Comparison of the short-term and long-term efficacies of the Mycoplasma gallisepticum vaccines ts-11 and 6/85

ABSTRACT

In order to compare the short-term efficacies of the live attenuated Mycoplasma gallisepticum (MG) vaccine strains ts-11 and 6/85, four groups of SPF chickens were vaccinated with each of the vaccines using eye drop and aerosol inoculations, and were subsequently challenged with a wild-type MG strain. When administered by the recommended routes (eye drop for ts-11 and fine aerosol for 6/85), both vaccines induced substantial and comparable levels of protection against airsacculitis and tracheitis caused by wild-type MG. The long-term efficacies of the two vaccines administered by the recommended route were also assessed. Serum antibody responses and colonization of the vaccines in the upper respiratory system were monitored at different time points after vaccination, and protective efficacies of the vaccines were evaluated at 36 weeks post vaccination as above. Systemic antibody response following ts-11 eye drop vaccination was initially strong but reduced gradually over time while, in contrast, that to 6/85 spray vaccination was initially weak but increased over time. Kinetics of the antibody response to the vaccines appeared to be correlated with the number of birds harbouring each vaccine in their upper respiratory system throughout the sampling timepoints. Regardless of the levels of serum antibodies or number of birds harbouring the vaccine, both vaccines induced substantial and comparable levels of protection against airsacculitis and tracheitis caused by wild-type MG. Therefore, kinetics of systemic antibody response and persistence in the upper respiratory system varies between vaccine strains; however, the levels of protection may not, at least up to 36 weeks post vaccination.

RESEARCH HIGHLIGHTS

• The kinetics of systemic antibody response and persistence of the vaccine in the upper respiratory system varies between vaccine strains ts-11 and 6/85.

• The levels of protection induced by the two vaccines against virulent MG strain challenge are comparable when they are administered by the route recommended by their manufacturers.

KEYWORDS:

• Mycoplasma gallisepticum
• vaccine
• live vaccine
• protection
• comparison
• efficacy

Abbreviations::

• MB: modified Frey’s mycoplasma broth
• MG: Mycoplasma gallisepticum
• NV: Non-vaccinated
• PCR: polymerase chain reaction
• RSA: rapid serum agglutination
• SPF: specific-pathogen-free
• SD: standard deviation

Introduction

Mycoplasma gallisepticum (MG) is a major pathogen of poultry worldwide, causing respiratory tract infection and impaired egg production (Raviv & Ley, 2013). Live attenuated MG vaccine strains, ts-11 (Vaxsafe^® MG) and 6/85 (MYCOVAC-L^®), are used to control MG in commercial chicken flocks in many countries. The efficacy and safety of these two vaccines have been subjected to extensive investigations (Whithear et al., 1990a, b; Evans & Hafez, 1992; Abd-el-Motelib & Kleven, 1993; Ley et al., 1997; Barbour et al., 2000; Biro et al., 2005). One of these studies (Ley et al., 1997) has investigated the mid-term (up to 105 days post vaccination) safety, kinetics of the antibody response and transmissibility of the two vaccines. However, no study has compared the long-term efficacies of, or the kinetics of the antibody responses to, these two vaccines side by side. The fact that some of these studies (Abd-el-Motelib & Kleven, 1993; Ley et al., 1997) have used different routes for vaccination for a single vaccine, makes it difficult to compare the results from two separate reports.

The main objectives of the current study were to compare the short- and the long-term efficacies of ts-11 and 6/85 vaccines in terms of protection against challenge with a field strain of MG, and also to monitor the vaccine colonization and serological conversion status when each vaccine was administered by the registered and alternate routes, that is, ts-11 vaccine administered by spray, and 6/85 vaccine administered by eye drop.

Materials and methods

Mycoplasma vaccines/cultures

Commercial batches of ts-11 (Vaxsafe^® MG, Bioproperties Pty Ltd, Ringwood, Australia) and 6/85 (MYCOVAC-L^®, MSD Animal Health America, Millsboro, DE) vaccines were used for vaccination of chickens. An aliquot of the same vial of the commercial ts-11 and 6/85 vaccines used for vaccination of birds was subjected to titration at 33°C and 37°C respectively. The virulent MG field strain Ap3AS (Soeripto et al., 1989) was grown in modified Frey’s mycoplasma broth (MB) to late logarithmic phase of growth (Whithear, 1993), diluted at 1/100 in MB and used for aerosolization of birds as described previously (Whithear et al., 1996). An aliquot of the diluted culture was also subjected to titration at 37°C.

