2021 CPDS SECTION EDITORS AND ADDRESSES
INDEX – TITLES AND AUTHORS / TITRES ET AUTEURS
DIAGNOSTIC LABORATORIES / LABORATOIRES DIAGNOSTIQUES 10
V. Joshi & P. Berlakoti. Diseases/symptoms diagnosed on commercial crop samples submitted to the British Columbia Ministry of Agriculture (BCAGRI) Plant Health Laboratory in 2020 10
J.F. Elmhirst. Diseases diagnosed on ornamental, berry, potato and vegetable crops submitted to Elmhirst Diagnostics & Research in 2020 19
Q. Zhou, Y. Yang, H. Ahmed, Y. Wang, K. Zahr, H. Fu, A. Sarkes & J. Feng. Diseases/symptoms diagnosed on plant samples submitted to the Alberta Plant Health Lab (APHL) in 2020 22
M. Melzer & X. Shan. Diseases diagnosed on plant samples submitted to the Plant Disease Clinic, University of Guelph in 2020 26
T. Blauel & M.R. McDonald. Diagnoses on plant samples submitted to the Muck Crops Research Station Diagnostic Laboratory in 2020 35
A.-M. Breton, A. Dionne, D. Hamel, L. Pichette, N. Shallow & J. Vivancos. Maladies et problèmes abiotiques diagnostiqués sur les échantillons de plantes reçus en 2020 au Laboratoire d’expertise et de diagnostic en phytoprotection (LEDP) du MAPAQ 37
M.T. Tesfaendrias. Diseases diagnosed on plant samples submitted to the New Brunswick Department of Agriculture, Aquaculture and Fisheries, Plant Disease Diagnostic Laboratory in 2020 49
M.M. Clark & A. MacLeod. Diseases diagnosed on commercial crop samples submitted to the PEI Analytical Laboratories Plant Disease Diagnostic Services (PDDS) in 2019 52
M.M. Clark & A. MacLeod. Diseases diagnosed on commercial crop samples submitted to the PEI Analytical Laboratories Plant Disease Diagnostic Services (PDDS) in 2020 55
CEREALS / CÉRÉALES 59
T. Islam, E. Boots, D. Meyers & H.R. Kutcher. Leaf spot diseases of oat and barley in Saskatchewan in 2020 59
N.E. Rauhala & T.K. Turkington. 2020 barley disease survey in Central Alberta 61
H.W. Klein-Gebbinck & T.K. Turkington. 2020 barley disease survey in the South Peace region of Alberta 63
A.G. Xue & Y. Chen. Diseases of barley in Ottawa, Ontario in 2020 65
J.G. Menzies, A.G. Xue, C. Azar, S. Deceuninck, Z. Popovic, H. Derksen & J. Zhao. Crown rust of oat in Manitoba, Saskatchewan, Ontario and Quebec in 2019 68
A.G. Xue & Y. Chen. Diseases of oat in Ottawa, Ontario in 2020 70
M. Banik, A. Kirk, D. Kaminski, M. Beyene & X. Wang. Barley and oat leaf spot diseases in Manitoba, 2020 73
M. Banik, A. Kirk, D. Kaminski, M. Beyene & X. Wang. Barley and oat fusarium head blight in Manitoba, 2020 75
M.A. Henriquez, D. Kaminski, A. Kirk, J. Doherty, D. Miranda & O. Gruenke. Fusarium head blight of spring wheat and winter wheat in Manitoba in 2020 77
M.A. Henriquez, D. Kaminski, A. Kirk, J. Doherty, D. Miranda & O. Gruenke. Leaf spot diseases of spring wheat and winter wheat in Manitoba in 2020 79
B. McCallum, W. McNabb & E. Reimer. Leaf rust of wheat in Manitoba in 2020 81
T. Fetch, T. Zegeye & M. Penner. Stem rusts of cereals in Canada in 2020 82
M.R. Fernandez, L. Abdellatif, N. Waelchli, C. Kenny, F. Waelchli, A. Akhavan, C. Peru & S. Hartley. Leaf spotting diseases of common and durum wheat in Saskatchewan in 2020 83
A.G. Xue & Y. Chen. Diseases of spring wheat in Ottawa, Ontario in 2020 87
A.G. Xue & Y. Chen. Diseases of winter wheat in Ottawa, Ontario in 2020 90
E. Johnstone, R. Matters & A. Foster. Causal species of fusarium head blight of spring wheat and winter wheat in Prince Edward Island in 2020 92
S. Waterman & K. Xi. Wheat and barley leaf disease survey in Central Alberta, 2020 95
Y.X. Wang, K.F. Chang, R. Fredua-Agyeman, F. Capettini, S.F. Hwang & S.E. Strelkov. Cereal crop disease surveys in North-Central Alberta, 2020 97
R. Aboukhaddour, R. Gourlie, T. Despins, M. Harding, H.W. Klein-Gebbinck, J. Feng & B. McCallum. Stripe (yellow) rust of cereals in Alberta, 2020 99
J.G. Menzies, Z. Popovic, S. Deceuninck & H. Derksen. Cereal smut surveys in Manitoba, 2020 102
B. Olson, B. Ernst, S. Fatima, M. Japp, S. Junek, H.R. Kutcher, T. Prasad & J. Wenaus. Seed-borne fusarium on cereal crops in Saskatchewan in 2019 103
B.L. Puchalski & B.J. Puchalski. 2020 wheat disease survey in Southern Alberta 107
OILSEEDS, PULSES, FORAGES AND SPECIAL CROPS / OLÉAGINEUX, PROTÉAGINEUX, PLANTES FOURRAGÈRES ET CULTURES SPÉCIALES 109
M.W. Harding, G.C. Daniels, D.A. Burke, C.A. Pugh, T.B. Hill, K. Zahr, A. Sarkes & J. Feng. Canola and mustard disease survey in Alberta, 2020 109
S.E. Strelkov, V.P. Manolii, Y. Aigu, M.W. Harding, S.F. Hwang & G.C. Daniels. The occurrence and spread of clubroot on canola in Alberta in 2020 114
C.X. Yang, S.F. Hwang, K.F. Chang, E.R. Fredua-Agyeman & S.E. Strelkov. Soilborne pathogens of canola in Central and Northern Alberta in 2020 118
M.W. Harding, G.C. Daniels & D.A. Burke. Lentil disease survey in Southern Alberta, 2020 121
M.W. Harding, G.C. Daniels, D.A. Burke, R. Neeser-Carazo, K. Zahr, A. Sarkes, T. Dubitz, J. Feng, R. Bowness & S. Chatterton. A survey for pea diseases in Alberta, 2020 123
M.W. Harding, D.A. Burke & G.C. Daniels. A survey for soybean diseases in Alberta in 2020 127
Y.M. Kim, D.L. McLaren, D. Kaminski, S. Phelps, M.W. Harding, B.D. Gossen, C. Tkachuk, L. Schmidt, D. Lange, A. Farooq, S. Roberts, N. Clouson, A. Akhavan, C. Peru, T.L. Henderson, N.J. Vachon, W.C. Penner, G.C. Daniels & M.J. Thompson. Soybean root rot and phytophthora rot in western Canada in 2020 129
A. Akhavan, C. Peru, D. Cubbon, J. Giroyed, B. Esau, O. Darcy, C. Jacob, J. Ippolito, K. Kindrachuk, E. Campbell, S. Chant, S. Tetland, J. Peru, A. Noble, L. Cowell, C. Robinson, K. Stonehouse, S. Marcino, M. Brown, K. Anderson, K. Makohoniuk, J. Kwasnicki, C. Neuberger, C. Fennig, B. Johnson & L. Roszell. Survey of canola diseases in Saskatchewan, 2020 132
A. Akhavan, C. Peru, J. Ippolito, K. Kindrachuk, S. Chant, S. Tetland, M. Brown, S. Marcino, D. Risula, E. Campbell, K. Boere, K. Makohoniuk, J. Kwasnicki, C. Neuberger, C. Fennig & B. Johnson. 2020 survey of lentil diseases in Saskatchewan 137
A. Akhavan, C. Peru, J. Ippolito, K. Kindrachuk, E. Campbell, K. Boere, S. Chant, M. Brown, S. Marcino, D. Risula, S. Tetland, K. Makohoniuk, J. Kwasnicki, C. Neuberger, C. Fennig, L. Roszell & B. Johnson. 2020 survey of field pea diseases in Saskatchewan 141
B.D. Olson, S. Banniza, B. Ernst, S. Fatima, S. Junek, S. Phelps, T. Prasad, D. Risula & J. Wenaus. Seed-borne pathogens of pulse crops in Saskatchewan in 2019 144
A. Akhavan, C. Peru, C. Jacob, D. Risula, J. Kwasnicki, K. Makohoniuk, S. Marcino & S. Roberts. 2020 survey of soybean diseases in Saskatchewan 148
Y.M. Kim, D.L. McLaren, A. Hou, N. Vachon & W.C. Penner. Diseases of dry bean in Manitoba in 2020 150
D.L. McLaren, D. Kaminski, J. Graham, M. Pradhan, E. Bargen, A. Brackenreed, T. Buss, N. Clouson, J. Cornelsen, T. Cummer, A. Farooq, J. Frey, D. Froese, N. Hari, J. Heard, T. Henderson, N. Vachon, L. Kaskiw, I. Kristjanson, A. Kubinec, D. Lange, L. Mitchell, M. McCracken & R. Picard. Survey of canola diseases in Manitoba in 2020 152
K. Nabetani, T. Islam, H.R. Kutcher, M. Reza, C. Peru, M. Beaith, C. Jacob, S. Roberts, E. Campbell, J. Ippolito, M. Brown, S. Marcino, A. Bowditch & G. Kruger. Diseases of flax in Manitoba and Saskatchewan in 2020 156
D.L. McLaren, Y.M. Kim, T.L. Henderson, N.J. Vachon, S.F. Hwang, K.F. Chang, S. Chatterton, C. Tkachuk, L. Schmidt, N. Clouson, D. Lange & A. Farooq. Field pea diseases in Manitoba in 2020 158
VEGETABLES / LÉGUMES 161
M.W. Harding, T. Forge, J. Feng, G.C. Daniels, R. Neeser-Carazo, Q. Zhou, P. Munro & R.C.J. Spencer. A survey of onion and garlic diseases in Alberta in 2019 and 2020 161
C.J. Robertson, D.P. Yevtushenko, E. Snowdon & M.W. Harding. A survey of Helicotylenchus, Paratylenchus, Pratylenchus and Tylenchorhynchus nematodes in potato fields in Alberta, 2018 and 2019 166
V. Bisht, M. Tenuta & S. Graham. Incidence of verticillium wilt (V. dahliae) in potato in Manitoba, 2020 crop 169
FOREST TREES / ARBRES FORESTIERS 172
N. Feau, B. Van der Meer, W. Van der Linden, P. Herath, G. Bradley, N. Ukrainetz, H. Kope & R. Hamelin. Phytophthora root rot in western white pine seed orchards in British Columbia 172
J. Krakowski, R. Heinzelmann, T. Ramsfield, A. Benowicz, R. Hamelin & C. Myrholm. First report of Dothistroma septosporum on Pinus flexilis in Canada176
GENERAL CROP SURVEY / ENQUÊTE GÉNÉRALE SUR LES CULTURES 179
R. J. Howard & K. Ferris. An inaugural survey of cereal, oilseed and vegetable crop diseases in the Yukon territory in 2020 179
LIST OF FIGURES / LISTE DE FIGURES
Foliar disease progress curves for barley yellow dwarf (BYDV), net blotch (Pyrenophora teres) and spot blotch (Cochliobolus sativus) in barley fields in Ottawa, Ontario in 2020. Each point is the mean of three fields and three sites per field. Severities of these diseases were visually estimated on a scale of 0 to 9, six times during the growing season when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively 66
Foliar disease progress curves for barley yellow dwarf (BYDV), stagonospora leaf blotch (Stagonospora avenae f. sp. avenaria), halo blight (Pseudomonas syringae pv. coronafaciens), crown rust (Puccinia coronata f. sp. avenae), pyrenophora leaf blotch (Pyrenophora avenae), spot blotch (Cochliobolus sativus) and stem rust (Puccinia graminis f. sp. tritici) in oat fields in Ottawa, Ontario in 2020. Each point is the mean of three fields and three sites per field. The severity of these diseases was visually estimated on a scale of 0 to 9, six times during the growing season when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively 71
Soil zone map with common and durum wheat fields surveyed across Saskatchewan in 2020 84
Three-month (May 3-July 31) percentage of average precipitation for 2020 on the Canadian prairies. Normal precipitation is based on 1981-2010 (Agriculture and Agri-Food Canada, 2020) 86
