Annual Meeting, 2011 / Réunion annuelle, 2011 The Canadian Phytopathological Society

Resistance of soybean cultivars fed with silicon to soybean rust and genetic diversity of Phakopsora pachyrhizi strains. G. ARSENAULT-LABRECQUE, S. HAMBLETON, K. OLIVER, E. WHITFIELD, J. MENZIES, P. DION AND R. R. BÉLANGER. Département de Phytologie, Centre de Recherche en Horticulture, Université Laval, QC G1V 0A6, Canada; (S.H., K.O., E.W.) Biodiversity (Mycology and Botany), Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada (AAFC), 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada; (J.M.) Cereal Research Centre, AAFC, 195 Dafoe Road, Winnipeg, MB R3T 2M9, Canada; and (P.D.) Département de Phytologie, Faculté des sciences de l'agriculture et de l'alimentation, Université Laval, QC G1V 0A6, Canada

Soybean rust caused by Phakopsora pachyrhizi Syd. & Syd. is a major threat to soybean production throughout the world. Its control still represents a challenge as much remains to be understood in the interaction between the plant and the pathogen. In a first approach, we wanted to determine the susceptibility of different soybean cultivars to the rust pathogen and to evaluate if silicon (Si), a reported prophylactic agent against biotrophic fungi, had a repressing effect against the disease. Scanning electron microscopy and X-ray microanalysis mapping were used to determine Si deposition in soybean leaves of plants treated with 0 or 1.7 mM Si and rust severity was assessed daily. The Korean cultivar Hikmok sorip displayed a significantly higher Si concentration in planta than all others when fed with Si. At the same time, plants from this cultivar exhibited a near absence of disease symptoms when supplied with Si. This resistance appeared to be the result of hypersensitive (HR) reactions that were triggered when plants were fed with Si. These results suggest a potential role for Si as part of an integrated approach to control soybean rust. In a second approach, we were interested in characterizing some of the genetic diversity and virulence within P. pachyrhizi strains, and for this purpose, we analyzed 24 different isolates collected from experimental plots and farmers' fields at six different sites in Mozambique and Malawi. For each sample, DNA was extracted and a fragment encompassing the ITS1 and ITS2 regions was PCR-amplified using rust-specific primers. Forty-six different ITS sequences were collectively detected in the various samples. Of these, 16 ITS sequences occurred in at least two samples. The remaining 30 ITS sequences occurred in one sample only, with 15 out of the 24 samples yielding such a unique sequence. This high within-sample diversity calls for the establishment of monosporic cultures, to allow individual characterization with respect to virulence and ITS genotype. Virulence profiles coupled with DNA analyses may reveal a relationship between genetic and phenotypic variation observed within the fungal population.

In vitro antagonistic effects of bacteria on the potato late blight-causing agent Phytophthora infestans . P. AUDY, S. M. BOYETCHKO, C. LE FLOCH-FOUÉRÉ AND K. SAWCHYN. Soils and Crops Research and Development Centre, Agriculture and Agri-Food Canada (AAFC), 2560 Hochelaga Boulevard, Quebec, QC G1V 2J3, Canada; (S.M.B., K.S.) Saskatoon Research Centre, AAFC, 107 Science Place, Saskatoon, SK S7N 0X2, Canada; and (L.-F.) Institut national de la recherche agronomique (INRA), Agrocampus Ouest, UMR1253, F-35000 Rennes, France

Late blight of potato (Solanum tuberosum L.), caused by Phytophthora infestans (Mont.) de Bary, is the world's single most economically important food crop disease with crop losses estimated worldwide at more than $3.0 billion annually. Multiple applications of chemical fungicides are required to control the disease, but the public's demand for environmentally friendly pest control products and preference for pesticide-free foods are driving the need to develop biological control options. Fifty-four bacterial strains, initially selected for in vitro screening against two mating types (A1 and A2) of P. infestans by measuring zones of inhibition, exhibited various degrees of antifungal activity. Incorporation of bacterial supernatant into agar (50%, v/v) was also used to measure the strength of the inhibition and/or suppression of P. infestans by monitoring mycelial growth rate after 7 days. The majority of the bacterial strains exhibited near complete inhibition of mycelial growth of both mating types, despite variable solubility of the secondary metabolites in agar. From these bacteria, in vivo tests were conducted with nine strains by dipping detached potato leaves in a 24 h bacterial culture suspension, followed 24 h later by dipping in a suspension of P. infestans (1000 zoospores/mL) of each mating type, and incubating in the dark for 6 days. Disease progression on the detached leaves was measure 4, 5, and 6 days post-inoculation. Preliminary results indicated that two bacterial strains delayed the progression of disease by the A1 mating type isolate, while five bacterial strains delayed disease progression by the A2 isolate. These bacterial strains appear to be promising for biological control. These results are remarkable considering that the experimental conditions favored the pathogen and disease progression, including optimum environmental conditions for the disease, susceptibility of the potato cultivar, and pathogen inoculum. Further testing is required to determine optimum conditions for maximizing growth and survival of the bacteria for biological control, including formulation.

Differential gene expression responses of Pythium aphanidermatum within plant hosts during root rot disease development. K. BALA, C. A. LÉVESQUE AND B. SAVILLE. Forensic Science Program and Environmental and Life Sciences Graduate Program, DNA Building, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada; and (C.A.L.) Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada

Pythium aphanidermatum (Edson) Fitzp. is a root rot pathogen and a major agricultural threat. It causes heavy losses in greenhouse vegetable and cereal crops worldwide. While pathogenicity and virulence studies have been carried out with this pathogen, no information is available on the P. aphanidermatum transcript level changes during growth within its plant hosts. Tracking the dynamic interplay between this pathogen and hosts at the early stages of infection will provide a substantial gain in understanding Pythium-host interactions. To provide context for deep transcriptome analysis, the timing of the pathogenic development in distinct hosts must be determined. This is being accomplished through the development of novel pathogenesis assay protocols and the use of these to assess the progression of disease development. The three hosts selected were cucumber, wheat and corn. The progression is being followed microscopically, through determining the relative concentrations of nucleic acids from the host and pathogen during infection by monitoring changing transcript levels of housekeeping genes, and by following the levels of selected P. aphanidermatum pathogenesis genes. RNA samples were pooled from the infected plant root tissue exposed to the zoospores of P. aphanidermatum at different time intervals. Quantification of transcript levels was assessed using quantitative reverse transcriptase RT-PCR. The results showed that the root-rot disease progression is consistent with the relative increase in the pathogen biomass to the total root mass. Progress in determining transcript levels of pathogenicity genes and the correlation with pathogen biomass at different times in pathogenesis will be presented. This work sets the stage for a comparative deep transcriptome investigation of P. aphanidermatum disease development on three agronomically important plant hosts.

Trichoderma spp. - antagonistic effects to Phytophthora ramorum growth and spore germination in vitro. E. M. BECKER, N. RAJAKULENDRAN AND S. F. SHAMOUN. Pacific Forestry Centre, Canadian Forest Service, Natural Resources Canada, 506 West Burnside Road, Victoria, BC V8Z 1M5, Canada

The pathogen Phytophthora ramorum Werres, De Cock & Man in't Veld, is responsible for sudden oak death in California and Oregon and sudden larch death in the UK, and causes foliar blight symptoms in many host plant species. In British Columbia, several nurseries have reported P. ramorum-infected plants, and eradication measures have been taken to prevent the spread of the pathogen beyond these points of entry and limit this potential pathway for escape into forested or wild areas. We are investigating the potential use of Trichoderma spp. to limit infection of plants and reduce the spread of P. ramorum. About 50 isolates of Trichoderma of eight species were assayed. Direct contact antagonism of P. ramorum was evaluated using a dual-culture assay in Petri plates, which measured the ability of Trichoderma isolates to overgrow and kill cultures of P. ramorum. In dual culture, the species with the fastest rates of overgrowth were T. atroviride, T. koningii and T. virens (9.0, 7.8, and 6.9 mm/day), which also had the fastest rates of lethal effect on P. ramorum (9.0, 6.1, and 5.5 mm/day). A high rate of overgrowth did not always translate to a lethal effect on P. ramorum. These results suggest that certain species of Trichoderma have the ability to kill P. ramorum after it has established. The effects of Trichoderma metabolites on P. ramorum (antibiosis) were investigated using a microplate assay. Zoospores of P. ramorum were added to media containing cell-free Trichoderma culture extracts, and germination and growth were evaluated over several days. The species that produced the most inhibitory extracts in microplate assays were T. polysporum, T. pseudokonigii, and T. harzianum (99, 73 and 68% inhibition). Trichoderma isolates were also tested for their ability to tolerate chemical controls that are registered for use in Canada by measuring their growth on media containing either fosetyl-Al (Aliette^TM) or metalaxyl (Subdue Maxx^TM). All isolates were inhibited by Aliette, but many isolates were tolerant of Subdue Maxx. This allows for the possibility of combining or alternating promising Trichoderma isolates with Subdue Maxx in an integrated pest management approach.

Multilocus genotyping of a worldwide collection of Phytophthora ramorum , the sudden oak death pathogen. M. -J. BERGERON, G. J. BILODEAU, C. A. LÉVESQUE AND R. C. HAMELIN. Natural Resources Canada, Canadian Forest Service, Laurentian Forestry Centre, 1055 du P.E.P.S., P.O. Box 10380, Stn. Sainte-Foy, Quebec, QC G1V 4C7, Canada; (G.J.B.) Canadian Food Inspection Agency, 3851 Fallowfield Road, Ottawa, ON K2H 8P9, Canada; and (C.A.L.) Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada

Phytophthora ramorum Werres, De Cock & Man in't Veld, the causal agent of sudden oak death and ramorum blight, is responsible for extensive mortality of Quercus spp. and Lithocarpus densiflorus in native forests of the western United States. Phytophthora ramorum has over 100 reported plant hosts that exhibit different symptoms of infection. Three clonal lineages have been reported to date in forests, nurseries and gardens of North America and Europe: the NA1 and NA2 lineages are currently only known in North America, whereas the EU1 lineage, although initially found in Europe, is also found in North America. Here, we examine the genetic variation within 13 nuclear genes from a worldwide collection of 99 P. ramorum isolates in order to better understand the evolutionary history of this introduced pathogen. The complete genome of P. ramorum provided us with a resource of approximately 16000 predicted genes from which polymorphic regions were identified. Eighty-six single nucleotide polymorphisms (SNPs) and five insertion/deletion changes were uncovered over the 6158 base pairs we sequenced. Twenty-one multilocus genotypes (MLGs) were observed within the European population (n = 72) compared with five within the North American population (n = 27), among which two were shared between both populations. As expected, more diversity is observed in Europe. Moreover, phylogenetic relationships among the P. ramorum genetic variants show that the 21 MLGs associated with the European population cluster together and correspond to the EU1 lineage. The five MLGs associated with the North American population split up into three groups, corresponding to the NA1, NA2 and EU1 lineages.

Trichothecenes and other secondary metabolites from Fusarium graminearum – is it just about deoxynivalenol? B. A. BLACKWELL, C. SEGUIN AND D. OVERY. Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada; and (D.O.) Department of Chemistry, University of Prince Edward Island, 550 University Avenue, Charlottetown, PE C1A 4P3, Canada

Fusarium graminearum Schwabe (teleomorph Gibberella zeae (Schw.) Petch) and closely related Fusarium spp. cause fusarium head blight (FHB) in wheat and barley and ear rot in maize. The disease results in reduced yield and quality as well as kernel contamination with the mycotoxin deoxynivalenol (DON). DON has been shown to be phytotoxic, thus acting as a virulence factor in the spread of the disease on the plant as well as potent non-specific inhibitor of eukaryotic protein synthesis. Within the F. graminearum species complex found in North America, there are three chemotypes, those producing 15-acetyl-DON and those producing 3-ADON as precursors to DON, and to a minor extent those producing nivalenol. In the past, the F. graminearum isolates with the 15-ADON chemotype were the primary cause of FHB in western Canadian grain. Fusarium graminearum DAOM 233423 (a 15-ADON chemotype) is a particularly virulent strain that is a good producer of 15-ADON in the laboratory. In addition, it is genetically well characterized and has been the source for gene knockouts in biosynthetic and virulence factor studies. In the course of isolating quantities of 15-ADON from large scale liquid cultures of this strain for use as analytical standards and in toxicological testing, other secondary metabolites were isolated and characterized. The crude fungal extract from a ten liter culture was fractionated by preparative HPLC into the pre-15-ADON (more polar components), 15-ADON itself (the primary metabolite) and the post-15-ADON (less polar components). The pre- and post- were further fractionated into 20 fractions which were combined based on their HPLC/UV profile. These fractions were characterized by UPLC/MS. The more polar metabolite fraction was dominated by a compound that is virtually indistinguishable from DON by HPLC. This compound was determined to be 3-deacetyl- 7,8 dihydroxy-calonectrin, a plausible oxidative precursor to 15-ADON. Other metabolites in this fraction included cyclonerodiol, butenolide and sambucinol. Metabolites identified in the less polar included culmorin, culmorone and sambucoin and 15-acetyl-4,7-dideoxynivalenol was found in the semi-pure 15-ADON fraction. While the role of these metabolites and whether they occur in planta is unknown, both analytical and genetic methods are under development to detect these metabolites in the field.

Evaluation of dry bean lines for resistance to common bacterial blight. J. G. BOERSMA, R. L. CONNER, P. BALASUBRAMANIAN, C. L. GILLARD AND A. HOU. Morden Research Station, Agriculture and Agri-Food Canada (AAFC), Unit 100–101, Route 100, Morden, MB R6M 1Y5, Canada; (P.B.) Lethbridge Research Centre, AAFC, 5403 1st Avenue South, Lethbridge, AB T1J 4B1, Canada; and (C.L.G.) University of Guelph, Ridgetown Campus, 120 Main Street East, Ridgetown, ON N0P 2C0, Canada

Common bacterial blight (CBB) caused by the bacterial pathogen Xanthomonas axonopodis pv. phaseoli Smith is a serious seed-borne disease affecting dry bean (Phaseolus vulgaris L.) production throughout the world. The bacteria attacks all plant aerial parts, first causing water soaked lesions on the plant leaves and later infecting pods and seeds. Infected seeds may exhibit a brown to butter-yellow discoloration or be small and shrivelled, resulting in poor marketability. One way of controlling CBB is to breed resistant varieties. To date this has largely been conducted by screening of field-inoculated plants for those displaying the least symptoms i.e., little or no leaf and pod lesions, since leaf disease and seed infection rates tend to be highly correlated. Seed discoloration is rarely if ever examined when breeding for CBB resistance. In two recent trials conducted at Morden it was found that the level of leaf disease was not always indicative of the level of seed infection. For instance, the cultivar ‘Envoy’ is reputed to be more susceptible to CBB than the cultivar ‘Navigator’ on the basis of incidence and severity of CBB on the leaves. However, our trial results showed that even though ‘Envoy’ had equal or higher levels of leaf disease incidence (70%) than ‘Navigator’ (68%), the percentage of diseased seeds was only half (18%) that of ‘Navigator’ (36%). Similar trends were seen in a backcross population derived from a cross between ‘OAC Rex’ and ‘Morden003’. In this population, leaf disease incidence ranged from 5 – 40%. The minimum number of diseased seed gradually increased over this interval from approximately 3% at 10% leaf disease incidence to 5% at 40% leaf incidence. The maximum number of diseased seed was approximately 13% across most of this range. Two exceptions at 15% and 20% leaf disease incidence had diseased seed numbers exceed 15%. Further investigations are underway.

