotinamide adenine dinucleotide (NADH) initiated the reaction (final volume of 1 ml) for 10 min. The decrease of absorption due to NADH oxidation represented activity of complex I and was quantified using an extinction coefficient of 6.22/mM/cm.

Complex III activity

In reaction medium containing 35 mM KH₂PO₄, 5 mM MgCl₂, 3 mM KCN, 0.25% BSA, 15 µM cytochrome c and 1 µM rotenone, 40 µg mitochondria protein were added to a final volume of 1 ml. Absorption changes were monitored at 550 nm for 10 min. Activity of complex III was calculated by an extinction coefficient of 19.2/mM/cm.

Complex IV activity

The activity was measured by the oxidation of reduced cytochrome c (cytochrome c was reduced with 0.05 to 0.10 M sodium dithionite) as a decrease in absorption at 550 nm. Reaction solution contained 10 mM Tris–HCl, 35 mM KH₂PO₄,5 mM MgCl₂,3 mM KCN, 0.25% BSA, 15 µM reduced cytochrome c and 1 µM rotenone to a final volume of 1 ml. Reaction was initiated by adding approximate 40 µg mitochondrial protein and oxidation lasted for 10 min as absorbance changed at 550 nm. An extinction coefficient of 19.2/mM/cm was used.

Statistical analysis

Data were analysed by one-way analysis of variance using the general linear model procedure (IBM Corp., Somers, NY, USA). Data <0.3 or> 0.7 were transformed by DEGREES ASIN SQRT n, and mortality was transformed to DEGREES ASIN SQRT (n+1) for analysis. A post hoc Student's test was used to separate means that significantly differ at P<0.05.

Results

Growth performance, ascites and mortality

During the first 3 weeks, BWG (P < 0.01) was increased and FCR (P < 0.01) was decreased in birds fed with a high ME diet (Table 3). During the age of weeks 3 to 6, there was still increased BWG (P = 0.059) in the treatment fed with high density diet, whereas FI and FCR were not significantly different between the two treatments. During the age of weeks 0 and 2, no ascites mortality was noted. From weeks 2 to 4, ascites and total mortality were numerically higher in treatment H but not significant. Ascites and total mortality were significantly higher in birds fed with high levels of ME diet and protein during the age of weeks 4 and 6.

Table 3.  Effect of different density diets on growth performance and mortality of broilers under low ambient temperature^a.

		Control	H	SEM	P value
Growth performance
Weeks 0 to 3	BWG (g)	647^B	693^A	8.02	<0.01
Weeks 0 to 3	FI (g)	1123	1149	8.36	NS
Weeks 0 to 3	FCR (g/g)	1.74^A	1.66^B	0.01	<0.01
Weeks 3 to 6	BWG (g)	1459	1699	64.8	NS
Weeks 3 to 6	FI (g)	3224	3411	94.2	NS
Weeks 3 to 6	FCR (g/g)	2.24	2.02	0.09	NS
Mortality (%)
Weeks 0 to 2	Ascites	0.00	0.00	0.00	–
	Total	0.00	0.51	0.26	NS
Weeks 2 to 4	Ascites	0.55	1.10	0.60	NS
	Total	0.77	1.88	1.36	NS
Weeks 4 to 6	Ascites	8.20^B	21.32^A	2.52	<0.01
	Total	16.23^B	24.30^A	3.28	<0.05
^aValues are the mean and pooled standard error of the mean (SEM), n=14 chickens/group. Means within the same column not sharing a common uppercase superscript letter differ significantly (P<0.05). NS, not significant.

Blood parameters, lung and ascites heart indices

Blood HGB (weeks 2 and 4; P < 0.05), MCH (week 2; P < 0.05), MCHC (week 4; P < 0.01) were increased in treatment H (Table 4). All blood parameters were observed not to be different between the treatments at the age of week 6. Lung index (P < 0.05) and RV/TV (P < 0.01) were increased only at the age of week 6 of birds exposed to high density diet. Red blood cells, HCT, mean corpuscular volume, and heart and liver indices (data not shown) in blood were not different.

Table 4.  Effect of different density diets on haematic parameters, lung index and RV/TV of broilers under low ambient temperature^a.