Foliar disease progress curves for bacterial blight (Pseudomonas syringae pv. syringae), septoria/stagono-spora leaf blotch (Zymoseptoria tritici and Parastagonospora spp.), spot blotch (Cochliobolus sativus) and tan spot (Pyrenophora tritici-repentis) in spring wheat fields in Ottawa, Ontario in 2020. Each point is the mean of three fields and three sites per field. Severities of these diseases were visually estimated on a scale of 0 to 9, six times during the growing season when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively 88
Foliar disease progress curves for bacterial blight (Pseudomonas syringae pv. syringae), septoria/stagonospora leaf blotch (Septoria tritici and Stagonospora spp.), powdery mildew (Blumeria graminis f.sp. tritici), spot blotch (Cochliobolus sativus) and tan spot (Pyrenophora tritici-repentis) in winter wheat fields in Ottawa, Ontario in 2020. Each point is the mean of three fields and three sites per field. Severities of these diseases were visually estimated on a scale of 0 to 9, four times during the growing season when plants were at the heading, flowering, milk, and soft dough stages of growth, respectively 91
Google maps screen capture with sample locations indicated and provincial counties labeled 93
Locations of cereal fields surveyed for incidence and severity of stripe rust in southern Alberta, July 2020. Severity as percentage of leaf covered with stripes: green = 0%; yellow = <5%; orange = 5 to 15%; red = >15%. Incidence as estimated percentage of total field infected: small circle = <5%; circle with square = 5 to 15%; circle with diamond = >15% 101
Location and severity of blackleg symptoms in 350 canola fields and five mustard fields in 2020 110
Cumulative cases of clubroot diagnosed in canola crops in Alberta. Since the start of clubroot surveillance in 2003, the disease has been confirmed in 44 counties and municipal districts in the province, as well as in rural areas of the cities of Edmonton and Medicine Hat, and the Town of Stettler 116
Canola crop affected by severe root disease in lower lying areas of a field in Lacombe County, Alberta, in 2020 119
Diseased canola plants; note lodging, yellowing and senescence in the crop 120
Survey locations for Alberta’s 2020 pea disease survey 124
Main issues observed in Alberta pea fields in 2020: A, drowned low spot in pea field; B, mycosphaerella blight on pea leaves; C, ascochyta blight on pea leaves; D, rot of pea roots 125
Eight soybean disease survey locations in Alberta, 2020 128
Approximate locations of Alberta potato nematode field survey in 2018 and 2019 167
Visual grading scale (0-5) of verticillium wilt severity in potato stems (Alkher et al. 2009) 170
Western white pine mortality in BC seed orchards. A, early disease stage; B, bent needle symptom; C, roots and necrotic root tips on a dead tree; D, Agdia ImmunoStrip® test positive for Phytophthora spp. (2 red bands) on a soil sample collected at the Saanich Seed Orchard 173
Phytophthora cactorum isolates obtained from western white pine at the Saanich Seed Orchard and Kalamalka Research Station have different origins. The tree is a maximum-likelihood phylogenetic tree including P. cactorum isolates from the Saanich Seed Orchard and Kalamalka Research Station orchard (in red) and reference sequences for closest homologs retrieved in the NCBI database (in black, with Genbank accession number). Numbers above nodes are statistical support values obtained from 100 bootstrap samples; poor statistical support under 50% is not represented. Grey boxes indicate the alignment position of intraspecific polymorphisms in P. cactorum 174
A map of the Yukon Territory showing areas where crop production is concentrated. The 2020 crop disease survey was conducted in fields in the Whitehorse area 177
Northern range of P. flexilis (orange) and sample location (blue star) at the genetic archive in the Alberta Tree Improvement and Seed Centre, Smoky Lake. Google Earth imagery, 2021177
Severity of Dothistroma infection by species and year at Smoky Lake, Alberta by observation year180
DIAGNOSTIC LABORATORIES / LABORATOIRES DIAGNOSTIQUESDISEASES/SYMPTOMS DIAGNOSED ON COMMERCIAL CROP SAMPLES SUBMITTED TO THE BRITISH COLUMBIA MINISTRY OF AGRICULTURE, FOOD AND FISHERIES (BCMAFF), PLANT HEALTH LABORATORY IN 2020CROP: Commercial Crops – Plant Health Laboratory Report
LOCATION: British Columbia
NAMES AND AGENCY:
V. JOSHI & P. BURLAKOTI
Plant Health Laboratory, Plant and Animal Health Branch, B.C. Ministry of Agriculture, Food and Fisheries, Abbotsford Agriculture Centre, 1767 Angus Campbell Road, Abbotsford, BC V3G 2M3Telephone: (778) 666-0581; Facsimile: (604) 556-3010; E-mail: [email protected]Web page: https://www2.gov.bc.ca/gov/content/industry/agriculture-seafood/animals-and-crops/plant-health/plant-health-laboratory
ABSTRACT: The British Columbia Ministry of Agriculture, Food and Fisheries (BCMAFF), Plant Health Laboratory (PHL) provides diagnoses of diseases and disorders caused by fungi, bacteria, viruses, plant parasitic nematodes and insect pests of agricultural crops grown in British Columbia. The PHL also makes assessments on possible abiotic factors affecting plant health. Between January 1 and December 14, 2020, the PHL received 794 samples including Christmas trees, field crops, greenhouse vegetable and floriculture crops, forest nursery seedlings, herbaceous and woody ornamentals, small fruits, tree fruits, nuts, turfgrass and specialty crops for diagnosis. No significantly new or unusually high level of any disease was detected in the samples.
METHODS: The BCMAFF Plant Health Laboratory provides diagnoses for diseases caused by fungi, bacteria, viruses, plant parasitic nematodes, and insect pests of agricultural crops grown in British Columbia. Samples are submitted to the laboratory by ministry staff, growers, agri-business representatives, crop insurance personnel, municipalities and master gardeners. Crop categories comprising majority of the samples in 2020 included; field vegetables (26.57%) followed by berry crops (18.51%), woody ornamentals (17.12%), tree fruit and grape (7.43%) and forest nursery seedlings (6.29%). All other crops were from 0.5% to up to 5.0% of the total submissions. Diagnoses were accomplished by visual and microscopic examination, culturing onto microbial media, biochemical identification of bacteria using BIOLOG® and serological testing of viruses, fungi and bacteria with micro-well and membrane-based enzyme linked immuno-sorbent assay (ELISA). Molecular techniques (polymerase chain reaction (PCR)- conventional and/or real time) were used for some species-specific diagnoses. General primer PCRs (for fungi and bacteria) were followed by sequencing to identify the organism involved. Some specimens were referred to other laboratories for identification or confirmation of the diagnosis.
RESULTS AND COMMENTS: Overall in 2020, British Columbia had mild winter weather conditions in January followed by a severe cold snap in February. The long, mild spring was wet as is normal for B.C. and was followed by a short dry summer. The wet weather in the spring supported bacterial blights on woody ornamentals, tree fruits and berry crops. Fire blight incidence was higher than usually seen in tree fruit as well as woody ornamental crops. Summaries of diseases and their causal/associated agents diagnosed on crop samples submitted to the laboratory are presented in to , organized by crop category. Diagnoses not listed include abiotic disorders caused by suspected nutritional stress, pH imbalance, water stress, drought stress, adverse growing/cultural conditions, genetic abnormalities, environmental and chemical stresses including damage from herbicides, fruit abortion due to lack of pollination, insect-related injury, or damage where no conclusive causal factor was identified. More than one disease-causing agent was identified on many samples and are listed under individual disease/symptom. The frequency of diseases diagnosed in the lab does not reflect their prevalence in the field in B.C.
Table 1. Diseases/symptoms detected in Christmas tree samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 2. Diseases/symptoms detected in field crop samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 3. Diseases/symptoms detected in greenhouse floriculture samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 4. Diseases/symptoms detected in forest nursery samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 5. Diseases/symptoms detected in greenhouse vegetable samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 6. Diseases/symptoms detected in herbaceous perennial samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 7. Diseases/symptoms detected in nut samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 8. Diseases/symptoms detected in small fruit (berry) samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 9. Diseases/symptoms detected in specialty crop samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 10. Diseases/symptoms detected in tree fruit and grape samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 11. Diseases/symptoms detected in golf course, sod and lawn samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 12. Diseases/symptoms detected in field vegetable samples submitted to the BCMAFF Plant Health Laboratory in 2020
Table 13. Diseases/symptoms detected in woody ornamental samples submitted to the BCMAFF Plant Health Laboratory in 2020
DISEASES DIAGNOSED ON ORNAMENTAL, BERRY, POTATO AND VEGETABLE CROPS SUBMITTED TO ELMHIRST DIAGNOSTICS & RESEARCH IN 2020
CROP: Diagnostic Laboratory Report
LOCATION: British Columbia
NAME AND AGENCY:
J. F. ELMHIRST
Elmhirst Diagnostics & Research, 5727 Riverside St., Abbotsford, BC V4X 1T6Telephone: 604-832-9495; Email: [email protected]
ABSTRACT: Diseases of ornamental, berry and vegetable crops in south coastal British Columbia submitted to Elmhirst Diagnostics & Research in 2020 and their causal agents identified are listed. Parasitic nematodes extracted from soil samples submitted are listed also. Rainy weather throughout the months of May and June led to high levels of botrytis and downy mildew on many crops. No new diseases or causal agents were identified.