Effect of nozzle type and orientation on fungicide efficacy against mycosphaerella blight in field pea. R. BOWNESS, B. D. GOSSEN, R. L. CONNER, T. WOLF, K. F. CHANG, C. WILLENBORG AND S. E. STRELKOV. (R.B.) Field Crop Development Centre, Alberta Agriculture and Rural Development (AARD), 6000 C & E Trail, Lacombe, AB T4L 1W1, Canada; (B.D.G., T.W.) Saskatoon Research Centre, Agriculture and Agri-Food Canada (AAFC), 107 Science Place, Saskatoon, SK S7N 0X2, Canada; (R.L.C.) Morden Research Station, AAFC, Unit 100–101, Route 100, Morden, MB R3M 1Y5, Canada; (K.F.C., C.W.) Crop Diversification Centre North, AARD, 17 507 Fort Road N.W., Edmonton, AB T5Y 6H3, Canada; and (R.B., C.W., S.E.S.) Department of Agriculture, Food and Nutritional Science, 410 Agriculture/Forestry Centre, University of Alberta, Edmonton, AB T6G 2P5, Canada

Mycospharella pinodes (Berk. and Blox.) Vestergren causes substantial yield loss in field pea (Pisum sativum L.) across western Canada. Symptoms include necrotic lesions on the leaves, stems and pods. Epidemics are initiated at the base of the plant canopy, but quickly spread up the plants when conditions are cool and wet. The only effective strategy to manage mycosphaerella blight in most areas is the application of foliar fungicide. The effect of spray application options (nozzles producing different spray quality in various arrangements), on severity of mycosphaerella blight were assessed at field trials at Morden, MN in 2008–2010, Saskatoon, SK in 2008 and 2009 and Lacombe, AB in 2009. The nozzles used included fine and coarse spray quality, single and double nozzle arrangements, a reduced application rate and a non treated control. Pyraclostrobin (Headline) fungicide was applied in 250 L/ha of water at early to late flowering depending on the timing of epidemic initiation. Across all years and sites, blight severity was lowest in the double nozzle system with either two fine droplet nozzles or a combination of a fine and coarse nozzle. Similarly, the highest yields were obtained using a double nozzle system, but differences were small and often not significant in individual trials. Blight severity was generally low during the study period, and mean yield was increased by only 4% over the single nozzle system and 13% over the control. It is likely that double nozzle systems improve canopy penetration and droplet retention at all levels in the canopy, but especially at the base of the canopy and on stems, where stem lesions increase lodging and so have a relatively large impact on yield.

Compost for organic control of apple replant disease. G. BRAUN, E. BEVIS AND S. A. E. FILLMORE. Atlantic Food and Horticulture Research Centre, Agriculture and Agri-Food Canada, 32 Main Street, Kentville, NS B4N 1J5, Canada

Apple replant disease (ARD) is a serious soil-borne disease managed by soil fumigation in conventional agriculture, but remains a significant problem in organic production systems. Many studies on composts for ARD control have been published but with inconsistent results. In this study, large volumes of compost were equivalent to fumigation with Telone C17 in alleviating symptoms of ARD in ‘Honeycrisp’ apple trees in two locations. Compost increased trunk cross-sectional area by more than 40%, tree height by up to 20% and branch length by more than 100% in the second year. Hog manure compost (HMC) and municipal waste compost (MWC, household kitchen and garden waste) were equally effective in increasing tree growth in ARD soil. Soil bacterial counts were only slightly reduced by fumigation and remained constant in all treatments over a 16-week period. Fungal population numbers were significantly decreased by fumigation. Bacterial and fungal population numbers were consistently larger in HMC compared to MWC while the fumigated and non-treated control (NTC) soils had the lowest population numbers. Soil respiration was significantly greater in the compost treated soils than the fumigated or NTC. Fumigated soils had the lowest organic matter content, the lowest fungal and bacterial populations, the lowest respiration rates but among the highest tree growth parameters that were equivalent to compost treatments. Nitrogen content was higher in MWC than HMC but leaf nitrogen was highest in the NTC. Phosphorus was double in HMC compared to MWC and phosphorus was greater in leaf samples from HMC treated trees. However, growth responses were equal for HMC and MWC treated trees. Therefore, nutrients or minerals in the compost do not appear to explain the differences in tree growth in response to compost applications. No obvious relationship between soil microbial populations and improved growth response of apple trees in ARD soil could be found. Since the response to compost was not specific to the type of compost, the physical dilution of root pathogens from the tree rhizosphere with large volumes of compost may have played the most significant role in ARD control in this study.

SmkA MAP kinase is involved in the mycoparasitism of the plant fungal pathogen Rhizoctonia solani . R. CHAMOUN AND S. JABAJI. Department of Plant Science, McGill University, 21,111 Lakeshore Road, Ste Anne de Bellevue, QC H9X 3V9, Canada

Mycoparasitism comprises the interaction between two fungi involving an elaborate cross-talk of the host and the pathogen. Several studies on the signalling pathways participating in this interaction revealed high conservation of the mitogen-activated protein kinases (MAP kinases). MAPK phosphorylation cascade transduces a variety of signals in eukaryotes which affects gene expression. Three MAPK pathways exist: Erk1/2, JNK/SAPK, p38/HOG. The latter two modules are activated by abiotic stress such osmotic/oxidative shock. Erk1/2 has been implicated in fungal parasitism as well as in the production of asexual spores. We isolated a MAPK homolog belonging to the YERK1 class, smkA, from the biocontrol fungus Stachybotrys elegans (Pidopl.) Gams a mycoparasite of the plant pathogenic fungus Rhizoctonia solani Kühn. We have cloned the gene and shown via alignment of similar and related fungal MAP kinases, that smkA encode the Erk1/2 MAP kinase. Southern blot analysis confirmed the existence of a single copy gene of smkA. Similar to the mycoparasite Trichoderma virens (Miller et al.) Arx, we believe that SmkA might be involved in activation of transcription factors for genes encoding one or more enzymes responsible for the degradation of the host. To confirm the role of SmkA in mycoparasitism of R. solani and to rule out that it does not respond to abiotic stress, S. elegans was subjected to the following types of stress: 1) biotic stress involving confrontation assays leading to mycoparasitism of R. solani; and 2- abiotic stress involving the application of osmotic (0.8 M NaCl/0.8 KCl) and oxidative (10 mM H₂O₂) stresses for 20, 40 and 60 min). Immunoblot analyses using monoclonal antibodies against the active forms of the target proteins (Erk1/2 and p38) were used. Western blot analyses revealed that SmkA was highly expressed in S. elegans during mycoparasitism, and was not expressed when the mycoparasite was exposed to osmotic/oxidative stress. On the other hand, p38 was highly expressed in S. elegance under oxidative stress. A solid understanding of transduction pathways following perception of signals and the identification of key components of signal transduction pathways is essential in the attempt to recognize the essential key factors that play roles in the mycoparasitism process of R. solani.

Methods of inoculating pea plants with Peronospora viciae f. sp. pisi . K. F. CHANG, J. F. LIU, S. F. HWANG, S. E. STRELKOV, B. D. GOSSEN, D. J. BING AND G. D. TURNBULL. Crop Diversification Centre North, Alberta Agriculture and Rural Development, 17 507 Fort Road N.W., Edmonton, AB T5Y 6H3, Canada; (J.F.L., S.E.S.) Department of Agricultural, Food and Nutritional Science, 410 Agriculture/Forestry Centre, University of Alberta, Edmonton, AB T6G 2P5, Canada; (B.D.G.) Saskatoon Research Centre, Agriculture and Agri-Food Canada (AAFC), 107 Science Place, Saskatoon, SK S7N 0X2, Canada; and (D.J.B.) Lacombe Research Centre, AAFC, Lacombe, 6000 C & E Trail, AB T4L 1W1, Canada

Downy mildew, caused by the obligate parasite Peronospora viciae (Berk.) de Bary f. sp. pisi, causes substantial losses in field pea (Pisum sativum L.) crops when environmental conditions are conducive to its development. The distribution of downy mildew from field to field and year to year in central Alberta is highly variable, and reliable assessments of pea resistance are often necessary, in which plants must be inoculated to ensure uniform levels of exposure to the pathogen. Inoculum must consist of viable spores or mycelium of P. viciae. Three inoculation methods were compared for their ability to consistently induce symptoms of downy mildew in growth chamber trials with 24 pea cultivars: 1) Seedlings at the 4-leaf stage were inoculated by inserting a 2x3 mm² piece of diseased leaf tissue between the bud-leaves of the top shoot; 2) Systemically infected plant tissues were ground to a powder, suspended in distilled water, and then poured (2 mL volume at 2x10⁴ oospores/mL) over each pea seed before planting; and 3) The 2 mL inoculum suspension in 2) was also added to the top soil as a drench after seeding. The plants were rated for disease severity (DS) 2 and 4 weeks after inoculation using a 0–4 rating sale. The mean DS was 0.07, 0.43 and 0.69 on a five-point scale using methods 1, 2 and 3, respectively. Therefore, the 3^rd soil drench method appears to be the most reliable for assessing pea resistance to downy mildew.

Effect of Upe expression on Ustilago maydis pathogenic development. H. Y. K. CHEUNG AND B. J. SAVILLE. (H.Y.K.C., B.J.S.) Environmental & Life Sciences Graduate Program, Trent University, DNA Building, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada; and (B.J.S.) Forensic Science Program, DNA Building, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada

Ustilago maydis D.C. Corda is the causal agent of common smut of corn. Since this biotrophic fungus requires in planta growth to become meiotically competent, we hypothesize that U. maydis meiosis is triggered by signals received from the host plant. Annotation of the U. maydis genome identified Um01961 as an ortholog of the transcription regulator Ume6, and it was hypothesized that it plays a role in U. maydis meiosis. However, deletion of Um01961 had no discernable effect on completion of meiosis, or haploid cell growth. The ability of haploid Um01961 deletion strains to mate was also indistinguishable from that of wild type haploids as determined by a plate mating assay. In contrast, infection with the deletion strains displayed an altered pathogenesis profile relative to wild type, suggesting a role for this gene in pathogenic development. As a result, Um01961 was named Upe for unregulated pathogenesis gene expression. We now hypothesize that Upe is either a repressor of pathogenesis genes or an activator of genes that suppress the host plant response. The solopathogenic U. maydis strain SG200 was altered to increase the level of transcription of Upe above that normally found in these cells. These altered SG200 strains were found to be deficient in filamentous growth and had altered pathogenesis profiles, supporting the hypothesis that Upe is involved in pathogenic development. The creation of compatible haploid cell lines with elevated Upe transcript levels showed an alteration in mating efficiency and the influence on pathogenesis was presented. Progress on determining variation in gene expression of the Upe mutant strains was also discussed.

Projected effects of climate change on plant disease and how plant pathologists can prepare to meet the challenge. S. M. COAKLEY. Botany and Plant Pathology, College of Agricultural Sciences, Oregon State University, Corvallis, OR 97331, USA

Global climate change may seriously limit our ability to provide adequate food and fiber production for the rapidly growing world population. In addition to the evidence of an increased severity of soil borne pathogens, there are numerous observations of changing patterns of plant disease in managed and native plant systems. A recent volume of Plant Pathology (2011) 60, provides a comprehensive overview of the many facets of climate change and its potential impact on plant diseases. This volume contains twelve papers that are a valuable resource for identifying the current status of the field; these papers and the hundreds referenced within them, provide a unique opportunity to evaluate progress to date, identify gaps in our current understanding, and identify research that might help manage disease under the unpredictable nature of global warming and associated changes in precipitation. Plant disease epidemics develop as a convergence of abundant susceptible hosts, pathogens, any vectors required, and a sustained favorable environment. The best way for plant pathologists to meet the challenge of a changing, and predominately warming climate, is to ensure that we have a sufficient number of broadly based scientists prepared to respond both in diagnosing the pathogens and utilizing all available tools to manage them. There are numerous economic factors which will affect what crops are grown, the balance of annual versus perennial, and the management strategies available. For example, more frequent application of fungicides can result in fungicide resistant pathogens and a more durable alternative may be multi-gene resistance. Because pathogens can evolve more rapidly than their hosts, they hold an advantage under favorable conditions when there is an abundance of susceptible hosts. One expects that in the long term, some diseases will increase and that others will decrease but the speed of climate change and the expected increase in local climate variability may result in significant and difficult to manage losses in some crops before adjustments can be made. This presentation will provide an overview of changes observed and what management options may be available.

Host-parasite interactions in the response of sclerotia of Sclerotinia sclerotiorum to freezing and parasitism by Coniothyrium minitans . J. E. COWAN AND G. J. BOLAND. School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada

Sclerotinia sclerotiorum (Lib.) de Bary is a worldwide pathogen of several economically important crops. The small, black sclerotia produced by the fungus enable it to survive adverse environmental conditions, such as Canadian winters. The effects of freezing on sclerotia of S. sclerotiorum are not well documented and previous literature conflicts with the high incidence of Sclerotinia diseases in Canada. Our research examined the effects of freezing (−12 °C and a 10 °C control) on cell damage and carpogenic germination (CG) of sclerotia from two isolates of S. sclerotiorum, and how those effects interacted with the mycoparasite Coniothyrium minitans Campbell (Contans® WG) in organic soils (Experiment 1). Additionally, sclerotia of nine isolates were cut in half, placed cut-side up in 1% water agar in a controlled environment (22 °C with 200 μmol m⁻² s⁻¹ lighting), and evaluated for their rate of re-melanization and susceptibility to C. minitans (3 × 10² conidia cm⁻²) before (day 0) and after (day 6) the cut surface re-melanized (Experiment 2). Using a ninhydrin test in Experiment 1, there was an isolate effect (P = 0.05) of freezing on damage to sclerotia, with 7% and 0% cell damage occurring in isolates 274 and ZQ35-10, respectively. Regardless, freezing did not reduce CG of either isolate relative to their unfrozen controls. However, freezing damage in isolate 274 increased its subsequent susceptibility to parasitism by C. minitans, with CG of the freeze-damaged sclerotia reduced by up to 99% vs. 62% for the unfrozen sclerotia. In contrast, CG of isolate ZQ35-10 was not reduced by C. minitans, suggesting resistance to the mycoparasite. In Experiment 2, cut sclerotia of all isolates succumbed rapidly to C. minitans; however, both an overall decreased susceptibility and an isolate-specific susceptibility to C. minitans became prominent after sclerotia re-melanized. These results suggest that increased susceptibility resulting from freezing or wounding cell damage may be temporary and associated with the melanization characteristics of individual isolates. It appears that only biotic antagonism of sclerotia immediately following seasonal freezing would be capable of exploiting freezing damage in sclerotia, and this effect may be limited to a subset of isolates of S. sclerotiorum within a field.