Chickens and experimental design

Two vaccine efficacy chicken experiments, one short-term (6 weeks post vaccination) and the other long-term (36 weeks post vaccination), were conducted concurrently as part of this study (Tables 1 and 3 respectively). In both experiments, five-week-old SPF Hybrid White Leghorn chickens obtained from SPAFAS Australia Pty Ltd were housed in negative pressure isolators, and vaccinated with either ts-11 or 6/85 strains as described in Tables 1 and 3.

Table 1. Short-term efficacy experiment: median and range of scores for RSA and air sac lesions, and mean and standard deviation for mucosal thicknesses of upper trachea (UT), middle trachea (MT), lower trachea (LT) and average tracheal thickness of chickens 6 weeks after inoculation with MG strains ts-11 or 6/85, or with MB, and 2 weeks after exposure to aerosols of a virulent MG strain (groups 1–5) or to MB (group 6).

Group	Treatment	Number	Median RSA score^1 (range)	Median air sac lesion score^1 (range)	Tracheal mucosal thickness in µm^1 (standard deviation)
					UT	MT	LT	Average
1	6/85 eye drop/Challenge	20	4^a (3–4)	3.0^a (0–6.5)	112.0^a (52.1)	79.7^a (21.9)	87.9^ac (29.2)	93.2^ac (31.4)
2	6/85 aerosol/Challenge	20	4^a (3–4)	1.5^b (0–6.5)	96.0^ac (38.6)	81.3^a (41.7)	75.9^a (42.5)	84.37^a (39.0)
3	ts-11 eye drop/Challenge	20	4^b (3–4)	1.0^b (0–5.5)	101.9^ac (62.9)	74.0^a (20.0)	72.5^a (23.9)	82.8^a (32.5)
4	ts-11 aerosol/Challenge	20	3^c (2–4)	6.0^c (1–9.5)	230.0^b (97.3)	186.7^b (113.9)	176.3^b (75.4)	197.6^b (86.3)
5	MB/Challenge	10	3^c (2–4)	5.0^c (4–8.5)	157.5^c (75.2)	137.9^ab (88.2)	144.4^bc (77.7)	146.6^bc (76.6)
6	MB/MB	10	0^d (0–0)	0.0^d (0–0)	73.4^d (17.2)	63.0^c (8.7)	49.3^d (7.5)	61.9^d (8.9)

¹Significantly different figures are represented by different superscript letters.

In the short-term efficacy experiment (Table 1), four groups of 20 birds each were subjected to vaccination with 6/85 using eye drop (group 1) or aerosols (2), or to vaccination with ts-11 using eye drop (3) or aerosols (4). Two additional groups (5 and 6) of ten birds each were subjected to eye drop as well as aerosols of sterile mycoplasma broth only. In the long-term efficacy experiment, two groups of 20 birds each were subjected to vaccination with 6/85 using aerosols (group 1), or to vaccination with ts-11 using eye drop (2). Two additional groups (3 and 4) of ten birds each were subjected to eye drop as well as aerosols of sterile mycoplasma broth only. During the course of this experiment, one bird from each of groups 1 and 3, and two birds from group 4 died or were culled due to causes unrelated to their vaccination regime (including feather pecking or physical trauma) and thus the numbers of birds in Table 3 reflect the total numbers at the end of this experiment.

Eye drop vaccination of either strain was performed as per the ts-11 vaccine manufacturer's instructions. For this purpose, the 6/85 vaccine (2000 doses per vial) was brought to a volume of 60 ml of sterile dH₂O so that each 30 μl represented 1 dose, consistent with ts-11 vaccine. Aerosol vaccination (with aerosols less than 50 µm in diameter) was performed within the isolators using the same nebuliser system also used for aerosol challenge (Whithear et al., 1996). Isolator fans were turned off during, 5 min before, and 5 min after aerosol exposure.

In the short-term protection study, swabs were taken for mycoplasma isolation from the choanal clefts at 4 weeks post vaccination, placed in MB and incubated at 37°C. Broth cultures with colour change were subjected to MG-specific polymerase chain reaction (PCR) (Boyle, 1993) to ascertain the presence/absence of MG. In addition, serum samples were taken for serology by rapid serum agglutination test (RSA). The birds were then exposed to aerosols of MB (groups 5 and 6) or to MG AP3AS challenge culture (groups 1–4) administered as described previously (Whithear et al., 1996) (Table 1).