METHODS: Elmhirst Diagnostics & Research (EDR) provides diagnosis of diseases of commercial horticultural crops in British Columbia caused by fungi, bacteria, viruses, plant parasitic nematodes, arthropod and mite pests as well as abiotic factors. Laboratory diagnostic services are provided in conjunction with on-site diagnostic consultations. Diagnosis is performed primarily by association of known symptoms with the presence of a pathogen known to cause these symptoms and identified by microscopic examination. If further identification or confirmation is needed, fungal and bacterial pathogens are isolated in pure culture for further examination of morphological characteristics or plant tissue or cultured specimens are sent to other laboratories for identification by ELISA, PCR or DNA sequencing. Problems caused by abiotic factors such as nutrient or pH imbalance, water stress, physiological response to growing conditions, genetic abnormalities and environmental and chemical stresses including herbicide damage are not included. The frequency of diseases diagnosed does not reflect their prevalence in the field.
RESULTS AND COMMENTS: A summary of disease diagnoses and causal or associated agents on ornamental nursery and landscape crops is presented in , field vegetables in and berry crops in . Spring 2020 was cool and wet through to the end of June, resulting in a high level of botrytis blight and downy mildew on many crops. No new diseases or causal agents were identified. Verticillium dahliae and root lesion nematodes were recovered from soil in a potato crop with symptoms of early dying in the western Fraser Valley.
Table 1. Diseases diagnosed on ornamental nursery crops submitted to Elmhirst Diagnostics & Research in 2020
Table 2. Diseases diagnosed on field vegetable and potato samples submitted to Elmhirst Diagnostics & Research in 2020
Table 3. Diseases diagnosed on berry samples submitted to Elmhirst Diagnostics & Research in 2020
DISEASES/SYMPTOMS DIAGNOSED ON PLANT SAMPLES SUBMITTED TO THE ALBERTA PLANT HEALTH LAB (APHL) IN 2020
CROP: All Crops – Plant Health Laboratory Report
LOCATION: Alberta
NAMES AND AGENCIES:
Q. ZHOU, Y. YANG, H. AHMED, Y. WANG, K. ZAHR, H. FU, A. SARKES & J. FENG
Alberta Plant Health Lab, Alberta Agriculture and Forestry, Edmonton, AB T5Y 6H3Telephone: 780-644-3436; E-mail: [email protected]
ABSTRACT: The Alberta Plant Health Lab (APHL) provides plant pest diagnosis and expertise to Alberta’s agricultural industry. The lab accepts samples exclusively from agricultural fieldmen, academic institutions, applied research associations and municipal pest management departments, at no cost. A total of 393 samples were processed for diagnosis in year 2020. Dutch elm disease was identified in one elm tree sample. There was a substantial increase in conifer samples diagnosed with needle cast pathogens. No fusarium head blight caused by Fusarium graminearum was detected in cereals except one corn sample. Seedling blight and clubroot was detected in canola samples. Fire blight was detected in raspberry and cotoneaster.
METHODS: Samples were submitted to APHL by Agricultural Fieldsmen, academic institutions, applied research associations and municipal pest management departments. Diagnoses were based on a combination of visual examination of symptoms and signs, microscopic observation, culturing on artificial media, PCR/qPCR, DNA barcoding and use of commercial diagnostic kits. Fungal barcoding was performed by sequencing DNA fragments of internal transcribed spacers (ITS) (White et al. 1990) and/or elongation factor −1α (EF1) (Stielow et al. 2015) and/or β-tubulin (Stukenbrock et al. Citation2012). Bacteria were usually identified based on DNA sequencing of 16S ribosomal RNA gene (Klindworth et al. Citation2013) and/or cpn60 (Links et al. Citation2012). The diagnosis of new clubroot pathotype of P5-like was done according to Zhou et al. (Citation2018). PCR identification of Fusarium graminearum from submitted cultures was performed following Zuzak et al. (Citation2018). For identification of Fusarium species from plant tissues, protocols described by Demeke et al. (Citation2005) were used. Phytoplasmas were detected by PCR using the primer pairs P1/Tint and R16MF2n/R16MR2n (Smart et al. 1996). Confirmation of late blight on potato and tomato was done using the Agdia ImmunoStrip® kit for Phytophthora species (http://www.agdia.com). For diagnosis of all other diseases, when PCR techniques were used, quantitative PCR (qPCR) preceded conventional PCR and probe-based qPCR preceded SYBR® Green-based qPCR. The primers and protocols were chosen from the most recent literature and verified by APHL using positive and negative controls.
RESULTS AND COMMENTS: A total of 393 samples were processed for disease diagnosis between January 1 and October 30, 2020. The samples received for diagnosis included cereals (12.2%), canola (5.1%), potato (30.3%), legumes (6.6%), trees and fruits (37.7%), vegetables (2.8%) and others (5.3%). The category ‘others’ included Canada thistle, unknown grass, hawkweed, hemp and strawberry. Pathogens associated with disease samples comprised fungi, oomycetes, protists, bacteria and viruses. More than one potential causal agent was identified in most samples. Summaries of symptoms and associated pathogens diagnosed are provided in to by crop category.
Table 1. Diseases diagnosed on cereal crop samples submitted to the Alberta Plant Health Lab in 2020
Table 2. Diseases diagnosed on canola samples submitted to the Alberta Plant Health Lab in 2020
Table 3. Diseases diagnosed on potato samples submitted to the Alberta Plant Health Lab in 2020
Table 4. Diseases diagnosed on legume samples submitted to the Alberta Plant Health Lab in 2020
Table 5. Diseases diagnosed on trees and fruits submitted to the Alberta Plant Health Lab in 2020
Table 6. Diseases diagnosed on vegetable crops submitted to the Alberta Plant Health Lab in 2020
Table 7. Diseases diagnosed on other crops submitted to the Alberta Plant Health Lab in 2020
Fusarium species were commonly isolated from various cereal crops (). However, no F. graminearum was isolated from any except one sample of corn. In addition, Parastagonospora nodorum, Pyrenophora tritici-repentis, Gaeumannomyces graminis, Microdochium spp. and Ustilago nuda, the causal organisms, respectively, of take-all, tan spot, leaf blotch, leaf blight and loose smut disease, were also observed.
Four canola samples were infected with the clubroot pathogen, Plasmodiophora brassicae (). Two of those samples were confirmed to be a new pathotype P5x of P. brassicae. No sample tested positive for Leptosphaeria maculans or L. biglobosa. Root rots caused by Fusarium spp., Pythium spp. and Rhizoctonia solani were observed in 12 canola samples.
A batch of 85 potato samples was received to test for sour rot (Geotrichum sp.) (). Nine samples were positive for sour rot. Four samples were tested for blackleg (Pectobacterium spp. and Dickeya dianthicola) and results were all negative. However, powdery scab (Spongospora subterranea), common scab (Streptomyces turgidiscabies), root rot (Colletotrichum spp.), and black scurf (Rhizoctonia solani) were identified. Five samples were infected with a phytoplasma.
Fusarium spp., Pythium spp. and Rhizoctonia solani were common in legume crops, causing root rot, seedling blight and leaf spot diseases (). Three lentil and five pea samples were positive for root rot caused by the oomycete Aphanomyces euteiches. Bacterial blight caused by Pseudomonas syringae was also found in pea and bean samples.
Thirty-nine elm samples were submitted for Dutch elm disease (DED) diagnosis, and one of them tested positive (). This was the first report on the occurrence of DED on an elm tree in Alberta. Seven samples with DED-like symptoms were found to have a Cytospora canker, four were infected with Verticillium dahliae and two with Fusarium spp. Bacillus megaterium, a wide-spread, non-pathogenic bacterium, was detected in four elm samples. All of the other samples were infected with Plenodomus tracheiphilus, based on the results of fungal isolation followed by DNA barcoding of both ITS and EF1. Plenodomus tracheiphilus is the pathogen causing a devastating disease of citrus named ‘mal secco’. A pathogenicity test of this pathogen to elm is warranted.
Sydowia polyspora, the causal agent of needle cast and needle blight was identified in 33 spruce, five pine and two fir samples. This pathogen is also associated with tip dieback of conifers. Cytospora canker caused by Cytospora spp. was found on elm, spruce, poplar, and saskatoon berry samples. Fire blight caused by Erwinia amylovora was detected in raspberry and cotoneaster samples. Alternaria spp. were commonly detected on conifer needles (9 samples), willow (2), saskatoon berries (5), poplar (1), and apple (3). Botrytis spp. were detected on samples of saskatoon berry, apple, maple and mountain ash.
A few Fusarium species were associated with root malformation in Chinese cabbage (). Alternaria spp. were found causing leaf spots on beet and early blight on tomato. Geotrichum spp. was found on carrot causing root rot. The blackleg pathogen, Leptosphaeria biglobosa, was isolated from mustard. Phytophthora spp. were associated with root rot of cucumber.
Nineteen Canada thistle samples with a distinct bleached or white color of the shoot or rust symptoms were received for diagnosis (). Eleven thistle samples were infected with Pseudomonas spp., six samples were infected with Phoma spp., and two samples with rust disease were infected with Puccinia punctiformis. An Alternaria sp. was found causing leaf spot of hawkweed. Five strawberry samples with fruit rot were infected with Botrytis spp. and Phytophthora spp.
REFERENCES
- Demeke T, Clear RM, Patrick SK, Gaba D. 2005. Species-specific PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis. Int J Food Microbiol. 103(3):271–284. doi:https://doi.org/10.1016/j.ijfoodmicro.2004.12.026
- Klindworth A, Pruesse E, Schweer T, Peplies J, Quast C, Horn M, Glöckner FO. 2013. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41(1):e1. doi:https://doi.org/10.1093/nar/gks808
- Links MG, Dumonceaux TJ, Hemmingsen SM, Hill JE, Neufeld J. 2012. The chaperonin-60 universal target is a barcode for bacteria that enables de novo assembly of metagenomic sequence data. PLoS One 7(11):e49755. doi:https://doi.org/10.1371/journal.pone.0049755
- Smart CD, Schneider B, Blomquist CL, Guerra LJ, Harrison NA, Ahrens U, Lorenz KH, Seemüller E, Kirkpatrick BC. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S–23S rRNA spacer region. Appl Environ Microbiol. 62(8):2988–2993. doi:https://doi.org/10.1128/aem.62.8.2988-2993.1996
- Stielow JB, Lévesque CA, Seifert KA, Meyer W, Irinyi L, Smits D, Renfurm R, Verkley GJ, Groenewald M, Chaduli D, et al. 2015. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes. Persoonia 35(1):242–263.