Effect of host resistance on infection by Plasmodiophora brassicae in canola. A. DEORA, B. D. GOSSEN AND M. R. MCDONALD. (A.D.) Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada; and (A.D., M.R.M.) Department of Plant Agriculture, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada

Several commercial cultivars of canola (Brassica napus L.) with resistance to clubroot caused by Plasmodiophora brassicae Woronin have been developed recently, but how and when this resistance is expressed is not known. Assessments of root hair infection (RHI) (% roots infected) and cortical infection (CI) (% cortical area infected) were made over time in four commercial cultivars that differed in reaction to two pathotypes (P3 and P6) of P. brassicae: ‘45H29’ (resistant), ‘46A76’ (susceptible), ‘Invigor 5030’ (intermediate) and ‘45H21’ (susceptible to P3, resistant to P6). The trial was arranged in a factorial RCBD with four replications and three plants per experimental unit. The plants were grown individually in sand at 25/20 °C (day/night) and inoculated with 10⁶ resting spores/ml 7 days after seeding. Samples were taken at 4, 8 and 12 days after inoculation (DAI) for RHI assessment and 16, 22 and 28 DAI for CI assessment. RHI occurred quickly in susceptible cultivar × pathotype combinations and slowly in resistant combinations. However, the maximum RHI was similar across reaction types. For example, RHI at 12 DAI in ‘45H29’ (resistant) and ‘46A76’ (susceptible) was about 70% for both pathotypes. At 28 DAI, there was no CI in ‘45H29’ for both pathotypes, CI was high in ‘46A76’ for P3 (45%) and P6 (35%), and moderate for P3 (23%) and P6 (16%) in ‘Invigor 5030’. There was no CI in ‘45H21’inoculated with P6, but CI was high (35%) in this cultivar inoculated with P3. The extent of cortical infection by P3 was consistently higher than by P6. Results of this trial indicated that resistance affected both RHI and CI, but that the differences in CI were larger and more distinct than for RHI. The observation that the pattern of response in CI was substantially different in ‘Invigor 5030’ (intermediate) than the other cultivars indicates that there may be differences in the mechanism(s) of resistance among various sources of genetic resistance.

Suppression of Fusarium oxysporum f. sp. radicis lycopersici and Pythium ultimum by fish effluent. D. DEY, V. GRAVEL, G. W. VANDENBERG AND M. DORAIS. Horticultural Research Centre, Pavilion Envirotron, Laval University, Quebec, QC G1V 0A6, Canada; and (G.W.V.) Department of Animal Science, Laval University, Quebec, QC G1V 0A6, Canada

Tomato production is the number one vegetable greenhouse crop in Canada. Fusarium oxysporum Schlecht. emend. Snyder and Hans. and Pythium ultimum Trow are two pathogens that seriously threaten greenhouse tomato production. Numerous studies reported that fish effluent represents an opportunity to provide nutrients for greenhouse tomato. However, little is known about the disease suppressiveness ability of fish effluents for horticultural crops. The objective of this study was to evaluate the effectiveness of fish effluent to reduce disease susceptibility of tomato plant to F. oxysporum and P. ultimum. An in vitro assay was conducted in order to determine the effect of fish effluent on mycelial growth of P. ultimum and F. oxysporum. Fish effluent or water was incorporated into PDA media (1 to 25%). In addition, sterilized fish effluent effect on mycelial growth was evaluated by incorporating autoclaved or microfiltered fish effluent into PDA. A second experiment was conducted with tomato seedlings grown in peat mix under greenhouse conditions and irrigated with conventional nutrient solution (6–11–31; 15.5–0–0). A split-plot experimental design with five replicates was used. Twice a week, treated plants received 50 mL of fish effluent at concentrations of 1.0, 0.5 and 0.25. After 1 and 4 weeks of growth, half of plants inoculated with 100 mL of a suspension of P. ultimum (1 × 10⁶ propagules/mL). The chlorophyll a fluorescence was measured every week. Growth parameters and root colonization by P. ultimum were evaluated two weeks after the last inoculation. In vitro assay revealed that there was no significant difference between 5 to 25% of fish effluent and showed 100% inhibition of mycelia growth of P. ultimum. In the case of F. oxysporum, 32% growth was suppressed using 25% of fish effluent on PDA medium. Significant difference (P < 0.05) was observed at the 25% with other percentages of fish effluent (5 to 20%). Interestingly, inhibition effect was not observed when fish effluent was sterilized by autoclaving or by microfiltration. These results suggest that the microbial antagonists in the fish effluents have direct inhibition of mycelial growth. Bioassay is underway and results will be discussed in terms of disease supressiveness against these two plant pathogens.

Impact of global climate change on plant diseases and world food production. G. R. DIXON. Centre for Horticulture, University of Reading and GreenGene International, Hill Rising, Horsecastles Lane, Sherborne, Dorset, DT9 6BH United Kingdom

Worldwide climates are changing at rates not previously experienced in geological time, this is having substantial effects on the natural world and crop production. This presentation charts the evidence for climate change, impacts on crop growth and yields, affects on plant diseases and resultant changes in food supplies worldwide. Irrespective of the causes of climate change, it is crucial that scientists develop understandings of its implications and impacts on natural biodiversity, artificial landscapes and production agriculture. Currently, worldwide 20 to 25% of harvested crops are lost due to diseases. Climate change appears to be characterised by increased variability in temperature, rainfall and wind velocity. As the world's environments alter so the activities and vigour of aerial and edaphic microbes appears to change, some are becoming considerably more active and damaging. Pathogen vigour and dispersal appear to be changing. There are pressing needs for an understanding of how plant pathogenic microbes respond to climatic changes and how the scale of losses caused by soil-borne and air-borne microbes is set to increase. These effects will be examined using examples drawn from crops and diseases of worldwide significance indicating how lost production will damage international food and commodity supplies. Reductions in food and commodity supplies comes at a time when the world's population is increasing, its demands on all natural resources are outstripping supplies and biodiversity in Nature is being damaged frequently beyond repair. Plant pathologists in their attempts at combating escalating losses caused by plant diseases will need to take into account the economic, medical, social and political issues which will be central for survival and the continuing quality of life as the 21^st century progresses. In the past visionary plant pathologists have contributed hugely in solving humanity's problems. Our profession's capacity for working with “one foot in the furrow (and) one hand on the bench” has increasing relevance.

A new class of gene expression control molecules in Ustilago maydis . M. E. DONALDSON, S. C. LAMBIE AND B. J. SAVILLE. (M.E.D., B.J.S.) Environmental & Life Sciences Graduate Program, DNA Building, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada; (S.C.L.) Department of Biology, Life & Health Science Building, Block D, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada; and (B.J.S.) Forensic Science Program, DNA Building, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada

Ustilago maydis D.C. corda is the model basidiomycete for investigating biotrophic plant pathogens. cDNA libraries from different cell-types and nutritional conditions were created to facilitate annotation of the U. maydis genome. Natural antisense transcripts (NATs) complementary to U. maydis open reading frames were identified and classified during analysis of the resulting expressed sequence tag (EST) libraries. NATs have been discovered in a broad range of plants, animals, and fungi; although studies have only identified a handful of functions for specific antisense transcripts. The RNA interference (RNAi) pathway is a broadly conserved mechanism whereby short antisense transcripts mediate the degradation of complementary sense mRNAs. Phylogenetic and functional analyses have revealed that select yeast species and U. maydis do not contain functional RNAi machinery. The lack of an RNAi pathway allows the study of NAT function without the complication of interacting with the RNAi machinery. Using strand-specific RT-PCR, it was determined that some NATs are expressed in a cell-type specific manner in U. maydis, notably in the dormant teliospore. Teliospore specific NATs were conserved between U. maydis and U .hordei (which unlike U. maydis, contains functional RNAi-machinery), supporting a functional role for antisense transcripts in these two species. U. maydis teliospore specific NATs were characterized using RNA ligase mediated rapid amplification of cDNA ends (RLM-RACE). Haploid cells normally lacking these specific NATs were transformed to artificially express select antisense transcripts. These transformants were used to determine how sense-antisense pairs interact. Quantitative-PCR revealed increased levels of sense transcripts in the antisense over-expression mutants, suggesting that specific U. maydis antisense transcripts have the ability to stabilize complementary sense mRNA. Furthermore, double stranded (ds) RNA was detected by S1 nuclease protection assays, suggesting that dsRNA formation facilitates this stabilization. These experiments indicate that the presence of antisense transcripts in the dormant teliospore may be linked to stabilizing mRNA during teliospore dormancy.

Detection of mutagenic secondary metabolites produced by entomopathogen fungus, Metarhizium robertsii . D. ERRAMPALLI, M. C. GIENOW, T. MUGADZA AND T. LAENGLE. Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada (AAFC), Vineland Research Farm, 4902 Victoria Avenue North, P.O. Box 6000, ON L0R 2E0, Canada; and (T.L.) Pesticide Risk Reduction Program, Atlantic Cool Climate Crop Research Centre, AAFC, 308 Brookfield Road, P.O. Box 39088, St. John's, NL A1E 5Y7, Canada

The fungal entomopathogens, Metarhizium anisopliae (Metch.) Sorokin and M. robertsii Bisch, Rehner & Humber cause fatal mycosis to agricultural arthropod pests. The objective of this study is to determine if any of the secondary metabolites are produced by two isolates of insect pathogenic fungi, M. robertsii ARSEF 2575 and M. anisopliae BIPESCO 5 were mutagenic. Liquid culture broth was inoculated at a concentration of 2.5 × 10⁵ spores/ml of M. robertsii ARSEF 2575 and M. anisopliae BIPESCO 5 and incubated at 160 rpm at 25C for 8 days. The secondary metabolites produced in liquid culture media by these insect pathogenic fungi were extracted with dichloromethane and ethyl acetate solvents, and concentrated by rotoevaporation. Resulting oily brown residue was dissolved in dimethyl sulphoxide (DMSO) and tested using TA98 and TA100 isolates of Salmonella typhimurium in the Ames MPF Penta I microplate format mutagenicity assay. The S. typhimurium TA98 detects 2-nitrofluorene (2-NF) while S. typhimurium TA100 detects 4-nitroquinoline N-oxide (4-NQO) without S9 (Aroclor-induced rat liver enzymes). Both TA98 and TA100 detect 2-aminoanthracene (2-AA) when tested in the presence of S9 (Aroclor-induced rat liver enzymes) which causes metabolic activation of the mutagenic compounds. The results from the Ames MPF Penta I assay showed that the positive control M. robertsii ARSEF 2575 produced two mutagenic metabolites, while M. anisopliae BIPESCO 5 tested negative for mutagenic metabolites. The negative control DMSO tested negative. The M. robertsii ARSEF 2575 and M. anisopliae BIPESCO 5 tested negative for mutagenic metabolites with S. typhimurium TA98 in the absence of S9. The negative result for the metabolite using the S. typhimurium TA98 tester strain indicates that the mutagens that can be detected by S. typhimurium TA98 was not produced by both Metarhizium species. All the experiments were repeated four times. The detection of mutagenic metabolites produced by the positive control, M. robertsii ARSEF 2575, with the Ames MPFTM Penta I microplate format mutagenicity assay (Xenometrix) suggests that the mutagenic metabolites were produced only by M. robertsii ARSEF 2575 but not by M. anisopliae BIPESCO 5.

Effect of methyl jasmonate for suppression of postharvest Botrytis in different grape cultivars. D. ERRAMPALLI, M. A. MACDONALD, A. SHARON AND P. H. GOODWIN. Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada (AAFC), Vineland Research Farm, 4902 Victoria Avenue North, P.O. Box 6000, ON L0R 2E0, Canada; (A.S.) Department of Molecular Biology and ecology of Plants, Tel Aviv University, Tel Aviv 69978; and (P.H.G.) School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, Ontario, Canada N1G 2W1, Canada

Botrytis bunch rot, caused by the fungus Botrytis cinerea Pers.: Fr., is a common problem wherever grapes (Vitis vinefera L.) are grown. The disease can cause serious losses in both yield and quality. Methyl jasmonate (MeJA) occurs naturally in plant tissues and has a signalling role in eliciting induced systemic resistance against disease. The present study investigates the effect of exogenous MeJA, on suppression of postharvest Botrytis bunch rot in four, ‘Flame’, ‘Niagara’, ‘Sugar One’, and ‘Thompson’ cultivars of grapes. A strain of B. cinerea collected from Israel (BC-I) was used in all the experiments. The surface sterilized grape bunches (15 grapes/bunch) were spray-treated with 1mM of MeJA, air dried for 3 hours and kept in the growth chamber at 12C. Four days after the MeJA treatment, each of the grape berry in the bunch was wounded with a needle and inoculated with 1 × 10⁴ spores of B. cinerea (BC-I) and incubated in the dark at 12 C and 85% RH. Control treatment did not receive MeJA. There were three replicate bunches per treatment. Experiments were repeated at least once for each of the cultivars. The lesion diameter was recorded at 7, 14 and 21 days after inoculation. MeJA significantly suppressed the disease caused by Botrytis in three green grape cultivars, ‘Niagara’ ‘Sugar One’, and ‘Thompson’, and in the red grape cultivar, ‘Flame’. Within the green grape cultivars, significant disease suppression was observed for up to 14 days in ‘Sugar One’ and ‘Thompson’ and for up to 7 days in ‘Niagara’ grapes. There was no significant disease suppression in any of the grape cultivars after 21 days of treatment. In conclusion, 1mM concentration of MeJA treatments have been shown to suppress disease caused by B. cinerea (BC-I). Pretreatment with MeJA could be an alternative to traditional fungicides in the management of post-harvest diseases of grapes.

Enhanced gene replacement frequency in KU70 disruption strain of Stagonospora nodorum . J. FENG, W. LI, S. F. HWANG, B. D. GOSSEN AND S. E. STRELKOV. Crop Diversification Centre North, Alberta Agriculture and Rural Development, 17 507 Fort Road N.W., Edmonton, AB T5Y 6H3, Canada; (W.L.) Yunnan Academy of Agricultural Sciences, Kunming, Yunnan, P. R. 650223, China; (B.D.G.) Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada; and (S.E.S.) Department of Agricultural, Food and Nutritional Science, 410 Agriculture/Forestry Centre, University of Alberta, Edmonton, AB T6G 2P5, Canada

To improve the efficiency of gene disruption in Stagonospora nodorum (Berk.) E. Castell. & Germano, the putative KU70 gene encoding the Ku70 protein involved in the nonhomologous end-joining double DNA break repair pathway was identified and deleted. The KU70 disruption strain showed no apparent defect in vegetative growth, conidiation and pathogenicity on wheat and barley compared with the wild-type strain. The effect of the absence of KU70 on gene replacement frequency was tested by disruption of TOXA encoding toxin A and LIP2 encoding a putative lipase. Frequency of gene replacement for both genes was dramatically increased in the KU70 disruption strain, compared with the low frequency in the wild-type recipient.