In the long-term protection study, swabs were taken from the upper trachea at 10, 20, 30 and 36 weeks post vaccination and broth cultures treated for PCR as described for the short-term experiment. Also, serum samples were taken at these time intervals for serology as described above. Thirty-six weeks post vaccination, birds were exposed to aerosols of MB (groups 3 and 4) or to MG AP3AS challenge culture (groups 1 and 2) as previously described (Whithear et al., 1996) (Table 3).

Determination of vaccine protection

In both the short-term and the long-term studies, 2 weeks after challenge, all birds were bled and then euthanized by exposure to CO₂ and their air sacs were examined/scored for lesions at post mortem examination. Air sac lesions were scored grossly for severity as described by Kleven et al. (1972) except that anatomically distinct air sacs (right and left anterior thoracic, posterior thoracic and abdominal) were scored individually on a scale of 0–3 and the individual scores summed to give an overall lesion score for each bird. The maximum score for a bird was thus 18 if all six air sacs were given a score of 3.

The microscopic thickness of the tracheal mucosa was measured in µm at three levels of the trachea (upper, middle and lower) and at four different points (two at vertical and two at horizontal axes).

All bird experiments were approved by the Melbourne University Animal Ethics Committee.

Detection of MG

The identity of positive MB cultures from swabs of choanal clefts were confirmed as MG by PCR using a previously described procedure (Boyle, 1993). Briefly, mycoplasma cells in 0.5 ml of MB cultures with colour change were harvested by centrifugation, washed in phosphate-buffered saline and resuspended in 200 μl of DNAse-free distilled water. The resultant suspensions were heated to 95°C and used as template in subsequent PCR assays. The PCR protocol was adapted from the procedure previously described by Boyle (1993). Briefly, 50-μl reaction mixtures each containing 12 μM each dATP, dCTP, dGTP, and dTTP, 1.5 mM MgCl₂, 0.5 μM primer MG1273f (GTTGCAAATCCGTAAGGTGG), 0.5 μM primer MG1427r (TTAGCAACACGGTTTTAGAT), 0.75 U of Taq DNA polymerase (Promega, Madison, WI), 5 μl of 10 × Taq DNA polymerase buffer, and 10 μl of template were prepared. The reaction mixtures were incubated at 94°C for 2 min and then subjected to 35 cycles of 94°C for 10 s, 60°C for 10 s and 72°C for 10 s. The resultant PCR products were visualized using agarose gel electrophoresis and considered as positive for MG upon observation of DNA bands of 219 base pairs.

Serology

Serum antibody levels to MG were determined by RSA (Intervet, Boxmeer, Holland) and results were scored on a scale of 0–4 as described before (Whithear, 1993).

Statistical analysis

The Mann–Whitney U-test was used to compare median figures for the sum of six air sac lesion and RSA scores and the student t-test was used for comparison of tracheal mucosal thicknesses (Minitab^® 18.1, State College, PA, www.minitab.com). The Fisher’s exact test (https://www.graphpad.com/quickcalcs/CatMenu.cfm) was used to compare the percentage of PCR and RSA positives between groups. P values of ≤ 0.05 were considered as significant.

Results

Short-term protection study

Vaccine and challenge strains viable counts

At the time of vaccination, the titre of the ts-11 vaccine was 9.80 × 10⁸ colour-changing units (CCU)/ml and the titre of the 6/85 vaccine was 1.55 × 10⁹ CCU/ml. Irrespective of the route of administration, birds inoculated by ts-11 vaccine each received a dose of approximately 2.96 × 10⁷ CCU and those inoculated with 6/85 vaccine received a dose of approximately 4.69 × 10⁷ CCU. The AP3AS culture used for aerosol challenge had a titre of approximately 5.70 × 10⁷ CCU/ml.

Colonization of the respiratory tract

At 4 weeks post vaccination/inoculation no mycoplasma could be isolated from the choanal clefts of the unvaccinated birds or those vaccinated with ts-11 by aerosol. However, mycoplasmas were detected by a combination of culture and PCR in 10% of the birds vaccinated with 6/85 by eye drop, 35% of the birds vaccinated with 6/85 by spray and 84% of the birds vaccinated with ts-11 by eye drop.