- Stukenbrock EH, Quaedvlieg W, Javan-Nikhah M, Zala M, Crous PW, McDonald BA. 2012. Zymoseptoria ardabiliae and Z. pseudotritici, two progenitor species of the septoria tritici leaf blotch fungus Z. tritici (synonym: Mycosphaerella graminicola). Mycologia 104(6):1397–1407. doi:https://doi.org/10.3852/11-374
- White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innes MA, Gelfand DH, Sninsky JJ, White TJ (editors). PCR protocols: a guide to methods and applications. San Diego (CA): Academic Press; 315–322.
- Zhou Q, Hwang SF, Strelkov SE, Fredua-Agyeman R, Manolii VP. 2018. A molecular marker for the specific detection of new pathotype 5-like strains of Plasmodiophora brassicae in canola. Plant Pathol. 67(7):1582–1588. doi:https://doi.org/10.1111/ppa.12868
- Zuzak K, Zahr K, Yang Y, Sarkes A, Feindel D, Daniels G, Harding MW, Feng J. 2018. A duplex PCR method for identification of cultures of Fusarium graminearum from infected wheat grain without DNA extraction. Can J Plant Pathol. 40(3):417–422. doi:https://doi.org/10.1080/07060661.2018.1481885
DISEASES DIAGNOSED ON PLANT SAMPLES SUBMITTED TO THE PLANT DISEASE CLINIC, UNIVERSITY OF GUELPH IN 2020
CROPS: Commercial Crops – Diagnostic Laboratory Report
LOCATION: Ontario
NAMES AND AGENCY:
M. MELZER & X. SHAN
Plant Disease Clinic, Laboratory Services Division, University of Guelph, 95 Stone Road W, Guelph, ON N1H 8J7Telephone: (519) 823-1268; Facsimile: (519) 767-6240; Email: [email protected]Web page: www.guelphlabservices.com
ABSTRACT: Diseases and their causal agents diagnosed on plant samples received by the Plant Disease Clinic, University of Guelph in 2020 are summarized in this report. Samples included greenhouse vegetables, annual and perennial ornamental plants, field crops, berry crops, tree fruits, turfgrass and trees.
METHODS: The Plant Disease Clinic of the University of Guelph provides plant pest diagnostic services to growers, agri-businesses, provincial and federal governments and the general public across Canada. Services include plant disease diagnosis, plant parasitic nematode identification and enumeration, pathogen detection from soil and water, and insect identification. The following data are for samples received by the laboratory for disease diagnosis in 2020. Diagnoses were accomplished using microscopic examination, culturing on artificial media, biochemical identification of bacteria using BIOLOG®, enzyme linked immunosorbent assay (ELISA), polymerase chain reaction (PCR) based techniques including DNA multiscan®, PCR and RT-PCR, and DNA sequencing.
RESULTS AND COMMENTS: In 2020, from January 1 to December 31, the Plant Disease Clinic received samples including approximately 95 plant genera for disease diagnosis. Results are presented in to . For various reasons, the frequency of diseases diagnosed on samples submitted to the laboratory does not reflect the prevalence of diseases of various crops in the field. Problems caused by plant parasitic nematodes, insects and abiotic factors are not listed. Most diseases identified in 2020 are commonly diagnosed on the respective plant hosts.
Table 1. Diseases diagnosed on vegetable samples (including greenhouse vegetables) submitted to the University of Guelph Plant Disease Clinic in 2020
Table 2. Diseases diagnosed on fruit samples submitted to the University of Guelph Plant Disease Clinic in 2020
Table 3. Diseases diagnosed on herbaceous ornamental samples submitted to the University of Guelph Plant Disease Clinic in 2020
Table 4. Plant diseases diagnosed on woody ornamental samples submitted to the University of Guelph Plant Disease Clinic in 2020
Table 5. Diseases diagnosed on field crop samples submitted to the University of Guelph Plant Disease Clinic in 2020
Table 6. Diseases diagnosed on herb and specialty crop samples submitted to the University of Guelph Plant Disease Clinic in 2020
DIAGNOSES ON PLANT SAMPLES SUBMITTED TO THE MUCK CROPS RESEARCH STATION DIAGNOSTIC LABORATORY IN 2020
CROP: Diagnostic Laboratory Report
LOCATION: Bradford/Holland Marsh, Ontario
NAME AND AGENCY:
T. BLAUEL & M.R. MCDONALD
Muck Crops Research Station, Dept. of Plant Agriculture, University of Guelph, 1125 Woodchoppers Lane, King ON L7B 0E9Telephone: (905) 775-3783; E-mail: [email protected]; Website: www.uoguelph.ca/muckcrop/
ABSTRACT: The Integrated Pest Management (IPM) program provided by the Muck Crops Research Station (MCRS) offers diagnostic services to support the vegetable growers of the Holland Marsh and surrounding area. In 2020, 58 plant samples were submitted to the diagnostic laboratory for identification and management recommendations. Samples submitted to the lab showed symptoms associated with infectious disease (72%) and abiotic disorders (28%).
INTRODUCTION AND METHODS: In addition to the scouting and forecasting services provided by the Integrated Pest Management (IPM) program, the diagnostic laboratory at the Muck Crops Research Station (MCRS) provides diagnostic services and management recommendations for plant diseases, insect feeding damage, abiotic disorders and weeds to vegetable growers in and around the Holland Marsh. In 2020, plant samples were submitted to the MCRS diagnostic laboratory by growers, IPM scouts and industry representatives. Diagnosis of plant symptoms and issues involved visual and microscopic assessment and culturing of pathogens on growth media.
RESULTS AND DISCUSSION: The MCRS diagnostic laboratory received 58 samples between May 18 and October 30, 2020. Of these, 72% were diagnosed with infectious diseases and 28% were diagnosed with an abiotic disorder. The percentage of total samples submitted comprising each crop is as follows: carrot (52%), onion (33%), celery (10%) and other crops (5%). A lower number of diagnostic samples may have been submitted to the MCRS this year because entrance to the station required an appointment (response to COVID-19 public health concerns and restrictions) compared to an open-door policy in previous years. The 2020 growing season began with large temperature fluctuations during planting starting with low temperatures in early May resulting in some frost damage, which changed to high temperatures later in the month, resulting in heat canker. The Holland Marsh received a large amount of rain in early August which flooded low areas in fields and may have contributed to the development of cavity spot (Pythium spp.). This disease was common in carrots at harvest throughout the marsh. Similar to previous years, botrytis leaf blight and downy mildew of onions were not identified in onion fields in 2020 although spores of both pathogens were detected in spore trapping. Diseases and disorders diagnosed on crop samples submitted to the MCRS diagnostic laboratory in 2020 are presented in .
Table 1. Disease/symptoms detected in samples submitted to the MCRS diagnostic laboratory in 2020
ACKNOWLEDGEMENTS: Funding was provided in part by the Bradford Cooperative Storage Ltd., agrochemical companies and growers participating in the Muck Crops Research Station IPM program.
MALADIES ET PROBLÈMES ABIOTIQUES DIAGNOSTIQUÉS SUR LES ÉCHANTILLONS DE PLANTES REÇUS EN 2020 AU LABORATOIRE D’EXPERTISE ET DE DIAGNOSTIC EN PHYTOPROTECTION (LEDP) DU MAPAQ
CULTURES: Échantillons reçus en 2020 au Laboratoire d’expertise et de diagnostic en phytoprotection (LEDP) regroupant de nombreuses cultures
RÉGION: Québec
NOMS ET ORGANISME:
A.-M. BRETON, A. DIONNE, D. HAMEL, L. PICHETTE, N. SHALLOW & J. VIVANCOS
Laboratoire d’expertise et de diagnostic en phytoprotection (LEDP), ministère de l’Agriculture, des Pêcheries et de l’Alimentation du Québec (MAPAQ), Complexe scientifique, 2700, rue Einstein, D.1-200h, Québec, QC G1P 3W8Téléphone: (418) 643-5027, poste 2700; Télécopieur: (418) 646-6806; Courriel: [email protected]; [email protected]Sites Internet: http://www.mapaq.gouv.qc.ca/fr/Productions/Protectiondescultures/diagnostic/Pages/diagnostic.aspxhttp://www.agrireseau.qc.ca/lab/
RÉSUMÉ: Malgré les deux périodes de confinement dues à la pandémie mondiale, la quantité d’échantillons reçue est restée dans les mêmes proportions que les années précédentes. Du 1er janvier au 27 octobre 2020, Citation2020 échantillons ont été traités par la section phytopathologie du LEDP. En ordre d’importance, les échantillons reçus comprennent des plantes maraîchères (serres et champs), des arbres et arbustes fruitiers, des petits fruits, des grandes cultures/céréales, des plantes à usage industriel, des plantes ornementales herbacées, des plantes fourragères, des arbres et arbustes ornementaux (serres et pépinières) ainsi que des plantes aromatiques et médicinales.
MÉTHODES: Le Laboratoire d’expertise et de diagnostic en phytoprotection du MAPAQ offre un service de diagnostic des maladies parasitaires aux conseillers agricoles, aux producteurs, aux particuliers et aux instances gouvernementales. Les données présentées ci-dessous concernent les maladies identifiées sur les échantillons de plantes reçus en 2020. Les échantillons reçus font d’abord l’objet d’un examen visuel suivi généralement d’un examen au stéréomicroscope et au microscope photonique. Selon les symptômes, un ou plusieurs tests diagnostiques sont réalisés dans le but de détecter ou d’identifier l’agent ou les agents phytopathogène(s).
Voici les principaux tests de laboratoire réalisés afin d’appuyer le diagnostic: Les nématodes vermiformes sont extraits du sol et des tissus végétaux par la méthode de l’entonnoir de Baermann tandis que les nématodes à kystes sont extraits du sol à l’aide d’un appareil de Fenwick. Leur identification (le genre et lorsque c’est possible, l’espèce) est réalisée par un examen microscopie des caractères morphologiques et par des techniques de biologie moléculaire. Les champignons sont isolés sur des milieux de culture gélosés, identifiés selon leurs caractéristiques morphologiques et/ou par le séquençage de certains gènes. Certaines espèces de champignons sont détectées directement de la plante par des outils de biologie moléculaire (PCR, qPCR). Les bactéries sont isolées sur des milieux de culture gélosés puis identifiées à l’aide de tests biochimiques BiologR et/ou par le séquençage de certains gènes. Comme pour les champignons, certaines espèces de bactéries sont détectées directement de la plante par des outils de biologie moléculaire (PCR, qPCR). Les phytoplasmes sont détectés par des techniques de biologie moléculaire (PCR nichée et séquençage d’ADN). Les virus, quant à eux, sont détectés par des tests sérologiques ELISA, ou par RT-PCR, PCR ou RT-qPCR.