Infection of canola by secondary zoospores of Plasmodiophora brassicae produced on ryegrass. J. FENG, Q. XIAO, S. F. HWANG, S. E. STRELKOV AND B. D. GOSSEN. Crop Diversification Centre North, 17 507 Fort Road N.W., Alberta Agriculture and Rural Development, Edmonton, AB T5Y 6H3, Canada; (Q.X., S.E.S.) Department of Agricultural, Food and Nutritional Science, 410 Agriculture/Forestry Centre, University of Alberta, Edmonton, AB T6G 2P5, Canada; and (B.D.G.) Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada

Clubroot caused by Plasmodiophora brassicae Woronin has a two-stage infection process. In the initial phase, root hairs are infected by primary zoospores from resting spores in the soil. In the second phase, secondary zoospores released from the root hairs fuse and then infect the root cortex. Although the initial phase occurs in many plant species, the second phase only continues to completion (pathogen development and symptoms) in susceptible hosts. As part of a larger study of clubroot pathogenesis, secondary zoospores collected from infected root hairs of canola (a susceptible host) and ryegrass (a nonhost) were inoculated onto healthy roots of both plant species. The treatments consisted of all possible combinations of the two plant species and the two sources of resting spores used as inoculum. At 5 days after inoculation, levels of both root hair infection and secondary plasmodia in the root cortex were similar on plant roots in all of the treatments. At 5 weeks after inoculation, typical large galls developed on canola inoculated with secondary zoospores derived from canola and no galls developed on ryegrass, regardless of inoculum source. However, tiny galls developed on canola inoculated with zoospores from ryegrass. These results indicate that there are distinct components in pathogen pathogenicity and plant resistance that correspond to the stages of the pathogen life cycle.

Characterization and functional analysis of an exo-β-1,3-glucanase from Pyrenophora tritici-repentis. H. T. FU, R. ABOUKHADDOUR, T. CAO AND S. E. STRELKOV. Department of Agricultural, Food and Nutritional Science, 410 Agriculture/Forestry Centre, University of Alberta, Edmonton, AB T6G 2P5, Canada

Tan spot, caused by the fungus Pyrenophora tritici-repentis (Died.) Drechsler, is an important foliar disease of wheat worldwide. In a previous study, analysis by 2-dimensional gel electrophoresis revealed that the enzyme exo-β-1,3-glucanase was five times more abundant in the secretome of a pathogenic race 5 isolate of the fungus versus that of a non-pathogenic race 4 isolate. To learn more about the relationship of exo-β-1,3-glucanase and the virulence of P. tritici-repentis, the glu gene coding for the enzyme was characterized and silenced via a sense and antisense mediated silencing mechanism. Quantitative-PCR analysis revealed a depressed level of glu gene transcript in the silenced strains. One glu gene transformant (C1) showed significantly reduced growth and sporulation relative to the wild-type. Microscopic analysis revealed that the transformant C1 produced significantly lower numbers of germ tubes and appressoria than the wild-type isolate on susceptible wheat leaves. The same transformant also caused significantly less disease symptoms relative to the wild-type after inoculation onto a susceptible wheat genotype. These results suggest that exo-1,3-β-glucanase encoded by the glu gene may contribute to the development and virulence of P. tritici-repentis.

Identification of a stem rust resistance gene in wheat line Tr129 with an introgression from Aegilops triuncialis genome. H. GHAZVINI, C. HIEBERT, T. ZEGEYE AND T. FETCH JR. Cereal Research Centre, Agriculture and Agri-Food Canada, 195 Dafoe Road, Winnipeg, MB R3T 2M9, Canada

Stem rust, caused by the fungus Puccinia graminis Pers. f. sp. tritici Eriks. & Henn., is a devastating disease of wheat worldwide. The last stem rust epidemic in North America's wheat fields occurred in the early 1950s, when race 15B became prevalent for the first time in North America. Since then, deployment of effective stem rust resistance (Sr) genes in wheat breeding programs has controlled stem rust damage in North America as well as other parts of the world. Stem rust on wheat caused by race Ug99 (TTKSK) is currently spreading across Africa and into the Middle East. This race has virulence to most Sr genes that have been employed for decades in wheat breeding programs across the world, as well as most of Canadian spring wheat cultivars. A preliminary study indicated that line Tr129, which contains an Aegilops triuncialis introgression, is resistant to race Ug99. F₂ progeny lines from a cross (RL6071/Tr129) were inoculated with a local P. graminis race (MCCFR) to characterize inheritance of resistance in the line Tr129. Results showed that segregation of the F₂ population fitted both a single dominant gene ratio (p = 0.222) and a two gene (one dominant and one recessive) ratio (p = 0.237). F₂ lines are being increased to the F₃ generation and will be inoculated with races MCCFR and TTKSK (Ug99) to clarify number of genes in line Tr129 and to confirm if gene(s) provide resistance against both strains. Molecular studies are in progress to determine the chromosomal location of these resistance gene(s). Preliminary evaluation of the parents showed that 19 wheat SSR markers, located in different chromosomes, had null alleles in Tr129 which are often indicative of alien segments. Markers will be used to locate and map the stem rust resistance transferred from Ae. triuncialis.

Ratio of 3-ADON and 15-ADON isolates of Fusarium graminearum recovered from wheat plants inoculated and incubated at various temperatures. J. GILBERT, R. CLEAR, S. PATRICK, K. SLUSARENKO AND C. WOLFE. Cereal Research Centre, Agriculture and Agri-Food Canada, 195 Dafoe Road, Winnipeg, MB R3T 2M9, Canada; and (R.C., S.P.) Grain Research laboratory, Canadian Grain Commission, 1404-303 Main Street, Winnipeg, MB R3C 3G8, Canada

Fusarium head blight (FHB) of wheat, caused principally by Fusarium graminearum sensu stricto in North America, can reduce crop value due to accumulation of mycotoxins in the grain. The fungus produces predominantly deoxynivalenol (DON) and its acetylated forms 3-ADON or 15-ADON. Recent analyses of F. graminearum Schwabe isolates collected between 1998 and 2004 identified higher numbers having the 3-ADON chemotype, whereas prior to 1998 the 15-ADON chemotype was considered the only significant cause of FHB in North America. To monitor the ratio of 3-ADON to 15-ADON chemotypes, strains of F. graminearum were isolated from harvested samples of six check varieties in FHB disease nurseries in 2008 and 2009. In 2008, the ratio of 3-ADON to 15-ADON was 79:21%. However, the following year the ratio changed dramatically to 55:45%. The 2009 summer was characterized by lower temperatures with mean daytime highs of 22.4 °C compared to 25.5 °C in 2008. To determine the effects of temperature on recovery of 3-ADON and 15-ADON chemotypes, plants of the six check varieties were grown under controlled conditions. After heading, plants were maintained at 20, 24 or 28 °C. At anthesis, plants were inoculated with a 1:1 ratio of F. graminearum isolates of 3- and 15-ADON chemotype. At maturity, 100 kernels were plated on potato dextrose agar and as Fusarium developed, up to 40 isolates were taken for which monospore cultures were established. DNA was extracted from these cultures and isolates identified to chemotype using PCR. At 20 °C the ratio of 3-ADON to 15-ADON isolates was 30:70%; at 24 °C this was 53:47%, while at 28 °C the pattern was reversed to 69:31%. These preliminary data indicate that in Manitoba, 15-ADON isolates may be favoured in cooler seasons and 3-ADON chemotypes in warmer ones.

Fusarium avenaceum - a causal agent of fusarium head blight in western Canada - its population structure and propensity to form moniliformin. T. GRÄFENHAN, S. A. TITTLEMIER, S. K. PATRICK, M. M. ROSCOE AND R. M. CLEAR. Grain Research Laboratory, Canadian Grain Commission, 1404-303 Main Street, Winnipeg, MB R3C 3G8, Canada

In western Canada, fusarium head blight (FHB) on wheat is caused mainly by three species of Fusarium, namely F. graminearum Schwabe, F. culmorum Sacc., and F. avenaceum (Fr.) Sacc. Out of these three species, F. avenaceum is often considered the least important. In some areas, Fusarium damaged kernels (FDK) from durum wheat are commonly infected by F. avenaceum, which is known to be incapable of producing Fusarium trichothecenes such as deoxynivalenol (DON) or T-2/HT-2 toxins. The spectrum of secondary metabolites formed by F. avenaceum, however, encompasses several “emerging” mycotoxins, e.g. moniliformin and enniatins. Fusarium acuminatum, a closely related species, shares a similar morphology and toxin profile. This species is just as widely distributed but less commonly detected. In this study, the distribution frequencies of F. avenaceum on FDK for durum wheat were determined using traditional agar plating techniques. In 2010/11, ca. 500 producer samples of wheat were tested for their causal agents of FDK. Numerous pure cultures of F. avenaceum and F. acuminatum were isolated from incubated seeds based on macro- and micro-morphological criteria. Of these, a selection of strains was used to study the population structure of the species by employing DNA cycle sequencing of two genetic markers, namely the translation elongation factor 1 alpha (tef1) and the ATP citrate lyase I (acl1). Phylogenetic analyses of the DNA alignment revealed rather simple population structures for F. avenaceum and F. acuminatum in western Canada. Concomitantly, wheat samples were analyzed for moniliformin (MON) and its frequency of detection was mapped onto crop districts. The relationships between the presence of FDK in durum and MON concentrations were also examined.

An innovative, high throughput screening technology for identification and optimization of effective anti-biofilm fungicides. M. W. HARDING, R. J. HOWARD, N. D. ALLAN AND M. E. OLSON. Innovotech, Inc., 301 Horticultural Station Road East, Brooks, AB T1R 1E6, Canada; (R.J.H.) Crop Diversification Centre South, Alberta Agriculture and Rural Development, 301 Horticultural Station Road East, Brooks, AB T1R 1E6, Canada; and (N.D.A., M.E.O.) Innovotech, Inc. Suite 101-2011 94 Street, Edmonton, AB T6N 1H1, Canada

A fundamental challenge in the development of crop protection fungicides is the gap between in vitro laboratory efficacy results compared with performance in field tests. For example, a compound may prove to be highly effective at low doses in laboratory tests, but fail to provide significant disease control when applied as an in-crop fungicide. Why do compounds demonstrate in vitro antimicrobial activity, but then fail to provide disease control when taken to clinical or field tests? In some cases, this phenomenon can be linked to differences in pathogen biology between microbial cells in laboratory cultures and those found in natural settings. In natural (and agricultural) environments, microorganisms grow as biofilms – layered communities of cells encased in a slimy extracellular matrix. However, most laboratory testing is done using cultures of solitary, free-floating cells in nutrient rich broths or semi-solid agar gels. It is well documented that cells within biofilms commonly display heightened tolerance to antimicrobial treatments compared to those of planktonic cells, and are commonly linked to failures in clinical settings. Traditionally, in vitro culturing of biofilms has been cumbersome and tedious, especially for replicated experiments. Recently, the development of multi-well plate technologies for high throughput biofilm culturing and testing have provided methods for rapid screening of anti-biofilm compounds, and for optimization of treatment performance. The purpose of this study was to determine whether fungicide testing versus microbial biofilms would provide a more accurate estimation of treatment rates necessary for field efficacy versus foliar fungal pathogens. The results are presented within the context of accelerating fungicide product discovery and development.

Effect of fertilizer on components of the disease cycle of Valdensinia heterodoxa in lowbush blueberry. P. D. HILDEBRAND, W. E. RENDEROS, S. A. E. FILLMORE AND B. A. WALKER. Atlantic Food and Horticulture Research Centre, Agriculture and Agri-Food Canada, 32 Main Street, Kentville, NS B4N 1J5, Canada

Valdensinia leaf spot has become a serious disease in lowbush blueberry that causes premature leaf drop in the crop and sprout phases of production. In this study, we examined the effect of fertilizer on various components of the disease cycle of Valdensinia heterodoxa Peyronel. Two-year old potted plants were obtained from a nursery that had been grown outdoors until mid-December of the second year when they were placed into cold storage at 1 °C until the following season. The plants were pruned to simulate commercial practices and fertilized once with 15-15-18 (N-P-K) at 20 kg N/ha or weekly at this rate (6 applications). After 6.5 weeks of re-growth in a greenhouse, the foliage was inoculated with conidia of V. heterodoxa and incubated at 20 °C for 24 h when the incidence of infected leaves, lesions/leaf and lesion size were assessed. Infected leaves were collected and incubated in Petri dishes with moist filter paper in a growth chamber at 20 °C with a 16 h photoperiod. After 8 days, released conidia on lids were counted, leaf area was measured and leaves were then further incubated at 20 °C in darkness for 12 days when incidence of leaves with sclerotia and their length in the mid-vein were assessed. The incidence of infected leaves was not affected by fertilizer, but lesions/leaf increased by 19.8%, lesion size increased by 21.8%, conidia/cm² leaf tissue increased 3.4 times, incidence of leaves with sclerotia increased 4.1 times and size of sclerotia increased 7.9 times with 20 Kg N/ha compared with the nontreated control. The high rate of fertilizer further stimulated these components. During the last 10–15 years, growers began to routinely fertilize fields with up to 24–31 kg N/ha. This study showed that an application of just 20 Kg N/ha can dramatically stimulate this disease and may help to explain its recent increase in blueberry fields.

Efficacy of fungicide, seeding date, and seedling age on seedling emergence, clubroot severity, and yield of canola. S. F. HWANG, T. CAO, Q. XIAO, H. AHMED, V. P. MANOLII, G. TURNBULL, S. E. STRELKOV, B. D. GOSSEN AND G. PENG. Crop Diversification Centre North, Alberta Agriculture and Rural Development, 17 507 Fort Road N.W., Edmonton, AB T5Y 6H3, Canada; (T.C., Q.X. V.P.M., S.E.S.) Department of Agricultural, Food and Nutritional Science, University of Alberta, 410 Agriculture/Forestry Centre, Edmonton, AB T6G 2P5, Canada; and (B.D.G., G.P.) Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada

Infestation of canola seed by Plasmodiophora brassicae Woronin could result in seedborne transmission of clubroot to fields where the pathogen (or a particular pathotype) does not yet occur. The effect of the seed treatment fungicides Dynasty 100 FS, Helix Xtra, Nebijin SSC, Prosper FX, and Vitavax RS on seed transmission of clubroot were evaluated under greenhouse conditions using artificially infested canola seeds. Each of the fungicides significantly reduced clubroot levels relative to the control, but Dynasty 100 FS and Nebijin SSC were the most effective, reducing disease severity by 75 and 80%, respectively. However, in trials planted in fields where P. brassicae was already present, none of the treatments evaluated (Cruiser, Helix Xtra, Dynasty, Prosper and Sedaxane) applied alone or in combination reduced clubroot severity or increased seedling emergence and yield. It appears that while seed treatments may be effective at removing seedborne inoculum, they may not be sufficient to protect the crop when sown in a field where a P. brassicae infestation is already established. In seeding date experiments conducted under field conditions, clubroot severity was higher and seed yield was lower in late-seeded canola (clubroot severity 1.30; seed yield 0.91 t/ha) compared to the early-seeded (clubroot severity 0.65; seed yield 1.18 t/ha) crop in one of three site-years. In another study, the impact of seedling age and cultivar resistance on clubroot severity, plant height and yield was evaluated under greenhouse conditions. Clubroot was more severe and plant height and yield were lower in younger seedlings versus older seedlings of both resistant and susceptible canola cultivars. We conclude that early seeding has promise for use as part of an integrated program for clubroot management.