Serum antibody response following vaccination and challenge

The median RSA score 4 weeks after vaccination with 6/85 by eye drop, 6/85 by aerosol and ts-11 by eye drop were 0.5 (range: 0–4), 0 (0–0.5) and 3 (1–4) respectively. No serum agglutination response was detected in any of the birds vaccinated with ts-11 by aerosol or those exposed to aerosols of MB only (groups 5 and 6).

Two weeks after challenge with the field strain AP3AS (groups 1-5), all birds showed strong serological reactions with median scores of 3 or 4 (Table 1). No serum agglutination response was detected in any of the birds in the unvaccinated-unchallenged group.

Protection against the development of air sac lesions

Results are shown in Table 1. No air sac lesion was found in the unvaccinated-unchallenged birds (group 6). Birds vaccinated with 6/85 vaccine by aerosol (group 2) and birds vaccinated with ts-11 by eye drop (group 3) showed only minor lesions with medians of scores not significantly different (P = 0.96) from each other. Birds vaccinated with 6/85 vaccine using eye drop (group 1) had moderate air sac lesions with median of scores significantly different (P ≤ 0.05) to those of all the other groups. Birds vaccinated with ts-11 by aerosol and unvaccinated-challenged birds showed the most severe air sac lesions with median of scores, which were not significantly different from each other but differed (P < 0.01) from those of all the other groups.

Protection against tracheal changes

The mean and range for mucosal thickness for upper, lower and middle trachea for each group are shown in Table 1. Using mucosal thicknesses from three levels of trachea (upper, middle and lower) an average tracheal thickness was also calculated for each group (Table 1). The average tracheal mucosal thickness of the groups vaccinated with ts-11 and 6/85 by the routes recommended by the manufacturers (eye drop and aerosol, respectively) were not significantly different from each other (P = 0.90) but were both higher than that of the unvaccinated-unchallenged group (P ≤ 0.03) and lower than those of the unvaccinated-challenged group (P ≤ 0.05) and of the group vaccinated with ts-11 by aerosol (P < 0.00).

Long-term protection study

Vaccine and challenge strains viable counts

The titres of the vaccines used in this study were the same as described for the short-term protection study. The AP3AS culture used for aerosol challenge of groups 1, 2 and 3 had a titre of 8.5 × 10⁷CCU/ml.

Colonization of the respiratory tract

Results for the detection (by a combination of culture and PCR) of MG in the upper respiratory system of the birds, at 4, 10, 20, 30 and 36 weeks post vaccination are summarized in Table 2. At 4, 10, 20, 30 and 36 weeks after vaccination, MG was detected in 35%, 50%, 50%, 80% and 42% of the 6/85-vaccinated birds and in 84%, 70%, 20%, 0% and 5% of the ts-11 vaccinated birds respectively. No MG could be isolated from the upper respiratory system of the unvaccinated birds at any timepoint.

Table 2. Median and range of scores for RSA, and percentage of RSA and PCR positives of experimental chicken groups from combined short-term and long-term protection experiments at 4, 10, 20, 30 and 36 weeks after vaccination with MG strains ts-11 by eye drop or 6/85 by aerosol.

		Weeks post vaccination
		4	10	20	30	36
% PCR positives	6/85 aerosol	35	50	50	80	42
	ts-11 eye drop	84	70	20	0	5
	P value	0.003	0.649	0.349	0.000	0.008
Median RSA score (range)	6/85 aerosol	0 (0–0.5)	4 (2–4)	4 (3–4)	3 (3–4)	3 (0.5–4)
	ts-11 eye drop	3 (1–4)	1 (1–4)	1 (0–4)	1 (0–4)	0.3 (0–2)
	P value	0.000	0.002	0.004	0.003	0.000
% RSA positives	6/85 aerosol	26	100	100	100	100
	ts-11 eye drop	100	100	50	70	50
	P value	0.000	1.000	0.033	0.211	0.000

All birds in each group were bled. See Tables 1 and 3 for the number of birds in each group.

Serum antibody response following vaccination

The results of RSA serum antibody responses at 4, 10, 20, 30 and 36 weeks after vaccination with the vaccines 6/85 and ts-11 are presented in Table 2. At 4 weeks after vaccination, relatively poor (median score of 0) MG RSA antibodies were detected in 26% of the 6/85-vaccinated birds while thereafter relatively strong (median scores of 3-4) RSA antibodies were detected in all (100%) of them.