RÉSULTATS ET DISCUSSIONS: Les à présentent le sommaire des maladies identifiées sur les échantillons de plantes reçues, quelle que soit leur origine (champ, serre ou entrepôt). Notez que le nombre de maladies rapportées ne correspond pas au nombre d’échantillons réellement reçus et traités durant l’année puisque (1) plus d’un problème peut être identifié sur un même échantillon (plante reçue), (2) le diagnostic de certains cas n’a pas été inclus dans ce rapport comme les causes indéterminées, les causes incertaines/hypothétiques, les détections négatives ou lorsque ces données pourraient être nominatives. Étant donné que les problèmes abiotiques (= problèmes non parasitaires) diagnostiqués sur les échantillons sont, en majorité, de nature hypothétique, ils ont rarement été cités dans ce rapport; ces diagnostics sont établis en fonction de l’observation des symptômes, du résultat de certains tests de laboratoire et d’informations obtenues à la suite de discussions avec le client.
Tableau 1. Sommaire des maladies diagnostiquées parmi les plantes maraîchères reçues au Laboratoire d’expertise et de diagnostic en phytoprotection du MAPAQ en 2020
Tableau 2. Sommaire des maladies diagnostiquées parmi les arbres fruitiers et petits fruits reçus au Laboratoire d’expertise et de diagnostic en phytoprotection du MAPAQ en 2020
Tableau 3. Sommaire des maladies diagnostiquées parmi les grandes cultures/céréales et cultures industrielles reçues au Laboratoire d’expertise et de diagnostic en phytoprotection du MAPAQ en 2020
Tableau 4. Sommaire des maladies diagnostiquées parmi les plantes fourragères reçues au Laboratoire d’expertise et de diagnostic en phytoprotection du MAPAQ en 2020
Tableau 5. Sommaire des maladies diagnostiquées parmi les arbres et arbustes ornementaux reçus au Laboratoire d’expertise et de diagnostic en phytoprotection du MAPAQ en 2020
Tableau 6. Sommaire des maladies diagnostiquées parmi les plantes herbacées ornementales reçues au Laboratoire d’expertise et de diagnostic en phytoprotection du MAPAQ en 2020
Tableau 7. Sommaire des maladies diagnostiquées parmi les plantes aromatiques et médicinales reçues au Laboratoire d’expertise et de diagnostic en phytoprotection du MAPAQ en 2020
REMERCIEMENTS: Les auteurs remercient Marion Berrouard, Annie Guérin, Dominic Lafleur, Kariane Pouliot, Chantal Malenfant, Carolle Fortin et Annie-Pier Hachey pour leur support technique ainsi que les étudiants Jaëlle Falardeau, Paul-Émile Gareau, Carlos-Mario Jimenez et India-Jane Tremblay.
DISEASES DIAGNOSED ON PLANT SAMPLES SUBMITTED TO THE NEW BRUNSWICK DEPARTMENT OF AGRICULTURE, AQUACULTURE AND FISHERIES, PLANT DISEASE DIAGNOSTIC LABORATORY IN 2020
CROP: Diagnostic Laboratory Report
LOCATION: New Brunswick
NAME AND AGENCY:
M.T. TESFAENDRIAS
New Brunswick Department of Agriculture, Aquaculture and Fisheries, 1350 Regent Street, Fredericton, NB E3C 2G6Telephone: (506) 453-3478; Facsimile: (506) 453-7978; E-mail: [email protected]
ABSTRACT: The New Brunswick Department of Agriculture, Aquaculture and Fisheries (NBDAAF) Plant Disease Diagnostic Laboratory provides diagnostic services and disease management recommendations to growers and the agricultural industry in New Brunswick. In 2020, a total of 105 plant tissue samples were submitted to the diagnostic laboratory for problem identification and possible control recommendations.
INTRODUCTION AND METHODS: The NBDAAF Plant Disease Diagnostic Laboratory located in Fredericton, New Brunswick (NB) provides diagnostic services and control recommendations for diseases of various crops to growers and the agricultural industry in New Brunswick as part of an integrated pest management (IPM) service. Samples are submitted to the diagnostic laboratory by IPM scouts, growers, agribusiness representatives, crop insurance agents and NBDAAF crop specialists and extension officers. Disease diagnoses are based on a combination of visual examination of symptoms, microscopic observations and culturing onto growth media.
RESULTS AND COMMENTS: From May 20 to November 30, 2020, the Plant Disease Diagnostic Laboratory received 105 diseased plant samples for diagnosis. Samples diagnosed during scouting and field visits are not included in this report. Summaries of diseases and causal agents diagnosed on plant tissue samples submitted to the NBDAAF Plant Disease Diagnostic Laboratory in 2020 are presented in to by crop category.
Table 1. Diseases diagnosed on fruit tree crop samples submitted to the NBDAAF Plant Disease Diagnostic Laboratory in 2020
Table 2. Diseases diagnosed on berry crop samples submitted to the NBDAAF Plant Disease Diagnostic Laboratory in 2020
Table 3. Diseases diagnosed on vegetable (field and greenhouse) crop samples submitted to the NBDAAF Plant Disease Diagnostic Laboratory in 2020
Table 4. Diseases diagnosed on cereal crop samples submitted to the NBDAAF Plant Disease Diagnostic Laboratory in 2020
Table 5. Diseases diagnosed on trees, shrubs and ornamental plant samples submitted to the NBDAAF Plant Disease Diagnostic Laboratory in 2020
DISEASES DIAGNOSED ON COMMERCIAL CROP SAMPLES SUBMITTED TO THE PEI ANALYTICAL LABORATORIES PLANT DISEASE DIAGNOSTIC SERVICE (PDDS) IN 2019
CROP: Diagnostic Laboratory Report – All Crops
LOCATION: Prince Edward Island
NAMES AND AGENCY:
M. M. CLARK1 & A. MACLEOD2
1PEI Department of Agriculture and Land, PEI Analytical Laboratories, Plant Disease Diagnostic Laboratory, 23 Innovation Way, Charlottetown, PE C1E 0B7Telephone: (902) 368-5261; Facsimile: (902) 368-6299; Email: [email protected]
2PEI Department of Environment, Water and Climate Change, PEI Analytical Laboratories, 23 Innovation Way, Charlottetown, PE C1E 0B7Web page: https://www.princeedwardisland.ca/en/information/agriculture-and-land/pei-analytical-laboratories-peial
ABSTRACT: The Prince Edward Island Department of Agriculture and Land Plant Disease Diagnostic Laboratory section of PEI Analytical Laboratories provides diagnosis of disease problems caused by fungi, bacteria, viruses and plant insect pests of commercial crops produced on PEI. A total of 145 samples were processed for the 2019 crop year.
METHODS: Samples for disease diagnosis are submitted to the PDD laboratory by agriculture extension staff, researchers, producers, growers, agri-business representatives, crop insurance agents and the general public. Diagnoses are based on a combination of investigative work, visual examination of symptoms, microscopic observation and culturing onto artificial media. Typically, one or more causal agents was identified and confirmed as required.
RESULTS: A total of 273 disease diagnoses were completed on 145 samples processed during the period of May 13 to October 23, 2019. A summary of diseases diagnosed per crop for samples submitted in 2019 is provided in . The diagnoses reported may not necessarily reflect the major disease problems encountered during the season, but rather those most prevalent within the samples submitted.
Table 1. Summary of diseases diagnosed on commercial crop samples submitted to the PEI Analytical Laboratories, Plant Disease Diagnostic Service in 2019
Categories of samples received were potatoes (68.03%), cole crops (6.69%), other vegetables (3.35%), cereal crops (3.35%), fruit crops (17.47%), and other crops (1.12%).
No potato late blight foliar infections were observed this season due to the low level of inoculum and growers’ vigilance with good management practices, including appropriate protectant fungicide scheduling and spore trapping surveillance. Potato blackleg infections increased this season. Blackleg is primarily a seed-borne disease that can spread under, warm, moist conditions. The potato varieties affected were ‘Electra’, ‘Innovator’, ‘Labella’, ‘Russet Burbank’, ‘Abbott’, ‘Satina’ and ‘Melody’, and the bacterial blackleg isolates involved were Pectobacterium sp. and P. parmentieri. The P. parmentieri identification was confirmed by Dr. Sean Li and Dr. Jingbai Nie, Canadian Food Inspection Agency (CFIA), Charlottetown, PE. This P. parmentieri isolate can cause symptoms of blackleg and soft rot in potato tubers. These diseases are usually a consequence of latent infection of seed potatoes. Early dying syndrome (EDS) and rhizoctonia stem canker continued to be a problem in potatoes, especially when the plants were grown under drought conditions. Some of the fungal organisms involved included Verticillium, Fusarium graminearum, Fusarium oxysporum, Fusarium solani, Rhizoctonia solani and Colletotrichum. This disease is exacerbated by the presence of the root lesion nematode, Pratylenchus penetrans.
In May 2019, the PEI Plant Disease Diagnostic Laboratory was involved in a Sudden Apple Decline (SAD) regional research survey (results not included in ). Some of the fungal pathogens identified in the disease complex included Botryosphaeria sp., Phomopsis sp. and Paraconiothyrium brasiliense. This disease complex is due to a combination of synergistic causal pathogens and abiotic factors depending on the geographic area, the age of the trees and the rootstock. Symptoms progressed very quickly, with complete death of the tree in a few weeks.
A wilt disease was found in brown mustard and the fungal pathogen involved was Fusarium oxysporum. This Fusarium species was also identified in potato and pea crops. A root rot disease was identified in hemp and the fungus involved in this species complex was Fusarium tricinctum.
Isolations from highbush blueberry stems demonstrated the biodiversity of fungi in this crop and included Ceuthospora sp./Phacidium sp. and Cytospora sp./Valsa sp. (not included in ). The identification of Fusarium tricinctum, Paraconiothyrium brasiliense, Ceuthospora sp./Phacidium sp. and Cytospora sp./Valsa sp. was confirmed by Dr. Rafik Assabgui, National Fungal Identification Service (NFIS), Agriculture & Agri-Food Canada (AAFC), Ottawa, ON. One case of Dutch Elm Disease was confirmed in Montague, PEI.