Novel microbial biodetoxification of type-A and type-B trichothecene mycotoxins. R. ISLAM, T. ZHOU, J. C. YOUNG AND K. P. PAULS. (R.I., T.Z., J.C.Y.) Guelph Food Research Centre, Agriculture and Agri-Food Canada, 93 Stone Road West, Guelph, ON N1G 5C9, Canada; and (R.I., K.P.P.) Department of Plant Agriculture, Crop Science Building, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada

Cereals are frequently contaminated with multiple type-A and/or type-B trichothecene mycotoxins, that are produced by the toxigenic Fusarium spp. during host plant infection. Interactions between the co-occurring mycotoxins have synergistic effects on toxicity and result in serious adverse effects on animal and human health. Hence contamination of grains with several mycotoxins is increasingly of concern in terms of food safety, quality and trade. Currently, there is no method to remove trichothecene mycotoxins safely and completely from agricultural commodities. To address this problem, we isolated a novel bacterial strain ADS47 from agricultural soil capable of de-epoxydizing (i.e. detoxifying) ten different type-A and type-B trichothecene mycotoxins that had been detected in cereal foods and feeds. Microbial biotranformation of mycotoxins was examined by culturing the strain ADS47 in four broth media (namely nutrient broth, mineral salts broth, luria bertani and brain heart infusion) supplemented with 100 ppm of various toxins. After five days of incubation under aerobic conditions and moderate temperatures, biotransformation of the mycotoxins was determined by liquid chromatography-ultraviolet-mass spectrometry. Strain ADS47 completely bio-transformed all five type-A mycotoxins, namely HT-2 toxin, T-2 toxin, T2-triol, diacetoxyscirpenol and neosolaniol to de-epoxy and/or deacetyl metabolities. The tested five type-B trichothecene mycotoxins, namely nivalenol, verrucarol, FusarenonX, 3-acetyl-deoxynivalenol and 15-acetyl-deoxynivalenol were also completely biotransformed to de-epoxy and/or unknown products. Media compositions had considerable effects on microbial de-epoxydation of the evaluated ten mycotoxins. This is the first report of microbial de-epoxydation of multiple type-A and type-B trichothecene mycotoxins under aerobic conditions and moderate temperatures. We speculate that strain ADS47 could directly be used for detoxifying mycotoxins contaminated grains and grain-derived products (e.g. silages for animal feedings). We are working on isolating the mycotoxins de-epoxydation bacterial gene(s)/enzyme(s). The gene(s)/enzymes may have potential applications for biological detoxification of agricultural commodities contaminated with multiple trichothecene mycotoxins including ‘vomitoxin’. Thus, the study may contribute to improve the quality, safety and trade of grain-derived foods and feeds.

Efficacy of Serenade and Prestop against clubroot is affected by soil type. H. KASINATHAN, B. D. GOSSEN, G. PENG AND M. R. MCDONALD. Department of Plant Agriculture, Crop Science Building, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada; and (B.D.G., G.P.) Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada

Clubroot of canola (Brassica napus L.) and other brassica crops is caused by Plasmodiophora brassicae Woronin. A study was conducted to determine if soil type: muck soil, mineral soil, non-calcareous sand and soil-less mix, influences the efficacy of the biofungicides Serenade (Bacillus subtilis) and Prestop (Gliocladium catenulatum) against P. brassicae in canola under controlled environmental conditions (25/20 °C day/night). The trial was arranged in a factorial randomized complete block design with three factors (soil type, biofungicides, and pathotypes 3 and 6), four replicates, and 12 plants per experimental unit. Canola (cv ‘46A76’) was sown directly into muck soil and soil-less mix and transplanted into sand and mineral soil. Serenade (5% v/v) and Prestop (7.5 g L⁻¹ of water) were applied at 50 mL solution per plant, 5 days after seed germination. Three days later, each seedling was inoculated with 5 mL of a resting spore suspension of P. brassicae containing 1 × 10⁵ spores mL⁻¹. Clubroot severity was assessed at 6 weeks after inoculation using a 0–3 scale, and a disease severity index (DSI, range 0–100) was calculated. Pathotype 3 resulted in slightly more clubroot (74% incidence, DSI = 52) than pathotype 6 (65% incidence, DSI = 43). The most important interaction was biofungicide × growing media. Incidence was low in plants treated with Prestop when grown on mineral soil (53% incidence) and soil-less mix (32% incidence), and severity was lower on mineral soil (DSI = 33) and muck soil ( DSI = 43) than the check (81% incidence, mean DSI = 58). Serenade was effective only in sand (55% incidence, DSI = 33). These results indicate that growing medium is an important factor in evaluation of biofungicides in controlled environments and that soil type will likely influence the efficacy of these biofungicides in field trials.

Metabolic profiles of barley genotypes inoculated with trichothecene producing and nonproducing isolates of Fusarium graminearum . G. K. KUMARASWAMY, A. C. KUSHALAPPA, T. M. CHOO, Y. DION AND S. RIOUX. Department of Plant Science, McGill University, 21,111 Lakeshore Road, Ste-Anne-de-Bellevue, QC H9X 3V9, Canada; (T.M.C.) Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada; (Y.D.) Centre de recherché sur les grains inc. (CÉROM), 740, chemin Trudeau, Saint-Mathieu-de-Beloeil, QC J3G 4S5, Canada; and (S.R.) CÉROM, 2700 rue Einstein, Ste. Foy, QC G1P 3W8, Canada

Resistance in barley to fusarium head blight (FHB), caused by Fusarium graminearum Schwabe (teleomorph: Gibberella zeae Schwein (Petch)), is quantitatively inherited. Four recombinant inbred lines, resistant and susceptible, black and yellow barley (derived from a cross between AC Legend/CH9403-2), were used in this study. Metabolic profiles were used to discover novel mechanisms of resistance. The spikelets were inoculated with a trichothecene-producing isolate, trichothecene-nonproducing isolate (tri5^- mutant) or mock solution. Spikelets were sampled, metabolites extracted in aqueous methanol, and analyzed using a LC-hybrid-MS (LC-ESI-LTQ-Orbitrap). A pair wise comparison between the resistant and susceptible genotypes, and pathogen and mock-inoculations, was separately made for the black and yellow colored genotypes. Student's t-test was used to select treatment significant peaks, which were further used to identify resistance related constitutive (RRC), resistance related induced (RRI), and resistance indicator (RI) metabolites. The RRC, RRI and RI metabolites were putatively identified. A signal molecule, jasmonic acid, was induced in barley only following inoculation of the trichothecene-producing isolate. Phenylpropanoids: cinnamic acid, sinapoyl alcohol, coniferin, catechin and naringin were identified as RRI metabolites, only against tri5^- mutant. p-Coumaric acid, coniferaldehyde and sinapaldehyde were induced in greater abundances against tri5^- mutant. Deoxynivalenol production and its degradation to DON-3-O-glucoside, designated as resistance indicator (RI) metabolites, also varied among genotypes. The roles of these RRC, RRI and RI metabolites in plant defense, and their further use as potential FHB resistance biomarkers will be discussed.

Heterobasidion populations in Canada are separated geographically and resemble H. irregulare and H. occidentale based on sequence analysis of housekeeping genes. X. LI, S. SHAMOUN, J. NIE, D. L. HAMMILL AND S. H. DE BOER. Canadian Food Inspection Agency, Charlottetown Laboratory, 93 Mount Edward Road, Charlottetown, PE C1A 5T1, Canada; and (S.S.) Pacific Forestry Centre, Canadian Forest Service, Natural Resources Canada, 506 West Burnside Road, Victoria, BC V8Z 1M5, Canada

Heterobasidion annosum (Fr.) Bref. species complex, the causal agent of root and butt rot of coniferous trees, is comprised of five fungal species. Heterobasidion annosum, H. parviporum (Fr.) Niemelä & Korhonen, and H. abietinum Niemelä & Korhonen are widely distributed in European countries while H. irregulare (Underw.) Garbel. & Otrosina and H. occidentale Otrosina & Garbel. occur in different regions of North America. Morphological differentiation among species remains a long standing challenge for classification of these plant pathogenic fungi despite recent progress. In this study, we collected 26 isolates from the provinces of British Columbia and Ontario. Eight housekeeping gene markers were selected for genetic analysis of heterobasidion populations isolated in Canada. Specific gene fragments were amplified and purified, and sequenced for each of the fungal isolates. The targeted genes were transcription factor, glutathione-S-transferase, internal transcribed spacer region, NADH dehydrogenase (subunit 5), elongation factor 1 (α subunit), ATP synthase (subunit 6), glyceraldehyde 3-phosphate dehydrogenase and mitochondrial rDNA insertion element. Phylogenetic analysis of sequences from the 26 isolates along with those from 226 other strains isolated in Europe, Asia, and North America, based on the partial elongation factor sequences, revealed that isolates from British Columbia formed a cohesive cluster resembling H. occidentale, and shares high sequence homology with isolates from regions west of the Rocky Mountains, such as California and Idaho in the USA. Another 16 isolates from regions east of the Rocky Mountains exhibited various degrees of sequence variation, and shared a close phylogenetic relationship with H. irregulare isolates from Quebec and Ontario in Canada, and Montana, Georgia, and Alabama in the USA. We are currently analysing the sequence data obtained from the additional housekeeping genes of the 26 isolates for multi-loci sequence typing.

First report of Phytophthora palmivora Butler causing root rot on avocado ( Persea americana ) in Cuba. M. MACHADO, C. COLLAZO, M. PEÑA, M. -A. RENAUD, M. O. LÓPEZ, O. COTO, V. ZAMORA, R. I. CABRERA, M. ARAUGUREN AND G. J. BOLAND. Instituto de Investigaciones en Fruticultura Tropical. 7ma., No.3005, PO 11300, La Habana, Cuba; (M.-A.R., G.J.B.) School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada; (M.O.L.) Instituto de Investigaciones de Sanidad Vegetal. 110 e/5A y 5F, Playa, La Habana, Cuba; and (M.A.) Unidad Científico-Técnica “Felix Duque-Guelmes”, Matanzas, Cuba

During 2007–2008, avocado (Persea americana Mill.) trees showing root rot symptoms were observed in Jagüey Grande, Alquízar, and Havana city, Cuba. We conducted pathogen isolation by plating diseased roots and fallen fruit directly, and avocado fruit tissues baited from rhizosphere soil onto selective V8 agar (PARPH) or carrot agar. Direct plating of infected and baited tissues yielded pure cultures that developed white, stellate colonies with sparse aerial mycelia. Hyphal growth was completely inhibited above 35 °C. Single, terminal sporangia on simple sympodium sporangiophores formed abundantly in agar and liquid media. Sporangia were 20 to 80 μm (48.4 ± 9.2 μm) long and 17.5 to 52.5 μm (31.6 ± 5.5 μm) wide, caducous, with short pedicels and prominently papillated. Sporangia were variable in shape, mostly ovoid-ellipsoid, obpyriform, spherical and distorted, with a narrow (6.4 ± 1.7 μm) exit pore. The isolates were heterothallic; and hyphal swellings and terminal and intercalary globose chlamydospores were also observed. PCR amplification using Pa11s/Pa12a primers, specific to Phytophthora palmivora, yielded a band of the expected size (648 bp). BLAST analysis of the nucleotide fragments of about 900 bp from Cuban isolates (FJ666090, GU073390, and GU073391) amplified using ITS5/ITS4 generic primers showed a 98–99% identity with P. palmivora isolates from India (AM422704 and EU515173) and Colombia (GQ398157). Multiple sequence alignment by VectorNTI program revealed a 98.8% of identity. Pathogenicity tests were performed using pieces of lateral branches from mature avocado trees and resulted in rapidly developing (within 72 h), sunken, necrotic lesions around the sites of wound inoculation. The causal agent was consistently re-isolated from necrotic tissues. This is the first report of P. palmivora affecting avocado trees in Cuba.

Variation in chemotype and aggressiveness among Fusarium isolates from different geographical zones. A. MALIHIPOUR, J. GILBERT, M. PIERCEY-NORMORE AND S. CLOUTIER. Cereal Research Centre, Agriculture and Agri-Food Canada, 195 Dafoe Road, Winnipeg, MB R3T 2M9, Canada; and (M.P.-N.) Department of Biological Sciences, 212B Biological Sciences Building, University of Manitoba, Winnipeg, MB R3T 2N2, Canada

Fifty eight putative Fusarium graminearum Schwabe isolates from Canada, Mexico, and Iran (isolated between 1996 and 2005) were used for chemotype analysis and to determine levels of aggressiveness on wheat. Phylogenetic relationships among the isolates were characterized using the Tri101 gene sequencing data. All Canadian and Iranian isolates clustered in one group and were identified as F. graminearum lineage 7 (= F. graminearum sensu stricto) within the F. graminearum (Fg) clade. The isolates from Mexico were placed in F. graminearum lineage 3 (= F. boothii) within the Fg clade or in F. cerealis (= F. crookwellense). A PCR assay based on the Tri12 gene revealed the presence of the three trichothecene chemotypes, 15-ADON, 3-ADON, and NIV among the isolates tested, with 15-ADON predominating. All F. boothii isolates from Mexico were identified as 15-ADON chemotype, while all F. cerealis isolates were determined to be the NIV chemotype. While the NIV chemotype was not found among Canadian isolates, this chemotype was predominant among the Iranian isolates. There was evidence of a shift from the 15-ADON to the more toxigenic 3-ADON chemotype among the Canadian isolates within the period 1996 to 2004. Fusarium isolates were individually inoculated on the susceptible wheat cultivar ‘Roblin’ under greenhouse conditions to measure disease spread within the spike as an indication of aggressiveness. Disease spread within the spike was rated as the percentage of diseased spikelets per spike 21 days after inoculation. A high variation in aggressiveness was observed among and within the species tested, with isolates of F. graminearum sensu stricto being the most aggressive, followed by F. boothii and F. cerealis. An association was found between chemotype and aggressiveness with the observation that 3-ADON chemotypes were the most aggressive, followed by the 15-ADON and NIV chemotypes.