At 4 and 10 weeks after vaccination, relatively strong to moderate (median scores of 3 and 1 respectively) RSA antibodies were detected in 100% of the ts-11 vaccinated birds, while at 20, 30 and 36 weeks post vaccination, moderate to poor (median scores of 1 and 0.3 respectively) RSA antibodies were detected in 50%, 70% and 50% of them respectively. No RSA antibodies could be detected in the unvaccinated birds at any time point.

Two weeks after challenge with AP3AS (groups 1–3, Table 3) birds showed moderate to strong serological reactions with median scores of 1 (ts-11 vaccinated birds) to 3 (6/85 vaccinated birds) respectively.

Table 3. Long-term efficacy experiment: median and range of scores for RSA and air sac lesions, and mean and standard deviation for mucosal thicknesses of upper trachea (UT), middle trachea (MT), lower trachea (LT) and average tracheal thickness of chickens 38 weeks after inoculation with MG strains ts-11 or 6/85, or with MB, and 2 weeks after exposure to aerosols of a virulent MG strain (groups 1–3) or to MB (group 4).

Group	Treatment	Number^1	Median RSA score^2 (range)	Median air sac lesion score^2 (range)	Tracheal mucosal thickness in µm^2 (standard deviation)
					UT	MT	LT	Average
1	6/85 aerosol/Challenge	19	3^a (0.5–4)	2.0^a (0–6.5)	71.6 (21.8)^a	54.0 (14.4)^a	67.1 (11.7)^a	64.3 (12.2)^a
2	ts-11 eye drop/Challenge	20	1^b (0–2)	1.0^a (0–6)	63.8 (20.5)^ac	50.2 (13.3)^ac	70.2 (24.1)^a	61.4 (14.1)^ac
3	MB/Challenge	9	2.5^a (2–3)	5.5^b (1.5–10.5)	306.4 (63.9)^b	344.6 (84.1)^b	279.2 (49.1)^b	310.1 (60.4)^b
4	MB/MB	8	0 ^c (0–0)	0.0^c (0–0)	57.5 (9.2)^c	44.4 (7.7)^c	57.8 (14.8)^a	53.2 (6.3)^c

¹Groups 1, 3 and 4 initially contained 20, 10 and 10 birds each but during the course of this experiment, one bird from each of groups 1 and 3, and two birds from group 4 were culled due to causes unrelated to their treatment (feather pecking and/or physical trauma). Thus the number of birds in each group reflects the total number at the end of this experiment.

²Significantly different figures are represented by different superscript letters.

Protection against the development of air sac lesions

The median and range of the air sac lesion scores for the chicken groups are shown in Table 3. No air sac lesion was found in the unvaccinated-unchallenged birds (group 4). Birds vaccinated with 6/85 vaccine by aerosol and birds vaccinated with ts-11 by eye drop showed minor lesions with medians of scores that were not significantly (P = 0.06) different from each other. Unvaccinated-challenged birds showed the most severe air sac lesions with median of scores that differed (P < 0.01) from those of all the other groups.

Protection against tracheal changes

The mean and calculated standard deviation for mucosal thickness of the tracheas for each group are shown in Table 3. Analysis of the tracheal mucosal thickness at each of the three levels (upper, middle and lower) did not find a significant difference (P ≥ 0.26) between ts-11 and 6/85 vaccinated groups. However, at each level, tracheal mucosal thicknesses from each of these groups were significantly lower (P ≤ 0.00) than that of the unvaccinated-challenged group. Similarly, the average tracheal mucosal thickness of the ts-11 and 6/85 groups did not differ significantly from each other (P = 0.51), but were both significantly lower (P ≤ 0.00) than that of the unvaccinated-challenged group.

Discussion

Results from this study revealed both ts-11 and 6/85 vaccines, when administered by routes recommended by the manufacturers (eye drop and spray respectively), induced a substantial level of protection against airsacculitis and tracheitis caused by wild-type MG challenge at 4 and 36 weeks after vaccination. The air sac lesion scores and tracheal mucosal thicknesses from the birds vaccinated with either of the vaccines by these routes were not significantly different but were all lower than those of the unvaccinated control group after challenge. In contrast, administration of the ts-11 vaccine by an alternative route, fine spray, did not produce a detectable antibody response or a protective immunity at 4 weeks after vaccination. Since ts-11 vaccine is known to mainly colonize the upper respiratory system due to its temperature-sensitive attenuation characteristics (Whithear et al., 1990b), it is likely that administration of the vaccine by eye drop or even possibly coarse spray, rather than fine aerosol, improves its colonization and thus protective immunity. It is noteworthy that, in this study, the exposure of birds to fine aerosols of 6/85 vaccine (group 2) was carried out in a confined isolator space with minimum air circulation (fans switched off). This is in contrast to field conditions where air movement is less controllable. It is possible that conditions used in this study may have favoured the take of the 6/85 vaccine and increased the immune response induced.