DISEASES DIAGNOSED ON COMMERCIAL CROP SAMPLES SUBMITTED TO THE PEI ANALYTICAL LABORATORIES PLANT DISEASE DIAGNOSTIC SERVICE (PDDS) IN 2020
CROP: Diagnostic Laboratory Report – All Crops
LOCATION: Prince Edward Island
NAMES AND AGENCIES:
M. M. CLARK1 & A. MACLEOD2
1PEI Department of Agriculture and Land, PEI Analytical Laboratories, Plant Disease Diagnostic Laboratory, 23 Innovation Way, Charlottetown, PE C1E 0B7Telephone: (902) 368-5261; Facsimile: (902) 368-6299; Email: [email protected]
2PEI Department of Environment, Water and Climate Change, PEI Analytical Laboratories, 23 Innovation Way, Charlottetown, PE C1E 0B7Web page: https://www.princeedwardisland.ca/en/information/agriculture-and-land/pei-analytical-laboratories-peial
ABSTRACT: The Plant Disease Diagnostic (PDD) Laboratory section of PEI Analytical Laboratories, Prince Edward Island Department of Agriculture and Land, provides diagnosis of disease problems caused by fungi, bacteria, viruses, and plant and insect pests of commercial crops produced on PEI. A total of 135 samples were processed for the 2020 crop year.
METHODS: Samples for disease diagnosis are submitted to the PDD laboratory by agriculture extension staff, researchers, producers, growers, agri-business representatives, crop insurance agents, and the general public. Diagnoses are based on a combination of investigative work, visual examination of symptoms, microscopic observations and culturing onto artificial media. Typically, one or more causal agents was identified and confirmed.
RESULTS: A total of 256 disease diagnoses were completed on a total of 135 samples processed during the period of June 6 to October 30, 2020. A summary of the diseases diagnosed per crop on samples submitted in 2020 is provided in . The diagnoses reported may not necessarily reflect the major disease problems encountered in the field during the season, but rather those most prevalent within the samples submitted. Categories of samples received were potatoes (47.12%), cole crops (16.85%), cucurbits (2.29%), other vegetables (5.36%), oilseeds (8.81%), cereal crops (8.04%), fruit crops (5.36%), greenhouse ornamentals (1.49%), and other crops (4.68%).
Table 1. Diseases diagnosed on commercial crop samples submitted to the PEI Analytical Laboratories, Plant Disease Diagnostic Service in 2020
No potato late blight foliar infections were reported or identified this season due to the low level of inoculum and extremely dry growing conditions. Growers were vigilant and carried out good management practices along with an appropriate protectant fungicide spray schedule and the assistance of spore trapping surveillance. One isolate of Phytophthora erythroseptica was confirmed as metalaxyl-sensitive by Dr. Rick Peters and staff at Agriculture and Agri-Food Canada (AAFC), Charlottetown, PE.
Potato blackleg infections increased this season despite the dry weather conditions. Blackleg is primarily a seed-borne disease that is often associated with cool, wet soil conditions, but new strains can develop under dry conditions. The potato variety involved was ‘Dakota Russet’ and the bacterial isolates involved were Pectobacterium atrosepticum and P. parmentieri (identification confirmed by Dr. Sean Li and Dr. Jingbai Nie, Canadian Food Inspection Agency (CFIA), Charlottetown, PE). This P. parmentieri isolate can cause symptoms of blackleg and soft rot in potato tubers. These diseases are usually a consequence of latent infection of seed potatoes. Other varieties that were exhibiting blackleg symptoms included ‘Chieftain’, ‘Ivory Russet’, ‘Russet Burbank’ and ‘Highland Russet’. Early Dying Syndrome (EDS) continues to be a problem in potatoes especially when plants are grown under drought conditions. Some of the fungal organisms involved included Verticillium, Fusarium, Rhizoctonia and Colletotrichum.
Diagnoses were also completed this season on new crops such as haskap, brown mustard, and crambe.
CEREALS/CÉRÉALES
LEAF SPOT DISEASES OF OAT AND BARLEY IN SASKATCHEWAN IN 2020
CROP: Oat and Barley
LOCATION: Saskatchewan
NAMES AND AGENCY:
T. ISLAM, E. BOOTS, D. MEYERS & H.R. KUTCHER
Crop Development Centre, University of Saskatchewan, 51 Campus Drive, Saskatoon, SK S7N 5A8Telephone: (306) 966-8661; Facsimile: (306) 966-5015; Email: [email protected]
ABSTRACT: Leaf spots were assessed on 31 oat and 27 barley survey samples that were collected across Saskatchewan in 2020. Leaf spot pathogens were detected in nine oat crops. The predominant pathogen was Stagonospora avenae, which was found in 26% of the oat crops surveyed. Pathogens causing leaf spots were also detected in 20 of 27 barley crops surveyed; Pyrenophora teres was the most prevalent pathogen found in 59% of the samples.
INTRODUCTION AND METHODS: From July to August 2020, 31 oat crops and 27 barley crops were visited by Saskatchewan Crop Insurance Corporation staff and at least 10 flag and penultimate leaves were collected from each barley crop, and 10 flag or penultimate leaves and panicles sampled from each oat crop. Leaf samples were plated from 31 oat and 27 barley crops. Samples were collected from early milk to soft dough stage. Grain samples were plated from 42 oat crops. Leaves were cut into 1 cm-long pieces, sterilized in 70% ethanol and triple rinsed with sterile distilled water, then dried before being plated on acidified potato dextrose agar. Plates were incubated under light at room temperature and pathogens were identified after four days based on morphology (Zillinsky Citation1983). Data were recorded as prevalence (the percentage of fields affected by a particular pathogen) and incidence (the percentage of each pathogen out of all pathogens isolated from the leaf samples). Kernels were threshed from the 42 oat panicles and sterilized in 5% bleach solution before triple rinsing with sterile water. Kernels were plated on acidified potato dextrose agar and left for five days under light at room temperature before pathogens were identified according to morphology (Zillinsky Citation1983; Leslie and Summerell 2006).
RESULTS AND COMMENTS: Oat leaf pathogens were identified in nine (29%) of the 31 oat crops surveyed. The prevalence of pathogens detected in the oat samples was: Stagonospora avenae (cause of septoria leaf blotch) affecting 26% of the crops surveyed; Pyrenophora avenae (cause of leaf blotch) affecting 6% of the crops surveyed; Cochliobolus sativus (cause of spot blotch) affecting 3% of the crops surveyed; and Fusarium spp. affecting 3% of the crops surveyed. The frequency of the individual pathogens expressed as a percentage of total pathogens isolated was 67%, 17%, 8% and 8%, respectively (). In addition to leaf pathogens, two saprophytes, Alternaria spp. (87% of the crops surveyed) and Epicoccum spp. (16% of the crops surveyed) were also detected. Oat kernels were infected by three different Fusarium spp. that are known to cause Fusarium head blight: F. poae, F. avenaceum and F. graminearum (). Prevalence was 76%, 41% and 16%, respectively.
Table 1. Prevalence and incidence of leaf spot pathogens in oat and barley in Saskatchewan in 2020
Table 2. Prevalence and frequency of Fusarium species isolated from infected oat kernels in Saskatchewan in 2020
Barley leaf pathogens were identified in 20 (74%) of the 27 crops surveyed. Pyrenophora teres (cause of net blotch) was the most frequently identified pathogen with a prevalence of 59% and frequency of 61% (). Cochliobolus sativus (cause of spot blotch) was present in seven of 27 barley crops surveyed (prevalence 26% and frequency 27%). The other identified pathogen was Septoria passerinii with a prevalence of 11% and frequency of 12%. Alternaria spp. were the only saprophytes identified in the barley samples at a prevalence of 74%.
In oat, 76% of the crops surveyed had trace to light disease severity in the upper leaf canopies, 18% had moderate to severe levels and 6% had severe disease ratings.
In barley, trace to light disease severity was observed in 86% of the crops surveyed in the upper leaf canopies, while 14% had moderate disease severity.
ACKNOWLEDGEMENTS: This survey was supported by the leaf samples submitted by the Saskatchewan Crop Insurance Corporation. We thank our colleagues from the province and the members of the Cereal and Flax Pathology Group (CFPATH) – University of Saskatchewan.
REFERENCES
- Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Ames (IA): Blackwell.
- Zillinsky FJ. 1983. Common diseases of small grain cereals: a guide to identification. Mexico: CIMMYT.
2020 BARLEY DISEASE SURVEY IN CENTRAL ALBERTA
CROP: Barley
LOCATION: Central Alberta
NAMES AND AGENCY:
N.E. RAUHALA & T.K. TURKINGTON
Agriculture and Agri-Food Canada, Lacombe Research Centre, 6000 C & E Trail, Lacombe, AB T4L 1W1Telephone: (403) 782-8100; Facsimile: (403) 782-6120; E-mail: [email protected]; [email protected]
ABSTRACT: In 2020, 30 random commercial barley crops were surveyed for disease levels in central Alberta. Compared to 2019, leaf disease levels were higher and common root rot levels were similar.
INTRODUCTION AND METHODS: A survey to document diseases of barley was conducted in 30 fields in Central Alberta from July 31 to August 6, 2020. Growers were contacted for permission to access their land, with evaluations being done at the late milk to soft dough stage. The fields were traversed in a diamond pattern starting at least 25 m in from the field edge, with visual assessment made of 10 penultimate leaves at each of five locations that were at least 25 m apart. Scald, netted net blotch and other leaf spot diseases were rated for the percentage of leaf area diseased (PLAD) on a visual scale of 0-100. Common root rot (CRR) was assessed on five sub-crown internodes at each of five sites using a 0-4 scale where 0=none, 1=trace, 2=low, 3=moderate and 4=severe. Other diseases, if present, were rated as a percentage of the plants affected. Following the survey, a representative tissue sub-sample of diseased plant parts collected at each location was cultured in the laboratory for pathogen isolation and identification.
RESULTS AND COMMENTS: Survey results are presented in . Growing conditions across the region were wet and cool for the entire growing season. Scald (Rhynchosporium commune) was present in 20 of 30 fields. Seven of those fields had low disease levels with ratings from 1-3, another seven fields had levels of 4-6, while six fields had higher levels of PLAD. Net blotch (net-form, Pyrenophora teres f. teres) was found in eight of 30 fields, with four of those fields having a low PLAD and another four fields with moderate PLAD. Other leaf spot diseases were found in 29 out of 30 fields, with 16 of those fields having a low PLAD and another 13 fields having a low to moderate PLAD. These other leaf spots were cultured in the laboratory and Cochliobolus sativus (the causal agent of spot blotch) was isolated from 13 of the 30 fields, while P. teres f. maculata (spot-form net blotch) was isolated from 14 and Alternaria spp. from 24 of the 30 fields. Overall, barley leaf disease levels in 2020 were higher than those in the previous year (Rauhala and Turkington Citation2020).