		Control	H	SEM	P value
Week 2	HGB (g/l)	97.0^B	101.9^A	1.22	<0.05
	MCH (pg)	43.6^B	45.3^A	0.42	<0.05
	MCHC (g/l)	319.8	310.2	10.8	NS
	RV/TV (g/g)	0.19	0.20	0.005	NS
	Lung index (%)	0.66	0.61	0.460	NS
Week 4	HGB (g/l)	113.3^B	118.4^A	1.26	<0.05
	MCH (pg)	42.3	42.9	0.23	NS
	MCHC (g/l)	318^B	324^A	1.08	<0.01
	RV/TV (g/g)	0.21	0.21	0.007	NS
	Lung index (%)	0.41	0.42	0.016	NS
Week 6	HGB (g/l)	96	98	1.86	NS
	MCH (pg)	34.3	34.6	0.31	NS
	MCHC (g/l)	272	269	2.85	NS
	RV/TV (g/g)	0.25^B	0.30^A	0.009	<0.05
	Lung index (%)	0.35^B	0.46^A	0.019	<0.01
^aValues are the mean and pooled standard error of the mean (SEM), n=8 chickens/group. Means within the same column not sharing a common uppercase superscript letter differ significantly (P<0.05). NS, not significant.

Oxidative status

At the age of week 2, all oxidative indices in the heart were not different between treatments (Table 5). At the age of week 4, contents of MDA and PC were increased (P < 0.05) and GSH-Px activity was decreased (P < 0.05) in the heart of birds feed with high density diet. At the age of week 6, activities of CuZn-SOD and CAT were decreased (P < 0.05) in the heart and MDA was increased in the liver of chickens in treatment H.

Table 5.  Effect of different density diets on oxidative status in the heart and liver of broilers under low ambient temperature^a.

		Heart				Liver
		Control	H	SEM	P value	Control	H	SEM	P value
Week 2	MDA (nmol/mg protein)	0.76	0.78	0.03	NS	0.75	0.77	0.03	NS
	PC (nmol/mg protein)	6.06	6.30	0.29	NS	3.05	4.12	0.29	NS
	CuZn-SOD (U/mg protein)	105.54	87.01	5.76	NS	133.00	130.50	6.66	NS
	GSH-Px (U/mg protein)	29.56	28.66	0.74	NS	38.14	34.27	1.04	NS
	CAT (U/mg protein)	5.14	5.29	0.30	NS	18.80	19.37	1.53	NS
Week 4	MDA (nmol/mg protein)	0.78^B	0.96^A	0.05	<0.05	0.84	0.84	0.02	NS
	PC (nmol/mg protein)	5.06^B	8.05^A	0.71	<0.05	4.63	4.35	0.15	NS
	CuZn-SOD (U/mg protein)	116.55	105.00	4.47	NS	124.83	126.83	5.87	NS
	GSH-Px (U/mg protein)	30.27^A	25.36^B	1.26	<0.05	34.16	33.11	0.69	NS
	CAT (U/mg protein)	4.50	4.67	0.26	NS	30.05	24.79	1.50	NS
Week 6	MDA (nmol/mg protein)	0.88	0.84	0.03	NS	0.86^B	1.09^A	0.04	<0.05
	PC (nmol/mg protein)	5.94	5.66	0.43	NS	5.78	4.94	0.22	NS
	CuZn-SOD (U/mg protein)	103.70^A	90.06^B	3.14	<0.05	114.50	122.17	4.77	NS
	GSH-Px (U/mg protein)	33.71	36.26	1.05	NS	39.48	36.42	1.10	NS
	CAT (U/mg protein)	4.95^A	4.10^B	0.21	<0.05	16.66	14.52	1.56	NS
^aValues are the mean and pooled standard error of the mean (SEM), n=8 chickens/group. Means within the same column not sharing a common uppercase superscript letter differ significantly (P<0.05). NS, not significant.

CuZn-SOD, Mn-SOD, GPX1, HO-1 and HIF-1α mRNA expression

The relative expression of mRNA of GPX1 (P=0.067) and HO-1 (P < 0.001) were increased in the heart in group H at week 2; thus, no difference was observed in the liver (Table 6). At week 4, relative expression of HIF-1α (heart) was elevated, and CuZn-SOD mRNA (heart and liver), Mn-SOD mRNA (heart and liver), GPX1 mRNA (liver) and HO-1 mRNA (heart and liver) were significantly decreased (P < 0.05) in chickens fed with high density diet. At the age of week 6, only CuZn-SOD mRNA (heart, P = 0.057 and liver, P < 0.05) and Mn-SOD mRNA (liver, P = 0.087) were decreased in treatment H.

Table 6.  Effect of different density diets on relative mRNA expression in the heart and liver of broilers under low ambient temperature^a.