Effect of leaf rust on ‘Thatcher’ near-isogenic wheat lines. B. D. MCCALLUM, G. HUMPHREYS, R. DEPAUW AND C. HIEBERT. Cereal Research Centre, Agriculture and Agri-Food Canada (AAFC), 195 Dafoe Road, Winnipeg, MB R3T 2M9, Canada; and (R.D., C.H.) Semiarid Prairie Agricultural Research Centre, AAFC, P.O. Box 1030, Swift Current, SK S9H 3X2, Canada

Wheat leaf rust, caused by Puccinia triticina Eriks., is a serious production problem in Canada and other countries. Genetic resistance has been effective in controlling wheat leaf rust. A series of near-isogenic wheat lines (NILs) were developed, by the late Dr. Peter Dyck, each with a different resistance gene or gene combination, using the susceptible cultivar ‘Thatcher’. In 2002 and 2003, 30 ‘Thatcher’ NILs and six hard red spring wheat cultivars were grown in yield trials at Glenlea, Morden and Brandon MB which all had high natural levels of leaf rust, and Swift Current SK, which had very low leaf rust incidence. Agronomic characters such as maturity, height, lodging, and grain yield were evaluated along with the leaf rust reaction. Quality of the harvested grain was assessed on samples from Glenlea and Swift Current by measuring test weight, 1000 kernel weight, grain protein content, grain hardness, and sedimentation volume. Under leaf rust pressure, many of the ‘Thatcher’ NILs with effective resistance genes exhibited reduced levels of leaf rust and yielded significantly more than ‘Thatcher’. In the absence of leaf rust pressure, most NILs were equivalent to ‘Thatcher’ in terms of agronomic performance and quality, although some lines were inferior. These results demonstrated the effectiveness of many of these genes in controlling leaf rust and protecting grain yield under leaf rust pressure, while having no apparent deleterious effects on agronomic performance or end use quality in the absence of the disease.

The incidence and severity of loose smut and surface borne smuts of barley on the Canadian Prairies: 1972–2009. J. G. MENZIES AND P. L. THOMAS. Cereal Research Centre, Agriculture and Agri-Food Canada, 195 Dafoe Road, Winnipeg, MB R3T 2M9, Canada

The barley pathogens Ustilago nuda (Jensen) Kellerman & Swingle, the cause of loose smut, U. nigra Tapke., the cause of false loose smut, and U. hordei (Pers.) Rostr., the cause of covered smut, were likely introduced to Canada on seed by early settlers. This report summarizes the survey data collected annually from 1972 to 2009, which have monitored the incidence and severity of these pathogens in barley fields on the Canadian Prairies. Barley fields to be surveyed were selected at random at intervals of at least 10 to 15 km. The presence of disease and an estimate of the percentage infected plants (plants with sori) were determined while walking an ovoid path of approximately 100 m in each field. Samples of smutted heads were collected for accurate identification of the pathogen in the laboratory. The data were separated into loose smut incidence and severity (U. nuda infects developing embryos) and surface borne smut incidence and severity (combining data for U. nigra and U. hordei, which infect germinating seedlings) for analysis. The three pathogens are ubiquitous in barley fields on the Canadian Prairies, but their areas of greatest incidence and severity were in Manitoba and northern crop districts of Saskatchewan and Alberta. The incidence of loose smut has declined since 1985, when 90% of all barley fields were infested. Since 2004, 20 to 40% of barley fields were infested with loose smut. The surface borne smuts have also declined since 1977, when 95% of barley fields were infested, to the point where few infested fields were found after 1999. The average severity of loose smut and surface borne smuts has been low. The highest average severity of loose smut occurred in 1975 at 1.6% and for surface borne smuts, in 1987 at 2.3%. Since 1998, the average severity of loose smut has been below 0.5%, and for surface borne smut, the severity was below 0.1%.

Chemical genomics - discovery of novel fungicides and their targets in the phytopathogen Fusarium graminearum . C. D. MOGG, P. BARKS, M. L. SMITH AND G. SUBRAMANIAM. (C.D.M. G.S.) Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada, Ottawa, ON K1A 0C6, Canada; and (C.D.M., P.B., M.L.S.) Department of Biology, Carleton University, Ottawa, ON K1S 5B6, Canada

The ascomycete fungus Fusarium graminearum Schwabe is a globally distributed cereal pathogen that is responsible for billions of dollars in annual worldwide economic losses. The infection of wheat with F. graminearum causes fusarium head blight (FHB) resulting in grain quantity and quality degradation, and mycotoxin contamination. F. graminearum and other members of this genus have become important model organisms for biological and evolutionary research on account of their impact upon the economics of global food production. We have developed a high-throughput system and assessed the growth of F. graminearum in the presence of a chemical library and plant extracts. Out of 35 compounds discovered to inhibit fungal growth, four have been selected for closer investigation. Future research will be to: 1) Perform efficacy studies to counter FHB in wheat; 2) Use a Saccharomyces cerevisiae Synthetic Deletion Array to identify targets; 3) Functionally complement identified S. cerevisiae targets with F. graminearum gene homologues.

Verticillium dahliae genes putatively involved in microsclerotium development and pathogenicity. N. P MORALES-LIZCANO AND K. F. DOBINSON. Department of Biology, University of Western Ontario, London, ON N6A 5C1, Canada; and (K.F.D.) Southern Crop Protection and Food Research Centre, Agriculture and Agri-food Canada, 1391 Sandford Street, London, ON N5V 4T3, Canada

Verticillium dahliae Kleb. is a soil borne fungus, causal agent of an economically significant vascular wilt disease. Verticillium dahlia produces persistent resting structures, known as microsclerotia, which are the primary source of disease inoculum in the field. Microsclerotium development has been studied at the morphological level, but still little is known about the molecular mechanisms that govern development. Recent gene expression studies and analysis of the V. dahliae genomic sequence have identified a diverse number of genes that may be involved in microsclerotia development. This study focuses on the characterization of several genes, including one (provisionally designated VdHyp04) that encodes a “hypothetical protein”, and four that encode hydrophobin-like proteins. Bioinformatics analyses suggest secretion of these hydrophobin-like proteins, and indicate that they are, like the previously characterized VDH1, class II hydrophobins. VdHyp04 appears to be an intron-containing gene (with two non-consensus intron splice sites) that encodes a small, secreted protein. Agrobacterium tumefaciens-mediated transformation is being used to generate gene deletion mutants, and knock out (KO) strains have been produced for VdHyp04 as well as one of the hydrophobin-like protein encoding genes (VdH5). Both gene KO strains show an amicrosclerotial phenotype, but no other defects have yet been identified. Generation of KO mutants for the other three hydrophobin gene homologues is in progress. Preliminary analyses of the vdhyp04 and vdh5 mutants is being done to determine if these genes are involved or not in microsclerotia development or in pathogenicity, and data from these studies was presented.

Molecular aerobiology - the contribution of new spore quantification methods. D. C. MORISSETTE, M. TREMBLAY, L. BRODEUR, H. VAN DER HEYDEN AND O. CARISSE. Phytodata Inc., Sherrington, QC J0L 2N0, Canada; and (M.T., O.C.) Horticulture Research and Development Centre, Agriculture and Agri-Food Canada, 430 Gouin Bouevard, Saint-Jean-sur-Richelieu, QC J3B 3E6, Canada

For several foliar diseases such as Botrytis leaf blight of onion (Botrytis squamosa J.C. Walker) and grey mould of tomato (Botrytis cinerea Pers. ex Fr.), airborne inoculum is a key factor influencing disease progress and hence monitoring airborne inoculum is essential to disease management. Since more than a century, several spore samplers were developed. For most spore samplers, spore counts are made by microscopic observations which are time consuming and not always reliable as specific spores are often difficult to identify or to distinguish from similar spores from different fungal species. In addition, in several situations, several spore samplers may be needed which would considerably increase the delay between sampling and information delivery. Molecular techniques such as quantitative PCR (qPCR) circumvent this problem. On average using microscopic observations may require 15 to 30 min to count the spores on one sample, up to 40 samples can be processed by qPCR in less than 2.5 h. This molecular technique allows processing a huge number of samples and hence to deliver information on abundance of inoculum in a timely manner and to identify best time to apply a control measure. From a research stand point, the ability to process large number of samplers make possible studies on the spatio-temporal dynamics of airborne inoculum. The benefits of monitoring airborne inoculum of B. squamosa and B. cinerea with qPCR will be used as an example.

Investigating the impact of fungal produced cytokinins on fungal development and disease progression in the Ustilago maydis – Zea mays pathosystem. E. N. MORRISON, K. M. MARSH, R. J. N. EMERY AND B. J. SAVILLE. (E.N.M., R.J.N.E., B.J.S.) Environmental & Life Sciences Graduate Program, DNA Building, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada; (R.J.N.E.) Department of Biology, Life & Health Science Building, Block D, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada; and (B.J.S.) Forensic Science Program, DNA Building, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada

The involvement of fungal produced cytokinins in plant disease development has not been thoroughly examined. Cytokinins are a group of phytohormones that are often associated with actively dividing tissues. Infection of corn by the smut fungus Ustilago maydis D.C. Corda stimulates uncoordinated cellular division, resulting in the formation of tumors on all aerial organs of the plant. Early studies identified altered cytokinin [CK]-like activity associated with these tumors. The first and rate-limiting step in cytokinin biosynthesis in plants is catalyzed by isopentenyltransferases (IPTs). In fungi, related IPTs are usually tRNA-isopentenyltransferases (tRNA-IPTs). U. maydis is amenable to molecular manipulation and biochemical characterization. This allowed us to create solopathogenic strains (SG200) of U. maydis in which the sole tRNA-isopentenyltransferase (tRNA-IPT gene) was deleted. We determined, by liquid-chromatography-electrospray ionization-tandem mass spectrometry, LC- (ESI) MS/MS, that none of the major CKs produced in wild type cultures are detectable in the tRNA-IPT deletion mutant strains. These strains have different disease development profiles, when compared to wild type strains, during seedling and cob pathogenesis assays in corn. The role of CK production by U. maydis in disease development was further investigated through the over expression of the tRNA-IPT gene in solopathogens and compatible haploids. A comparison of CK production, growth and pathogenic development by these strains will be presented. Further, we are beginning to investigate the control of cytokinin production by U. maydis and will present preliminary data on the detection and characterization of a putative natural antisense transcript to the U. maydis tRNA-IPT mRNA.

Fusarium graminearum chemotypes and deoxynivalenol levels from winter wheat commercial fields across Ontario in 2010. A. Muckle, A. Schaafsma, M. R. McDonald, W. G. D. Fernando and L. Tamburic-Illincic. Department of Plant Agriculture, University of Guelph, Ridgetown Campus, 120 Main Street East, Ridgetown, ON N0P 2C0, Canada; (M.R.M.) Department of Plant Agriculture, Crop Science Building, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada; and (G.D.F.) Department of Plant Science, University of Manitoba, 222 Agriculture Building, 66 Dafoe Road, Winnipeg, MB R3T 2N2, Canada

Fusarium head blight (FHB) caused by Fusarium graminearum Schwabe is an economically important wheat disease in Canada. FHB causes decreased yield and quality and the accumulation of mycotoxins including deoxynivalenol (DON). Different F. graminearum populations (chemotypes) produce either DON/15-ADON or DON/3-ADON and some parts of North America (not Ontario) are reporting a shift from the 15- to the 3-ADON chemotype. The objective of this study was to investigate the occurrence and frequency of 15-ADON and 3-ADON isolates of F. graminearum and DON levels from fields with and without fungicide application, across different counties and winter wheat cultivars. In 2010 grain samples were collected from 50 commercial fields across Ontario. Grain DON content was estimated for each location using the ELISA method. From each location, 60 kernels considered to be of low quality, were surface sterilized, then cultured and incubated on acidified potato dextrose agar to isolate the pathogen. The frequency of Fusarium spp. was determined and Fusarium graminearum chemotypes will be identified by PCR. DON levels ranged from none detected -1.8 ppm. The highest DON level (1.8 ppm) occurred in a commercial field with the variety ‘Wentworth’ and no fungicide application. The lowest DON level (none detected) occurred in two commercial fields with the varieties ‘25W43’ and ‘25R47’ both of which received fungicide application. Middlesex County had the highest DON level (0.9 ppm) based on the average of 7 commercial field locations, while Chatham-Kent, Lambton and Wellington counties had the lowest DON level (0.2 ppm), based on the average of 8, 2 and 6 commercial field locations, respectively. Middlesex County had the highest average percent Fusarium spp. (56.9%), while Lambton County had the lowest (15.8%).

Genetic diversity of potato virus Y in seed-lot potatoes in New Brunswick. U. N. NANAYAKKARA, X. NIE, M. SINGH AND Y. PELLETIER. Potato Research Centre, Agriculture and Agri-Food Canada, 850 Lincoln Road, P.O. Box 20280, Fredericton, NB E3B 9H8, Canada; and (M.S.) Agricultural Certification Services, 1030 Lincoln Road, Fredericton, NB E3B 8B7, Canada

Recently Potato virus Y (PVY) has reemerged as a major problem in seed potato production in North America including New Brunswick (NB), Canada. It is widely believed that a change in the genetic composition of PVY strains has resulted in high PVY incidences. This study investigated genetic diversity of PVY in 20 seed-lots in NB growing 11 different cultivars in 2009. Multiplex RT-PCR, serological and biological assays were used to reveal and characterize the strain identity. PVY^O strain is the predominant strain in NB seed-lots. However, recombinant strains, PVY^N:O and European (Eu) PVY^NTN are widespread and becoming prevalent in NB. PVY^N:O was identified in 19 of the 20 seed-lots and accounted for ∼13% of the isolates. Eu-PVY^NTN was identified in 13 of the 20 seed-lots and accounted for ∼ 5% of the isolates. When these tubers were planted in the field, progeny tubers did not develop tuber necrosis at the time of harvest or after 5 months in storage. North American (NA) PVY^N/NTN strains were conspicuously absent in these seed-lots. Mixed infections with PVY strains, mainly PVY^O and PVY^N:O or PVY^NTN were found in 18 of the 20 seed-lots and accounted for ∼10% of the isolates (total 728). A coat protein gene based RT-PCR assay differentiated the dominant PVY^O strain into three groups: PVY^O-Oz/-FL type, PVY^O-139/-RB type, and an uncharacterized PVY^O type. The PVY^O-Oz/-FL type is the predominant followed by the uncharacterized PVY^O type. Incidences of PVY^O-139/-RB are either low or completely absent. PVY^O-Oz/-FL type generally produced severe symptoms in all 11 cultivars compared to other PVY^O types and PVY strains. Biological assays on tobacco and ‘Yukon Gold’ confirmed the findings from RT-PCR assays and serological assays. Results from this study clearly demonstrate the diverse nature of PVY in NB, Canada.

Isolation and evaluation of soil microorganisms for control of clubroot on canola. G. PENG, S. M. BOYETCHKO, R. K. HYNES, L. MCGREGOR, K. SAWCHYN AND D. HUPKA. Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7J 0X2, Canada

Clubroot, caused by the plasmodiophorid pathogen Plasmodiophora brassicae Woronin, is an emerging threat to canola (Brassica napus L.) production in western Canada. During the 2008 and 2009 crop seasons, canola roots were collected from the Black Soil Zone of Alberta and Saskatchewan for isolation and screening of indigenous microorganisms against clubroot. Under laboratory conditions, soils removed from the root surfaces were suspended in sterile water (SW), and plated on acidified potato dextrose agar amended with antibiotics or on nutrient agar (NA) for isolation of rhizosphere fungi and bacteria, respectively. Additional root samples were surface sterilized in 70% alcohol for 30 s, 0.12% hypochlorite for 5 min, cut into 1-cm pieces after rinsing, and placed on the same media for 2–6 weeks to isolate endophytes. A total of 5,152 isolates were obtained, and screened for antagonism initially against an indicator pathogen (Pythium ultimum Trow) in vitro. About 440 antagonistic isolates were selected and tested against clubroot on canola using a bioassay in which the microbial candidates were applied as a soil drench (25 mL) immediately after seeding to saturate the growth medium that had already been infested with P. brassicae at 2 × 10⁶ resting spores/g. For fungal isolates, the suspension was adjusted to about 10⁶ spores or propagules/ml and for bacteria, the lawn of a culture on NA from three Petri plates (10-cm-diam) was scraped and suspended in 200-mL SW. Treated plants were kept in a growth cabinet at 23/18 ºC for 4 weeks, and clubroot development assessed using a 0–3 scale where 0 indicated no clubroot symptoms and 3 represented greater than 75% of the root affected. Seven plants (replicates) were used for each microbial candidate, and plants which received water only were included in each test as controls. Overall, only three bacterial isolates resulted in greater than 75% of reduction in clubroot severity relative to controls. These bacteria were identified tentatively as Bacillus sp. and Pseudomonad spp. and the Bacillus sp. isolate appeared to be an endophyte capable of colonizing canola roots. These isolates are being further investigated for their practicality in clubroot control on canola.