Table 1. Disease incidence and severity in 30 commercial barley fields in central Alberta, 2020
Loose smut (Ustilago nuda) in barley was found at trace levels in two of the 30 fields surveyed in central Alberta in 2020.
Common root rot (Bipolaris sorokiniana) was found in all 30 fields surveyed. Disease levels in the affected fields ranged from trace to moderate, similar to those in 2019.
No stripe rust (Puccinia striiformis) was found in any of the 30 commercial barley fields surveyed.
REFERENCES
- Rauhala NE, Turkington TK. 2020. 2019 barley disease survey in central Alberta. Can Plant Dis Surv. 100:53. In Can J Plant Pathol. 42:sup1.
2020 BARLEY DISEASE SURVEY IN THE SOUTH PEACE REGION OF ALBERTA
CROP: Barley
LOCATION: South Peace Region of Alberta
NAMES AND AGENCIES:
H.W. KLEIN-GEBBINCK1 & T.K. TURKINGTON2
1Agriculture and Agri-Food Canada (AAFC), Beaverlodge Research Farm, Beaverlodge, AB T0H 0C0Telephone: (780) 354-5117; E-mail: [email protected]
2AAFC, Lacombe Research and Development Centre, 6000 C&E Trail, Lacombe, AB T4L 1W1
ABSTRACT: In 2020, 20 producer barley fields in the South Peace region of Alberta were surveyed for leaf diseases at the early milk to late dough stages of crop development. In general, mean monthly temperatures and total precipitation were near the norms of the previous 25 years. Scald and the net-form of net blotch were the most common diseases. Although severity levels were low to moderate on average, a few fields had higher levels of scald.
INTRODUCTION AND METHODS: Twenty commercial barley fields at the early milk to late dough stages were surveyed in the South Peace Region of Alberta from August 1 to 15, 2020. Fields were traversed in a diamond-shaped pattern with samples taken at the vertices. Twenty-five leaves (equal numbers of penultimate (flag leaf – 1) and the next lower (flag leaf – 2) leaves were randomly sampled from a path of 3 to 5 m radius around each vertex. Leaves were collected and placed in envelopes, air-dried and stored under cool dry conditions for disease assessment and plating for sporulation later in the fall. The percentage of diseased leaf area (DLA) was assessed on a visual scale of 0-100 for scald (Rhynchosporium commune), the net-form of net blotch (Pyrenophora teres f. teres), leaf blotch (Parastagonospora nodorum) and other leaf spots such as spot-form net blotch (P. teres f. maculata) and spot blotch (Cochliobolus sativus). Standard area diagrams were used to aid disease assessments. Diseases were identified on the basis of symptoms and sporulation on lesions on leaf pieces. Leaf pieces from air dried leaves were surface- sterilized in 10% bleach/10% alcohol solution for 1–2 minutes, plated on water agar, and incubated at 18°C in light for 3–14 days. Plating was repeated with air-dried leaf pieces where needed.
RESULTS AND COMMENTS: Monthly average temperatures over the region from May to August were 10.0, 13.5, 15.8 and 14.0oC in 2020 and 9.6, 13.6, 15.7 and 14.5oC for the previous 25 years, respectively. However, the first half of July was cooler in 2020 (14.1oC) than the 25-year norm (15.2oC) and warmer in the second half of July, 2020 (17.4oC) than the 25-year average (16.0oC). Monthly total rainfalls over the same period were 43, 60, 77 and 26 mm in 2020 compared to the 25-year norms of 41, 63, 72 and 55 mm, respectively.
Results of the disease survey are shown in . All sampled fields had low to moderate levels of scald with an average severity of 12.1% DLA. As in 2018 and 2019, scald was the most common disease in most fields. Net blotch (both spot- and net-form) was found in 30 and 35% of fields, respectively, with severities ranging from 0.1 to 1.1%. Limited leaf blotch and spot blotch were observed. Overall, trends were similar to those in 2018 and 2019 (Klein-Gebbinck and Turkington 2018; Klein-Gebbinck et al. 2019). Two fields had trace to low (<1%) levels of loose smut.
Table 1. Field incidence, severity and range of barley leaf diseases in the South Peace region of Alberta, 2020
REFERENCES
- Klein-Gebbinck HW, Turkington TK. 2020. 2018 barley disease survey in the South Peace River Region of Alberta. Can Plant Dis Surv. 100:56. In, Can J Plant Pathol. 42:sup1.
- Klein-Gebbinck HW, Turkington TK, Uloth K. 2020. 2019 barley disease survey in the South Peace River Region of Alberta. Can Plant Dis Surv. 100:57. In, Can J Plant Pathol. 42:sup1.
DISEASES OF BARLEY IN OTTAWA, ONTARIO IN 2020
CROP: Barley
LOCATION: Ottawa, Ontario
NAMES AND AGENCIES:
A.G. XUE & Y. CHEN
Ottawa Research and Development Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6Telephone: (613) 759-1513; Facsimile: (613) 759-1926; E-mail: [email protected]
ABSTRACT: Three barley fields located on the Central Experimental Farm (CEF) in Ottawa, Ontario were monitored for the occurrence and severity of diseases during the growing season in 2020. Of the six diseases observed, spot blotch and barley yellow dwarf (BYDV) were the most prevalent, having moderate levels of infection in all three fields. Fusarium head blight (FHB) was observed in all three fields with low severities. Fusarium sporotrichioides was the predominant species isolated from the FHB- infected kernels.
INTRODUCTION AND METHODS: The occurrence and severity of barley diseases on the Central Experimental Farm (CEF) in Ottawa, Ontario were monitored during the 2020 growing season. Three fields located in Central 7, Central 8 and Central 10, respectively, were chosen at random. The fields were approximately 2-km apart and consisted of two-row barley.
The development of foliar diseases was monitored by visually estimating disease severity on 10 randomly selected plants at each of three random sites per field, using a rating scale of 0 (no disease) to 9 (severely diseased). Diagnosis was based on visual symptoms. Assessments were carried out six times dated June 11, June 21, July 2, July 9, July 16 and July 23, when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively. Average severity scores of <1, <3, <6 and ≥6 were considered as trace, slight, moderate and severe disease levels, respectively.
Severity of root and head diseases was assessed at the soft dough stage of growth. The severity of leaf stripe and take-all was rated as the percent of plants infected at each of the three random sites per field. Fusarium head blight (FHB) was rated for incidence (% infected spikes) and severity (% infected spikelets in the affected spikes) based on approximately 200 spikes at each of the three sites per field. An FHB index ([% incidence x % severity]/100) was determined for each field. Average percentage of infected plants or FHB index values of <5, <10, <20 and ≥20% were considered as slight, moderate, severe and very severe disease levels, respectively.
Determination of the causal species of FHB was based on 60 infected spikes collected from each affected field. The spikes were air-dried at room temperature and subsequently threshed. Sixty discoloured kernels per sample were chosen at random, surface sterilized in 1% NaOCI for 60 s and plated in 9-cm diameter petri dishes on modified potato dextrose agar (10 g dextrose L−1 amended with 50 ppm of streptomycin sulphate). The plates were incubated for 10-14 days at 22-25ºC and a 14 h photoperiod using fluorescent and long wavelength ultraviolet tubes. Fusarium species isolated from kernels were identified by microscopic examination using standard taxonomic keys.
RESULTS AND COMMENTS: Three foliar diseases were observed during the growing season (). Barley yellow dwarf (BYDV) was the only disease found before the heading stage of growth. Spot blotch (Cochliobolus sativus) and net blotch (Pyrenophora teres) were first observed at the heading stage. The disease progression of spot blotch was noticeably faster than BYDV and net blotch, however, none of these diseases reached severe levels at the soft dough stage when leaves started to naturally senesce.
A total of six diseases were observed at the soft dough stage (). Spot blotch and BYDV were the predominant foliar diseases with average severities of 5.3 and 3.8, respectively. Moderate to severe levels of infection from spot blotch were observed in two fields and from BYDV in one field only. Yield reductions due to these diseases were estimated to have averaged 5% in affected fields. The other foliar disease observed was net blotch which occurred at the trace to slight levels and caused minimal or no measurable damage to the crop.
Table 1. Prevalence and severity of barley diseases in Ottawa, Ontario in 2020
Leaf stripe (Pyrenophora graminea) and take-all (Gaeumannomyces graminis) were observed in all fields at mean incidences of 2.3% and 3.0% respectively (). Moderate and severe infections from these diseases were not observed and yield reductions were estimated at <3% in affected fields.
FHB was observed in all three fields with a mean FHB index of 0.1% (range 0.1% to 0.3%) (). Moderate to severe FHB infection was not observed. Yield and quality reductions due to FHB were estimated at <1%. Three Fusarium species were isolated from putatively infected kernels (). Fusarium sporotrichioides predominated and occurred in all three fields, isolated from 18.1% of infected kernels, and represented 58.8% of the pathogen population causing FHB. Fusarium equiseti and F. poae were less common, occurring in 5.6% and 7.2% of kernels, and representing 18.0% and 23.2% of the pathogen population, respectively.
Table 2. Prevalence of Fusarium species isolated from putatively infected barley kernels in Ottawa, Ontario in 2020
The six diseases observed on barley on the CEF in Ottawa, Ontario in 2020 were among the 14 diseases recorded on barley in the survey of 24 commercial fields across Ontario in 2019 (Xue and Chen 2020). Overall, the incidence and severity of these diseases were generally lower in 2020 than in 2019. The hot and dry weather conditions in June and July 2020 compared to 2019 in Central and Eastern Ontario were likely responsible for the decreased disease severities observed. It is also worth noting that F. graminearum, the principal species causing FHB in North America, was not isolated from the Fusarium-infected kernels in 2020. This result was in agreement with our previous findings that F. graminearum is less prevalent than other etiological components of FHB in barley under lighter disease pressure in a non-epidemic year in Ontario (Xue et al. Citation2013, 2019). Weather conditions across the province during the 2020 growing season were less favourable to the endemic of F. graminearum, but likely favoured the presence of F. sporotrichioides, F. equiseti, and F. poae.
REFERENCES
- Xue AG, Chen Y. 2020. Diseases of barley in Ontario in 2019. Can Plant Dis Surv. 100:58–59. In, Can J Plant Pathol. 42:sup1.
- Xue AG, Chen Y, Seifert K, Guo W, Blackwell BA, Harris LJ, Overy D. 2019. Prevalence of Fusarium species causing head blight of spring wheat, barley and oat in Ontario during 2001–2017. Can J Plant Pathol. 41(3):392–402.