		Heart				Liver
		Control	H	SEM	P value	Control	H	SEM	P value
Week 2	SOD1	1.00	1.26	0.12	NS	1.00	1.00	0.18	NS
	SOD2	1.00	1.26	0.10	NS	1.00	0.99	0.07	NS
	GPX1	1.00	1.63	0.16	NS	1.00	1.02	0.08	NS
	HO-1	1.00^B	1.70^A	0.12	<0.001	1.00	0.78	0.10	NS
	HIF-1α	1.00	0.83	0.16	NS	1.00	0.73	0.18	NS
Week 4	SOD1	1.00^A	0.36^B	0.14	<0.01	1.00^A	0.22^B	0.19	<0.05
	SOD2	1.00^A	0.49^B	0.12	<0.05	1.00^A	0.41^B	0.16	<0.05
	GPX1	1.00	0.48	0.20	NS	1.00^A	0.21^B	0.17	<0.01
	HO-1	1.00^A	0.46^B	0.14	<0.05	1.00^A	0.40^B	0.13	<0.05
	HIF-1α	1.00^B	2.06^A	0.24	<0.01	1.00	0.81	0.17	NS
Week 6	SOD1	1.00	0.29	0.19	NS	1.00^A	0.47^B	0.12	<0.05
	SOD2	1.00	0.88	0.16	NS	1.00	0.48	0.15	NS
	GPX1	1.00	0.38	0.20	NS	1.00	1.22	0.09	NS
	HO-1	1.00	0.69	0.17	NS	1.00	1.48	0.16	NS
	HIF-1α	1.00	0.46	0.18	NS	1.00	0.72	0.24	NS
^aValues are the mean and pooled standard error of the mean (SEM), n=6 chickens/group. Means within the same column not sharing a common uppercase superscript letter differ significantly (P<0.05). NS, not significant.

Mitochondrial complex activity

At week 2, in treatment H there was higher mitochondrial complex IV activity (P < 0.001) in the heart, but not in the liver (Table 7). At week 4 there was no difference in mitochondrial complex activity in the heart between treatments; however, lower activities of complex III (P < 0.01) and IV (P < 0.001) occurred in the liver. At the age of week 6, activities of mitochondrial complex III and IV in the heart and complex I in the liver were decreased in broilers receiving high ME and protein diet.

Table 7.  Effect of different density diets on mitochondrial complex activity in the heart and liver of broilers under low ambient temperature^a.

		Heart				Liver
		Control	H	SEM	P value	Control	H	SEM	P value
Week 2	Complex I	4.68	6.77	0.67	NS	21.79	21.95	1.07	NS
	Complex III	2.646	2.911	0.096	NS	1.678	1.648	0.044	NS
	Complex IV	0.598^B	1.016^A	0.065	<0.001	0.825	0.971	0.054	NS
Week 4	Complex I	5.98	6.66	0.47	NS	19.23	21.34	1.26	NS
	Complex III	2.371	2.245	0.055	NS	1.709^A	1.346^B	0.062	<0.01
	Complex IV	0.551	0.485	0.091	NS	0.651^A	0.209^B	0.065	<0.001
Week 6	Complex I	5.72	6.82	0.53	NS	26.56^A	16.89^B	2.21	<0.05
	Complex III	2.811^A	1.841^B	0.195	<0.01	1.543	1.629	0.105	NS
	Complex IV	1.562^A	0.644^B	0.220	<0.05	0.334	0.369	0.032	NS
^aValues (U/g protein) are the mean and pooled standard error of the mean (SEM), n=8 chickens/group. Means within the same column not sharing a common uppercase superscript letter differ significantly (P<0.05). NS, not significant.

Discussion

In the present study, higher dietary metabolizable energy and crude protein increased growth and decreased FCR during the first 3 weeks of the growing period. Much research demonstrated that high level of dietary energy resulted in higher body weight gain (Pesti & Smith, 1984; Leeson et al., 1996a; Leterrier et al., 1998), and lower FCR (Deaton et al., 1983). In contrast, a dilution of dietary energy and protein increased feed intake (Leeson et al., 1996b), and that was possibly because the broiler is able to control the feed intake based on the energy level in the diet (Leeson et al., 1996b). Ascites mortality and total mortality were increased in treatment H during weeks 2 to 4 and weeks 4 to 6. The result was consistent with a previous report (Julian et al., 1989). Relative oxygen deficiency will aggravate susceptibility to ascites in broilers with high growth intensity (Julian, 2000; Camacho et al., 2004; Ipek & Sahan, 2006). It was shown that weeks 4 to 6 was the peak period during which broilers were growing fast.