Susceptibility of potato and other hosts to late blight caused by Canadian genotypes of Phytophthora infestans . R. D. PETERS, H. W. PLATT, B. W. BEATON, C. BANKS AND I. K. MACDONALD. Crops and Livestock Research Centre, Agriculture and Agri-Food Canada, 440 University Avenue, Charlottetown, PE C1A 4N6, Canada; and (B.W.B., C.B.) PEI Department of Agriculture, Charlottetown, PE C1A 4N6, Canada

Late blight, caused by Phytophthora infestans (Mont.) de Bary, has caused significant yield losses in both potato and tomato crops in Canada in recent years. In some cases, the initiation of disease epidemics has been traced to diseased tomato plantlets for sale at local retail outlets. To better understand the host range of Canadian genotypes of the pathogen, a greenhouse trial was conducted in 2010. Various cultivated varieties of potato, tomato, pepper and petunia were grown in the greenhouse and then inoculated with either the US-8 (A2 mating type; resistant to metalaxyl-m; common in eastern Canada) or US-11 (A1 mating type; resistant to metalaxyl-m; common in western Canada) genotypes of P. infestans. Plants were spray-inoculated with P. infestans sporangia and then maintained in a humid environment (mist chamber) to facilitate infection and subsequent disease development. Plants were rated for percent foliar necrosis three times per week and the experiment was ended prior to secondary spore development and dispersal within the foliage. Disease severity varied among potato cultivars with ‘Dorita’ showing the least susceptibility to symptom development. Similarly, tomato varieties differed in disease response, with ‘Mountain Magic’ displaying the most resistance to disease. No disease symptoms were found on the pepper varieties inoculated in the trial, however, necrotic lesions were found in petunia. In general, plants responded similarly to both genotypes of the pathogen. These results confirm the susceptibility of a range of horticultural crops to late blight and underscore the need for vigilant monitoring of plantlets distributed widely to the general public. As well, options exist for organic growers and home gardeners to choose varieties that resist disease development, thereby reducing potential sources of initial inoculum.

Screening for resistance to pasmo ( Septoria linicola ) in flax. K. Y. RASHID. Morden Research Station, Agriculture and Agri-Food Canada, Unit 100–101, Route 100, Morden, MB R6M 1Y5, Canada

Flax (Linum usitatissimum L.) is the second major oilseed crop grown on 600,000 to a million hectares in western Canada. Flax pasmo disease, caused by the funguus Septoria linicola (Speg.) Garassini (sexual state Mycosphaerella linorum Naumov), is a stubble-borne pathogen that causes severe epidemics with disease severity of 20–60% foliage affected, and 10–30% yield losses. Methodologies for testing flax genotypes and screening for resistance under controlled growth room conditions have been developed. Several trials were conducted using various levels of inoculum concentrations, varying incubation periods with dew formation, and different light and temperature regimes. The most consistent results were obtained by using artificial inoculations of 3-wk old seedlings with single spore isolates and incubating in a dew chamber with a misting system for 48 hrs (N/D of 16/8 hr with 25/28 °C, respectively). The inoculated plants were then moved into a growth room of similar N/D hrs and 20/25 °C, respectively. Disease reactions on leaves and stems were assessed every 10 days for 40 days after inoculation. This methodology proved effective in identifying differential reactions among flax genotypes and S. linicola isolates for future identification of distinct races of this pathogen and specific resistance genes for resistant cultivar development.

Efficacy of fungicides to reduce the impact of sclerotinia head rot in sunflower. K. Y. RASHID. Morden Research Station, Agriculture and Agri-Food Canada, Unit 100–101, Route 100, Morden, MB R6M 1Y5, Canada

Sunflower (Helianthus annuus L.) is a major crop in the USA and Canada and is grown on about 1 million ha in the USA and 100,000 ha in Canada. Head rot and mid-stem rot caused by ascospore infections of Sclerotinia sclerotiorum (Lib.) de Bary, are major diseases affecting sunflower in North America and worldwide. In Manitoba, 50–90% of sunflower crops are affected annually, and yield reduction is estimated at 10–20% in most years, and up to 80% in some fields. Field trials were conducted to study the efficacy of 18 fungicides on reducing the disease severity of head rot using artificial inoculation with ascospores under a misting system to ensure infections and disease development. Several fungicides were effective in significantly reducing disease incidence by up to 50–80% and significantly improved yield by up to 40–100% of the diseased control treatment. Fungicide application at flowering was more effective than after flowering, and two fungicide applications were more effective than one.

New races of Plasmopara halstedii causing sunflower downy mildew in Manitoba. K. Y. RASHID. Morden Research Station, Agriculture and Agri-Food Canada, Unit 100–101, Route 100, Morden, MB R6M 1Y5, Canada

Sunflower (Helianthus annuus L) is grown in western Canada on 80,000 ha mainly in Manitoba. The confection types are for in-shell and de-hulled kernels, while the oilseed types are mostly for the birdfeed market. Downy mildew (DM) caused by the fungus Plasmopara halstedii (Farl.) Berl. & De Toni is a major disease affecting sunflower worldwide. DM affects 15–80% of sunflower crops annually in Manitoba causing an estimated 10–20% yield reduction in most years, and up to 40% in some crops. Isolates of P. halstedii were collected from infected plants from sunflower fields between 2005 and 2010, and tested on 9 differential sunflower lines to identify the prevalent races. New race-groups 700 and 300 were more frequently collected than the 100 and 500 race groups traditionally reported in Canada. The specific races 720, 730 and 770 were very frequent over the last few years, and are virulent on most commercial sunflower hybrids grown in Canada.

The teliospore and meiosis as probes for investigating host influence of smut fungi development. A. M. SETO, C. E. DOYLE AND B. J. SAVILLE. (A.M.S., C.E.D., B.J.S.) Environmental & Life Sciences Graduate Program, DNA Building, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada; and (B.J.S.) Forensic Science Program, DNA Building, Trent University, 2140 East Bank Drive, Peterborough, ON K9J 7B8, Canada

Ustilago maydis D.C. Corda requires growth in the host plant Zea mays to complete its sexual cycle. A goal of the Saville lab is to investigate the influence of the host on U. maydis development using the teliospore as the probe. Teliospores are formed only during growth in the plant; they are the dormant dispersal agents, and the only cell type capable of meiotic division. It is reasonable to propose that genes expressed in the teliospore are involved in facilitating germination and the completion of meiosis. These genes are likely expressed in response to signals received from the plant. To investigate the role of these genes, we are following changes in their transcript levels during teliospore germination. Additionally, we will be determining the function of a gene putatively involved in the control of meiosis. Since teliospore germination is asynchronous, determining the timing of gene expression is difficult. We hypothesize that growth in a highly susceptible host, an inbred line of maize, along with harvesting teliospores from individual tumours, will result in increased germination synchrony. We will report on the level of germination synchrony assessed microscopically and through the change in transcript level of several genes with teliospore specific expression. To begin assessing the control of meiosis in U. maydis gene expression, umNdt80, an ortholog of the Saccharomyces cerevisiae meiotic control gene Ndt80, was deleted. Teliospores resulting from infection of corn with compatible umNdt80 mutants germinate but do not complete meiosis. Genes that are possible downstream targets of umNdt80 have been identified and will be characterized by comparing their levels of expression in teliospores produced from wildtype and umNdt80 deletion strains. Together these investigations will identify genes that can be used as probes for following the influence of Z. mays on U. maydis development.

Effect of temperature on cortical infection and disease severity by Plasmodiophora brassicae on Shanghai pak choy. K. SHARMA, B. D. GOSSEN AND M. R. MCDONALD. Department of Plant Agriculture, Crop Science Building, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada; and (B.D.G.) Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada

Clubroot, caused by Plasmodiophora brassicae Woronin, is an important worldwide root disease of Brassica crops. The life cycle of P. brassicae consists of two phases, a primary phase (infection and development in root hairs) and a secondary phase (cortical infection and gall development). Studies were conducted to assess the effect of temperature on development of P. brassicae in roots of Shanghai pak choy (Brassica rapa subsp. Chinensis) and on clubroot severity. Three-day-old seedlings were transplanted into root-trainers containing soil-less growing media, kept at 20 °C for 1 week, and inoculated by pipetting 800 μL of resting spore suspension (10⁸ spores of P. brassicae /mL) onto the base of each seedling. Control plants were inoculated with sterile water. After inoculation, the seedlings were transferred to growth cabinets at 10, 15, 20, 25, and 30 °C (14-h photoperiod, 65% RH). The roots of four plants per treatment were collected, washed, and assessed for cortical infection, stage of development of secondary infection, and clubroot severity at 4-day intervals from 10 to 42 days after inoculation (DAI). Cortical infection, visual symptoms, and clubroot severity were highest and initiated earliest at 25 °C, intermediate at 20 °C and 30 °C, and lowest and latest at 15 °C. No cortical infection or symptoms were observed at 42 DAI in plants grown at 10 °C. Regression analysis indicated that the effect of temperature on cortical infection was quadratic, with an optimum temperature near 25 °C (R² = 0.88; P < 0.001). Cortical infection was positively correlated with disease severity index (r = 0.95; P < 0.01). These results demonstrate that temperature affects secondary infection by P. brassicae, and that under ideal moisture and pH conditions, secondary infection is highly correlated with subsequent symptom development and severity.

Quantification of cortical infection by Plasmodiophora brassicae using Assess image analysis software. K. SHARMA, B. D. GOSSEN AND M. R. MCDONALD. Department of Plant Agriculture, Crop Science Building, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada; and (B.D.G.) Saskatoon Research Centre, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, SK S7N 0X2, Canada

The life cycle of Plasmodiophora brassicae Woronin, which causes clubroot of canola (Brassica naups L.) and other crucifers, consists of a primary phase (infection and development in root hairs), and a secondary phase (cortical infection and clubbing). The objective was to develop a histological technique to quantify cortical infection using Shanghai pak choy (B. rapa subsp. chinensis) as a model crop. Individual 3-day-old seedlings of pak choy in soil-less mix were inoculated with 1 × 10⁸ resting spores and maintained at 25 °C. Cortical infection and clubroot severity were assessed on four plants per date at 4-day intervals from 10 to 42 days after inoculation (DAI). A 0.5-cm root segment from the top 0–1 cm of each main root was dehydrated in an ethanol series, embedded in paraffin, and 6-ųm-thick cross-sections were cut and stained using methylene blue. This top of the taproot was selected because infection occurs first in this region and has a large impact on subsequent plant development. Four stains (periodic acid schiff, fast green, haematoxylin + eosin and methylene blue) were assessed. Methylene blue was selected for the analysis because it provided consistent results that were compatible with image analysis (Assess software, American Phytopathological Society). Five digital images per root at 125x magnification were collected and used to estimate the mean proportion of the area of each field of view that stained for P. brassicae. Cortical infection (CI) was 2.4% at 10 DAI but increased to 37% by 42 DAI. CI was strongly and positively correlated with disease severity (r = 0.98; P < 0.001). The Assess software readily separated infected and noninfected areas, and so provided a rapid technique for assessing cortical infection. This approach would be particularly useful where large numbers of samples are assessed. We conclude that assessment of cortical infection can be a useful supplement to other parameters of pathogen quantification, such as qPCR. Assessment of CI at 30 DAI at 25 °C would be optimum for many studies because this ensures a high CI in susceptible lines in a relatively short time.

Assessment of fusarium head blight in oat mid-season and at maturity. A. TEKAUZ. Cereal Research Centre, Agriculture and Agri-Food Canada, 195 Dafoe Road, Winnipeg, MB R3T 2M9, Canada

Fusarium head blight (FHB) in oat and other cereals is monitored annually in Manitoba to document disease occurrence, prevalence, and severity. In a growing oat crop there usually is scant visual evidence of FHB. However, when immature kernels are examined, some of these are normally infested by various Fusarium spp., suggesting FHB is developing. FHB can also be assessed at maturity, as done routinely by agencies such as the Canadian Grain Commission, to determine levels of fusarium-damaged kernels (FDK), Fusarium infestation of seed, and the presence and amounts of the mycotoxin deoxynivalenol (DON). To compare results between such assessments, and their implications, in 2010, ten commercial oat crops in southern Manitoba were sampled both mid-season (ZGS 78–85) and at maturity. The average mid-season Fusarium head blight index or FHB-I (overall visual FHB severity) was 0.3% (range 0–1.3%), a typical low value. Fusarium kernel infestation averaged 10.2% (range 0–24%), and involved four main species, F. graminearum Schwabe (7.0%), F. poae (Peck) Wollenw. (1.4%), F. avenaceum (Fr.) Sacc. (1.0%) and F. sporotrichioides Scherb. (0.6%). At maturity, kernel infestation levels doubled to 23.6% (range 11–34%), but now F. poae predominated (12.5%), followed by F. graminearum (8.6%), F. avenaceum (0.9%) and F. sporotrichioides (0.7%). FDK levels averaged 8.3% (range 1–27%) while mean DON contamination (determined using ELISA) was 1.9 ppm (range 0.5–3.3 ppm). The results indicate that while mid-season data provide useful information, such as the onset of FHB and the causal Fusarium species involved, sampling at maturity is needed to determine final FDK and DON levels. These influence grade, end-use options or indicate a health risk, and, total Fusarium kernel infestation levels that could impact seed quality. Both assessments provide necessary data, but each must be interpreted in context.