It was also found that although immediately following eye drop vaccination, ts-11 colonized the upper respiratory system more efficiently and produced a stronger serological response than strain 6/85, antibody response following ts-11 vaccination reduced gradually over time. These results are in agreement with a previous report (Abd-el-Motelib & Kleven, 1993) where the number of birds with detectable serum agglutinating antibody response decreased from 90% at 45 days to 20% at 105 days following vaccination with ts-11. A previous study on the short-term serological responses to ts-11 (Collett et al., 2005) reported that the proportion and the intensity of RSA reactions increased after vaccination over the trial period and stabilized at 40-60% reactor rate. However, that study did not investigate the pattern of serological response beyond 12 weeks after vaccination. In addition, commercial broiler-type birds (kept in pens) were used in their study which is in contrast to the SPF layer-type birds (in isolators) used in our study. A previous report has highlighted the differences between layer- and broiler-type chickens in immunological responses to antigens and that broilers respond to antigens with a stronger IgM response (Koenen et al., 2002). Given that RSA primarily detects IgM and its propensity to false positive reactions, it may be argued that RSA results presented here may not reflect the dynamics of the IgY response. However, when serum samples from time points 4, 10 and 20 weeks (Table 2) were examined using pMGA ELISA (Noormohammadi et al., 2002a), relatively strong correlation coefficients of 0.70, 0.77 and 0.84 were found between RSA and ELISA titres (results not shown) indicating that the IgY responses were correlated with those of IgM.

The results presented here also indicated that reduction of antibody response after vaccination with ts-11 was associated with reduced detection of ts-11 strain from the upper respiratory system. A previous study (Barbour et al., 2000) has shown that the recovery of ts-11 from birds decreases slightly over time after vaccination although ts-11 was isolated from tracheas of 88% of the birds sampled at 34 weeks post vaccination. This difference in the rate of isolation of ts-11 long after vaccination may be related to the fact that commercial broiler-breeder (meat-type) chickens were used in that study while SPF Leghorn type chickens were used in ours. A difference between immune responses elicited by different breeds of chickens to a single antigen has been demonstrated previously (Koenen et al., 2002). It has been frequently reported that a substantial level of protection is achieved in the absence of strong circulating agglutinating antibodies (Lam & Lin, 1984; Lin & Kleven, 1984; Yoder et al., 1984; Talkington & Kleven, 1985; Whithear et al., 1990a; Ley et al., 1997; Noormohammadi et al., 2002b). However it remains to be investigated how this protection is achieved and maintained also in the absence of detectable colonizing organisms.

In contrast to ts-11, systemic antibody response to 6/85 vaccine was relatively weak immediately after vaccination but increased over time to a maximum level at 30 weeks after vaccination. Increased level of antibodies was associated with increased detection of 6/85 strain from the upper respiratory system. It is not known whether an increase in antibody response and detection in the respiratory system over time following vaccination with 6/85 vaccine is linked to its increased capacity to transmit between birds and/or to colonize more efficiently in the respiratory system.

The results of this experiment reveal that, following vaccination with ts-11 and 6/85 strains, the kinetics of systemic antibody response and persistence of the vaccines in the upper respiratory system vary depending on the administration route and vaccine strain used. Presence of substantial protection against a challenge with a virulent MG strain further emphasizes the lack of correlation between the level of antibody response and susceptibility to infection with a virulent MG strain.

Ideally, results of this experiment need to be confirmed under field conditions although monitoring of a wide array of variables under field conditions is difficult.

Acknowledgements

The authors like to thank Dr Greg Underwood for reading the manuscript, and Dr Jill Disint, Ms Cheryl Colson, Dr Nathan Jeffery and Mr Tony Belfiore for technical assistance.

Disclosure statement

The manufacturers of the ts-11 vaccine provided funding for this independent research and the authors confirm no conflict of interest.

Additional information

Funding

Funding to support this research was provided by Bioproperties Australia Pty Ltd.