HGB plays a crucial role in oxygen-carrying in blood. Blood HGB (weeks 2 and 4), MCH (week 2), and MCHC (week 4) were increased in treatment H. The increment of HGB content in red blood cells might be a compensatory consequence for hypoxia in birds from treatment H. Higher amounts of HGB in red blood cells will help birds to obtain more oxygen to combat hypoxia. Previous research documented that HCT was increased in ascites or PHS birds under low ambient temperature (Ozkan et al., 2007; Aksit et al., 2008). Our results showed only a numeral increment of HCT in blood of birds from high ME treatment. In the current study, the RV/TV value was 0.30 at week 6, which is regarded as a threshold indicator of pulmonary hypertension and ascites (Huchzermeyer et al., 1988; Julian, 1993; Currie, 1999; Wideman, 2000). Similar results were reported that RV/TV was increased in PHS broilers at low ambient temperature (Ozkan et al., 2007; Li et al., 2010). The relative lung weight index was elevated at the age of week 6, implying an adaptive change for more oxygen exchange. It can be inferred that high levels of dietary ME and protein enhanced the sensitivity of ascites in broilers, and blood parameter change occurred earlier than organ indices.

In the present study, high levels of dietary ME and protein resulted in oxidative damage in the heart of the broilers for the increased concentration of MDA and PC (week 4), and lowered activity of GSH-Px (week 4) and CuZn-SOD (week 6). However, in the liver higher MDA was only noted at week 6, suggesting that the heart was more susceptible to oxidative damage than the liver. A higher energy diet will enhance the metabolic rate and reactive oxygen species (ROS) production. In over-feeding broiler breeders, hepatic haemorrhage associated with oxidative stress was observed (Ahmadi et al., 2010). Indeed, oxidative injury with increased blood MDA content (Ozkan et al., 2007) and decreased anti-oxidative enzyme activity (Aksit et al., 2008) were involved in ascites or PHS broilers. It was also documented that broilers at risk of developing ascites syndrome showed oxidative damage in the heart, liver and lung (Bottje et al., 1995; Diaz-Cruz et al., 1996). Supplementation of anti-oxidants such as vitamin E, vitamin C, thioctic acid and selenium can ameliorate oxidative stress and reduce ascites or PHS related mortality (Bottje et al., 1995; Diaz-Cruz et al., 2003; Pan et al., 2005; Aksit et al., 2008).

Hypoxia can induce oxidative stress via an over-generation of ROS (Pialoux et al., 2009). The activity of HIF is largely determined by the induction of the HIF-α subunit in response to hypoxia. HO-1, a stress response protein, can degrade oxidant heme and generate the antioxidant bilirubin in response to various environmental stimuli to serve a cytoprotective function (Wu et al., 2011). At the age of week 2, mRNA expression of HO-1 was significantly elevated in treatment H. A compensatory mechanism could be proposed, by which oxidative stress could be ameliorated by enhanced HO-1 expression. In the current study, relative expression of HIF-1α (week 4) was elevated and HO-1 (week 4) was lowered in the heart, which was consistent with change of blood parameter and tissue redox status, and further confirmed that the heart was subjected to oxidative damage by hypoxia. Under anoxic conditions, excess production of ROS will stimulate vascular remodelling due to the abnormal metabolism of vascular wall matrix proteins (Bottje & Wideman Jr, 1995; Herget et al., 2000). Meanwhile, ROS reduced bioavailability of nitric oxide (Bautista-Ortega et al., 2010), which may aggravate cardiovascular dysfunction and increase ascites incidence in broilers.

Mitochondria play an important role in adenosine triphosphate (ATP) biosynthesis and are regarded as an “energy factory”; however, along with ATP synthesis, ROS will also be released to cytoplasm. Mitochondrial superoxide radicals occur primarily at two discrete sites of electron transport chain, named complex I (NADH dehydrogenase) and complex III (ubiquinone cytochrome c reductase). Complex III is the main source of ROS (Finkel & Holbrook, 2000). Inhibitors to mitochondrial complex I (rotenone) or complex III (antimycin) can increase hydrogen peroxide production (Pitkänen et al., 1996; Pitkanen & Robinson, 1996; Raha & Robinson, 2000). Therefore, the reduction of mitochondrial complex activity might partially be attributed to oxidative damage in the heart and liver in the present study. It had been confirmed that oxidative injury in mitochondria was positively related to ascites and PHS in broilers (Cawthon et al., 2001; Iqbal et al., 2001; Iqbal et al., 2002). Oxidative stress was associated with inhibition of mitochondrial complex activity, and accelerated heart and lung dysfunction and ascites formation in broilers.

In summary, a diet with high levels of ME and protein resulted in a rapid growth rate, high incidence of ascites, tissue anoxia and oxidative stress in broilers under low ambient temperature. The heart was more susceptible than the liver to oxidative injury in ascites chickens. Oxidative stress and inhibited mitochondrial complex activity in the heart might be the partial mechanism for ascites occurrence.

Acknowledgements

This study was financed by Beijing Natural Science Foundation (6111002) and the Ear-marked Fund for China Agriculture Research System.