Development of fusarium head blight in wheat, barley and oat inoculated with Fusarium graminearum , F. poae and F. sporotrichioides . A. TEKAUZ AND D. GABA. Cereal Research Centre, Agriculture and Agri-Food Canada, 195 Dafoe Road, Winnipeg, MB R3T 2M9, Canada; and (D.G.) Grain Research Laboratory, Canadian Grain Commission, 1404-103 Main Street, Winnipeg, MB R3C 3G8, Canada

Cereal crops on the Canadian prairies often are affected by fusarium head blight (FHB). The disease reduces yields, lowers grade, and may contaminate grain with harmful mycotoxin(s). Fusarium graminearum Schwabe is the recognized principal causal agent of FHB, but other Fusarium species also are implicated, especially in oat and barley. To assess FHB produced by F. graminearum, F. poae (Peck) Wollen. and F. sporotrichioides Scherb., one wheat, two barley and three oat cultivars were grown in southern Manitoba in 2010 in field plots treated with Fusarium-infested corn kernels of the individual species. At maturity, levels of FDK, seed-borne Fusarium, and mycotoxins (using GC-MS) were determined. FDK levels for each pathogen were similar (7–15%) in oat and barley, but twice as high (40%) for F. graminearum in wheat vs. the others. Recovery of F. poae from seed was low (0–9%) in wheat and barley and moderate in oats (15–28%). Recovery of F. sporotrichioides was similar in all cereals (25–34%). Recovery of F. graminearum was very high (>80%) in wheat and barley, and moderate (35–50%) in oat. The principal mycotoxins detected were deoxynivalenol (DON) and HT-2. The latter was detected in F. sporotrichioides-treated samples of all cereals. The highest level (∼1.5 ppm) occurred in wheat. DON levels were very high (23–37 ppm) in wheat and barley treated with F. graminearum, but low (0.6–1.4 ppm) in oat. Trace levels of nivalenol were occasionally detected in barley, but not associated with a particular Fusarium. Apparent high amounts of natural F. graminearum inoculum led to substantial levels of this species being isolated from seed in all treatments. This likely influenced results, which must be interpreted accordingly.

Species susceptibility and biocontrol of fusarium wilt of Hiemalis begonias in Canada. X. TIAN AND Y. ZHENG. School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada

In 2010 a hitherto unknown disease caused major economic losses in Hiemalis begonias (Begonia × Hiemalis Fotsch) in commercial greenhouses in southern Ontario, Canada. The foliage of affected plants first appeared dull green and subsequently wilted. Lower portions of the stems became water soaked and the vascular tissues turned brown. It was identified that sporodochia of Fusarium foetans Schroers developed on affected portions of the stems. The pathogen was shown to be the causal agent in inoculation tests and the disease is referred to as fusarium wilt. The resistance tests were conducted in the greenhouse of different begonia species and cultivars to fusarium wilt, drenched inoculation plants with 50 mL conidia suspension at 10⁶ conidia/mL. Begonias showed different symptoms post inoculation time, and different species and cultivars showed different resistance to this pathogen. Disease symptoms were severe on Hiemalis begonia ‘Golden Edith’ even at low concentrations of 100 conidia/mL; and cultivar ‘Camilla’ was ranked as moderately resistant. For biological control with five microorganisms and five substrates in the greenhouse, vermicompost tea treatment delayed the symptoms three weeks. And vermicompost and yard waste substrates significantly suppressed fusarium wilt on Hiemalis begonias.

An overview of ochratoxin A in Canadian grains. S. A. TITTLEMIER, M. ROSCOE, R. BLAGDEN, C. KOBIALKA AND T. NOWICKI. Grain Research Laboratory, Canadian Grain Commission, 1404-303 Main Street, Winnipeg, MB R3C 3G8, Canada

Ochratoxin A (OTA) is a fungal secondary metabolite. In areas with temperate climates (including Canada) OTA is produced in grain by Penicillium verrucosum. OTA is produced during storage, as opposed to in the field, as is the case with fusarium trichothecene mycotoxins such as deoxynivalenol. OTA shares a structural similarity to the essential amino acid phenylalanine, and affects the enzymes involved in the metabolism of phenylalanine. OTA is a relatively stable molecule and can accumulate in kidney, liver, muscle, and body fat. Health Canada has recently proposed maximum limits of 3 to 5 μg/kg for OTA in a number of cereal grains for human consumption. The Canadian Food Inspection Agency has recommended tolerance levels of 200 to 2000 μg/kg for swine and poultry diets. The analysis of OTA in grains is particularly challenging. There are no visible signs when grain is infected with P. verrucosum, nor when OTA is produced. OTA is generally present in grain at very low concentrations – in the low μg/kg range. It is also heterogeneously distributed, from one individual kernel or seed to the next as well as throughout a bulk sample of whole grain. The Canadian Grain Commission has been monitoring grain for OTA since the mid 1990s. Ongoing monitoring activities include the sampling of vessel loadings bound for export, as well as loadings from shipments across the Great Lakes. Much work has also been performed on developing adequate sampling protocols in order to minimize the effect of OTA's heterogeneity in whole grain on the variance of analytical results. Data generated by the Canadian Grain Commission's monitoring programs demonstrate that OTA is only infrequently detected in bulk lots of Canadian grain. OTA has been found more frequently in cereals than oilseeds or pulses, but the concentrations of OTA measured in cereals were not different than those observed in oilseeds and pulses. OTA has also been detected in western and eastern varieties of Canadian wheat, suggesting a widespread geographical occurrence of P. verrucosum and production of OTA. Overall, the majority of OTA quantified in samples have been below the maximum limits of OTA recently proposed by Health Canada.

Effect of cover crops as mulches in the development of diseases in Spaghetti squash. V. TOUSSAINT AND M. CIOTOLA. Horticulture Research and Development Centre, Agriculture and Agri-Food Canada, 430 Gouin Boulevard, Saint-Jean-sur-Richelieu, QC J3B 3E6, Canada

In a context of sustainable agriculture, the use of cover crops as mulches is gaining in popularity because it promotes soil conservation, increases microbial diversity and activity, reduces weed infestation and was reported to reduce the incidence of some plant diseases. In this study, the impact of cover crops as mulches on diseases of cucurbits was investigated. The study was conducted three times from 2008 to 2010 at the Agriculture and Agri-Food Canada experimental farm in Frelighsburg, QC. Cover crop plots, rye (Secale cereale L. ) and wheat (Triticum L.), were seeded in a randomized complete block design fashion the preceding fall. The other treatments were conventional tillage cropping (control) and dried mulch using wheat straw. In June, cover crops were destroyed using a roller crimper and herbicides when required. Spaghetti squash (Cucurbita pepo L.) seedlings were transplanted in the different treatments. Disease development, growth and yield were determined for each treatment. In 2008, the disease pressure was high and the percentage of healthy fruits was significantly higher for the rye and wheat treatments (P = 0.003; F = 13.096). The bacterial disease caused by Pseudomonas syringae van Hall and scab caused by Cladosporium cucumerinum Ellis & Arthur were significantly reduced. In 2009 and 2010, the disease pressure was low and the percentage of healthy fruit was equivalent in all treatments. For 2008 and 2009, the number of squash was equivalent in all treatments. In 2010, the number of squash was significantly lower in both rye and wheat treatments compared to the control (P = 0.03, F = 5.085) and the foliar analysis showed a N deficiency. In conclusion, cover crops can reduce the incidence of diseases in cucurbits; the next steps are to verify how the cover crops act as a disease control method by studying the impact on the microclimate, soil and plant microbiology and on the plant itself.

Relationships between plant phenology and the development of bacterial leaf spot of lettuce. V. TOUSSAINT, M. CIOTOLA, A. DALLIER, M. CADIEUX AND G. BOURGEOIS. Horticulture Research and Development Centre, Agriculture and Agri-Food Canada, 430 Gouin Boulevard, Saint-Jean-sur-Richelieu, QC J3B 3E6, Canada

In this study, the effect of the growth stage of lettuce (Lactuca sativa L.) on the development of the bacterial leaf spot caused by Xanthomonas campestris pv. vitians (Brown) Dye (Xcv) was investigated. In 2011, three trials were conducted under controlled conditions using a growth chamber equipped with a misting system. Growth stages were obtained by seeding plants (cv. ‘Paris Island Cos’) over time, once a week for 5 weeks for first and second trials and 4 weeks for the third one respectively. One week after the last seeding date, the number of leaves were recorded for each plant and then inoculated with a suspension of Xcv (strain B07-07) adjusted to 10⁸ CFU/mL. Plants were placed in conditions known to be conducive to disease development with a mist settled to spray fine droplets of water 20 s every 15 min. One week after inoculation, symptoms were rated for each leaf of each plant using the Horsfall-Barratt scale. Analysis of variance was conducted to compare disease incidence (percentage of affected leaves per plant) and the non-parametric Kruskall-Wallis test was used to compare disease severity for the different growth stages. The incidence did not significantly differ for the different growth stages amongst trials, but the severity of the affected leaves was higher on older plants than younger ones. The next steps to this study are to elucidate the mechanisms in the lettuce phenology that influence disease development.

Characterization of a virulence gene responsive to nitrogen stress in Fusarium graminearum . S. WALKOWIAK, W. LEUNG, A. JOHNSTON, L. HARRIS, C. RAMPITSCH AND G. SUBRAMANIAM. (S.W., W.L., A.J., L.H., C.R., G.S.) Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada; and (S.W., G.S.) Carleton University, 1125 Colonel-By Drive, Ottawa, ON K1S 5B6, Canada

Fusarium graminearum Schwabe is a broad range phytopathogen that infects a variety of economically important cereal crops in Canada. The fungus produces a mycotoxin, deoxynivalenol, a secondary metabolite that contributes to the spread of the fungus during infection and therefore acts as a virulence factor. The toxin accumulates in infected plants and appears in grain products after downstream processing; consumption of contaminated products causes vomiting and reduced appetite. Recent studies indicate that nitrogen availability and other environmental cues are important triggers for secondary metabolism and virulence, which is also true for deoxynivalenol biosynthesis. This study focuses on a regulatory gene Fg03881 which responds to nitrogen availability and is involved in virulence. Disruption of Fg03881 causes increased virulence of the pathogen in a susceptible variety of wheat ‘Roblin’. A high throughput assay was developed to assess various environmental cues that are required to activate Fg03881 expression. A transcription fusion of the promoter of Fg03881 and GFP was transformed into F. graminearum and was used in a 96 well plate reader system to identify compounds that modulate the promoter activity of Fg03881. Overall, results indicated that both preferred and complex sources of nitrogen strongly repressed the promoter activity, while non-preferred sources and reduced nitrogen had the opposite effect. Finally, comparative proteomics and gene expression profiling performed in the Fg03881 mutant identified genes involved in virulence.

Rapid detection and identification of five pathogens associated with tomato corky root rot by real-time PCR. K. WANG, G. PATTERSON, J. A. TRAQUAIR AND G. LAZAROVITS. A&L Biologicals, Agroecology Research Services Centre, 2136 Jetstream Road, London, ON N5V 3P5, Canada; and (J.A.T.) Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Standford Street, London, ON N5V 4T3, Canada

Early diagnosis of tomato corky root rot, a commercially important disease emerging in Ontario processing tomato production, is complicated and time consuming using traditional methods, since it is associated with five different pathogens including Fusarium oxysporum Schlecht. emend. Snyder and Hans., Colletotrichum coccodes (Wallr.) Hughes, Rhizopycnis vagum Farr, Pyrenochaeta terrestris (Hansen) Gorenz, and Pyrenochaeta lycopersici Schneider and Gerlach as well as their interactions. For the rapid and reliable detection and identification of these pathogens, oligonucleotide primers and probes were designed on the basis of alignment of internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) for a TaqMan real-time quantitative polymerase chain reaction (qPCR) assay. Specificity of species-specific primer pairs and probes was confirmed by using 15 different fungal pathogens. Under optimum conditions, the sensitivity of the qPCR assay was as little as 0.05 pg of target genomic DNA. The DNA standards and an internal control were also developed for quantification of these pathogens. The qPCR has been successfully used to detect and quantify pathogens present in soil and asymptomatic tomato roots. This technique provides an accurate, reliable and fast method for identification and quantification of pathogens associated with Ontario tomato corky root rot in etiological studies and in disease control strategies.

Identification and specific detection of Pectobacterium wasabiae associated with blackleg-like disease of potato. L. J. WARD, S. H. DE BOER AND X. LI. Charlottetown Laboratory, Canadian Food Inspection Agency. 93 Mount Edward Road, Charlottetown, PE C1A 5T1, Canada

Pectobacterium atrosepticum (van Hall) Gardan et al., the pathogenic bacterium usually associated with the potato blackleg, was readily detected in most potato stems with symptoms of the disease collected from commercial potato fields in Canada during 2007–2010. However, Pectobacterium wasabiae was identified as the sole or companion pectobacterial species detected in some symptomatic stems and tubers. Purported P. wasabiae isolates did not grow at 37 °C and did not produce reducing substances from sucrose or have phosphatase activity, but acid production from α-methylglucoside was variable. Sequence analyses of individual and concatenated housekeeping genes (acnA, gapA, icdA, mdh, pgi and proA) by a neighbour-joining algorithm sensu Ma et al. 2007 (Phytopathology 97:1150–1163) showed that on this basis these strains clearly grouped with the P. wasabiae clade which included the type strain of the species, a Japanese isolate from horseradish. A P. wasabiae-specific PCR test was designed based on the phytase gene which in blast analyses of Genbank data was shown to have only an 82–89% sequence similarity to analogous gene regions of P. atrosepticum and P. carotovorum, and only short segment similarities with the genome of Dickeya spp. In PCR using primers based on the phytase gene (PhF: GGTTCAGTGCGTCAGGAGAG; PhR: GCGGAGAGGAAGCGGTGAAG) a 100 bp species-specific amplification product was obtained at an annealing temperature of 62 °C. The sequences of cloned PCR products from seven Canadian P. wasabiae isolates were identical to the published sequence except for occasional deviation in the number of repeats in a repetitive TC region, which was probably due to sequencing errors common for such repetitive regions. Pathogenicity of P. wasabiae isolates on potato was confirmed by stem inoculation and tuber vacuum infiltration experiments conducted respectively, in the greenhouse and a growth chamber. By both methods symptoms induced by P. wasabiae were indistinguishable from those induced by P. atrosepticum.

High-throughput isolation of glyphosate-degrading bacteria from agricultural soil and monitoring degradation of glyphosate in bacteria-enriched soil using LC-MS/MS. X. YANG, K. WANG AND G. PATTERSON. A&L Biologicals, Agroecology Research Services Centre, 2136 Jetstream Road, London, ON N5V 3P5, Canada

Glyphosate, commonly known as Roundup, is the world's most extensively used herbicide in the control of grasses and herbaceous plants. This broad-spectrum herbicide can be systematically transferred throughout the plant after spray application on plant shoots, resulting in high levels of residues in food and animal feed or being released into the rhizosphere and bound onto soil particles. Glyphosate is not only poisonous to animals acutely and chronically, but is also detrimental to plants and environments through direct toxicity or indirectly altering microbial community dynamics or reducing micronutrient availability. To decontaminate soils and feeds contaminated with glyphosate, we developed a high-throughput method for isolation of bacterial strains from agricultural soil for efficient degradation of glyphosate herbicide. Twenty soil samples from different agricultural fields heavily polluted with glyphosate were initially screened for the presence of glyphosate-degrading bacteria by monitoring degradation level of glyphosate using LC-MS/MS. Glyphosate-degrading bacteria were then isolated based on LC-MS/MS analysis of pooled cultures on a selective medium with glyphosate as the sole phosphorus source from the identified soil. Further chemical characterizations associated with glyphosate degradation efficiency of the bacterial isolates are in progress.

Notes

¹This meeting was held jointly with Plant Canada in Halifax, Nova Scotia on 17–21 July, 2011.