- Xue AG, Rowsell J, Ho KM, Chen Y, Chi DT, Manceur A, Zhang SZ, Ren CZ. 2013. Effect of harvest date on barley grain contamination with Fusarium spp. and deoxynivalenol in northeastern Ontario. Phytoprotection 93(1):1–7. doi:https://doi.org/10.7202/1015205ar
Fig. 1 Foliar disease progress curves for barley yellow dwarf (BYDV), net blotch (Pyrenophora teres) and spot blotch (Cochliobolus sativus) in barley fields in Ottawa, Ontario in 2020. Each point is the mean of three fields and three sites per field. Severities of these diseases were visually estimated on a scale of 0 to 9, six times during the growing season when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively
CROWN RUST OF OAT IN MANITOBA, SASKATCHEWAN, ONTARIO AND QUEBEC IN 2019
CROP: Oat
LOCATION: Manitoba and eastern Saskatchewan (eastern prairie region), Ontario and Quebec
NAMES AND AGENCIES:
J.G. MENZIES1, A.G. XUE2, C. AZAR3, S. DECEUNINCK1, Z. POPOVIC1, H. DERKSEN1, & J. ZHAO4
1Agriculture and Agri-Food Canada, Morden Research and Development Centre, 101 Route 100, Morden, MB R6M 1Y5, CanadaTelephone: (204) 822-7522; Facsimile: (204) 822-7507; E-mail: [email protected]
2Agriculture and Agri-Food Canada, Ottawa Research and Development Centre, K.W. Neatby Building, 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada
3 Crop Production Research Farm, La Coop fédérée, Saint-Hyacinthe, QC J2T 5J4, Canada
4Triticeae Research Institute, Sichuan Agricultural University, Wenjiang, Chengdu, China
ABSTRACT: In 2019, 58 fields with wild oats and 57 fields of common oats were surveyed for the incidence and severity of crown rust (Puccinia coronata f. sp. avenae P. Syd. & Syd.) in Manitoba and eastern Saskatchewan. Crown rust-infected plants were found in 66% and 37% of wild and common oat fields at mean incidences of 4% and 6%, respectively, and mean severities of 1M and 2MR. Virulence was observed to all resistance genes in 123 single pustule isolates from Manitoba and Saskatchewan, except for virulence to Pc98. Forty-two single pustule isolates from Ontario and Quebec did not express virulence to the resistance genes Pc64, Pc94 and Pc101.
INTRODUCTION AND METHODS: Surveys for the incidence and severity of oat crown rust, caused by Puccinia coronata f. sp. avenae P. Syd. & Syd., were conducted in Manitoba and Saskatchewan from August 8th to August 16th, 2019. The areas surveyed were in crop districts 1, 2, 3, 7, 8, 9, and 11 in Manitoba and crop districts 1, 2, and 5 in Saskatchewan. Incidence was considered to be the percentage of leaves infected with rust in a given field, and the severity was the mean percentage leaf area with pustules. Crown rust collections were obtained from wild oat (Avena fatua L.) and common oat (A. sativa L.) in the fields, and susceptible and resistant oat lines and cultivars grown in uniform rust nurseries. The nurseries were located at Indian Head and Saskatoon, SK, Emerson, MB, and Casselman and Ottawa, ON. Samples from fields in Ontario and Quebec were collected in July and crown rust samples from the eastern prairie region were also generously provided by Dr. T. Zegeye-Gebrehiwot, Morden Research and Development Centre (MRDC). For virulence studies, single-pustule isolates (spi) were established from the rust collections. Races were identified using 16 standard oat crown rust differentials () as described by Chong et al. (Citation2000, Citation2008). In addition, single Pc-gene lines with Pc91, Pc94, Pc96, temp_pc97, temp_Pc98, Pc101, Pc103-1 and Pc104 were used as supplemental differentials.
Table 1. Frequencies (%) of virulence of Puccinia coronata f. sp. avenae isolates from the eastern prairie region and eastern Canada on 16 standard and eight supplemental crown rust differential oat lines in 2019
RESULTS AND COMMENTS: Fifty-eight fields with wild oats and 57 fields of common oat lines were surveyed in Manitoba and Saskatchewan in 2019. Oat plants infected with P. coronata f. sp. avenae were found in 38 (66%) of the wild oat fields, and 21 (37%) of the common oat fields.
Crown rust incidence on wild oats ranged from 0 to 80%, with a mean incidence of 4%. The severity of crown rust on wild oats ranged from 0 to 5S with a mean severity of 1MR. Crown rust incidence on commercial oats ranged from 0 to 50%, with a mean incidence of 6%. The severity of crown rust on common oats ranged from 0 to 10S with a mean severity of 2MR. The incidence and severity of crown rust was greater in Manitoba crop districts 1, 7, 8 and 9. There was very little crown rust in Saskatchewan crop districts at the time of the surveys, with crop district 1 having the most.
Eighty-two spi were obtained from wild oat collections from Manitoba and eastern Saskatchewan, and 44 races were identified. Thirty-five (80%) races were each represented by only one spi. The most common races were JTQG, represented by 16 spi, and JRLG, represented by nine isolates. Virulence was observed to all the Pc genes in the spi from wild oat, except Pc98 (), and virulence was less than 5% for Pc54, Pc58, Pc62, Pc64, Pc94 and Pc96. Virulence was observed in 80% or more of the spi from wild oat for Pc38, Pc39, Pc45, Pc46, Pc51, Pc56, Pc68 and Pc91.
Twenty-eight spi were made from common oat collections from Manitoba and Saskatchewan, with 23 races identified. Only race JTQC, represented by six spi, was represented by more than one spi. Virulence to Pc genes Pc54, Pc58, Pc96, Pc97 and Pc98 was not observed in any spi, and only one spi was virulent to Pc101. Virulence to Pc38, Pc39 was observed in all the spi from common oat, and all but one spi had virulence to Pc91 ().
Thirteen spi were obtained from collections from the Uniform Rust Nursery and 11 races identified. Race GTQG was represented by three isolates. Virulence to seven of the Pc genes was not observed with these spi () and 100% of the spi possessed virulence to Pc38, Pc48, Pc52 and Pc68.
Overall, in Manitoba and eastern Saskatchewan for the wild oat and common oat spi, virulence was observed to all Pc genes except Pc98, but less than 5% of the spi possessed virulence to Pc64, Pc94 and Pc96.
Forty-two spi were made from the eastern Canada collections, and 26 races identified. Race DTQG (seven spi) was the most common race. None of the spi possessed virulence to Pc98, and less than 5% of the spi had virulence towards Pc64, Pc94 and Pc96 (). Virulence to Pc38, Pc39, Pc48, Pc56 and Pc68 was observed in 90% or more of the spi ().
Greater than 70% of all Canadian spi from the 2019 collections possessed virulence to resistance genes Pc38, Pc39, Pc45, Pc46, Pc48, Pc51, Pc52, Pc56, Pc68 and Pc91, while virulence was observed at 5% or less to Pc54, Pc58, Pc64, Pc94, Pc96, Pc97, PPc98 and Pc101 (). The high levels of virulence to Pc38 and Pc39 in the eastern prairie region likely reflect the deployment of Pc38 and Pc39 in combination in the eastern prairies, as well as North Dakota and Minnesota since the 1980s.
REFERENCES
- Chong J, Gruenke J, Dueck R, Mayert W, Woods S. 2008. Virulence of oat crown rust [Puccinia coronata f. sp. avenae] in Canada during 2002–2006. Can J Plant Pathol. 30(1) 115–123. doi:https://doi.org/10.1080/07060660809507502
- Chong J, Leonard KJ, Salmeron JJ. 2000. A North American system of nomenclature for Puccinia coronata f. sp. avenae. Plant Dis. 84(5):580–585. doi:https://doi.org/10.1094/PDIS.2000.84.5.580
DISEASES OF OAT IN OTTAWA, ONTARIO IN 2020
CROP: Oat
LOCATION: Ottawa, Ontario
NAMES AND AGENCIES:
A.G. XUE & Y. CHEN
Ottawa Research and Development Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6Telephone: (613) 759-1513; Facsimile: (613) 759-1926; E-mail: [email protected]
ABSTRACT: Three oat fields located on the Central Experimental Farm (CEF) in Ottawa, Ontario were monitored for the occurrence and severity of diseases during the growing season in 2020. Of the nine diseases observed, barley yellow dwarf (BYDV), crown rust, halo blight and stem rust were the most prevalent, having moderate to severe levels of infection in 3, 2, 2 and 2 fields, respectively. Fusarium head blight (FHB) was observed in all three fields with low severities. Fusarium sporotrichioides and F. equiseti were the predominant species isolated from the FHB infected kernels.
INTRODUCTION AND METHODS: The occurrence and severity of oat diseases on the Central Experimental Farm (CEF) in Ottawa, Ontario were monitored during the 2020 growing season. Three fields located in Central 5, Central 8 and Central 9, respectively, were chosen at random. The fields were approximately 2-km apart.
The development of foliar diseases was monitored by visually estimating disease severity on 10 randomly selected plants at each of three random sites per field, using a rating scale of 0 (no disease) to 9 (severely diseased). Diagnosis was based on visual symptoms. Assessments were carried out six times dated June 11, June 21, July 2, July 9, July 16 and July 23, when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively. Average severity scores of <1, <3, <6 and ≥6 were considered as trace, slight, moderate, and severe disease levels, respectively.
Severity of root and head diseases was assessed at the soft dough stage of growth. The severity of take-all was rated as the percent of plants infected at each of the three random sites per field. Fusarium head blight (FHB) was rated for incidence (% infected panicles (heads)) and severity (% infected spikelets in the affected panicles) based on approximately 200 panicles at each of the three sites per field. An FHB index ([% incidence x % severity]/100) was determined for each field. The percentage of infected plants or FHB index values of <5, <10, <20 and ≥20% were considered as slight, moderate, severe, and very severe disease levels, respectively.
Determination of the causal species of FHB was based on 60 infected panicles collected from each affected field. The panicles were air-dried at room temperature and subsequently threshed. Sixty discoloured kernels per sample were chosen at random, surface sterilized in 1% NaOCI for 60 s and plated in 9 cm diameter petri dishes on modified potato dextrose agar (10 g dextrose L−1 amended with 50 ppm of streptomycin sulphate). The plates were incubated for 10-14 days at 22-25ºC and a 14 h photoperiod using fluorescent and long wavelength ultraviolet tubes. Fusarium species isolated from kernels were identified by microscopic examination using standard taxonomic keys.
RESULTS AND COMMENTS: Seven foliar diseases were observed during the growing season (). Of these diseases, barley yellow dwarf (BYDV) was the only disease found before the booting stage of growth and it was noticeably the predominant disease throughout the season. Stagonospora leaf blotch (Stagonospora avenae f. sp. avenaria) was first noticed at the booting stage and halo blight (Pseudomonas syringae pv. coronafaciens) at the flowering stage. Other foliar diseases including crown rust (Puccinia coronata f. sp. avenae), pyrenophora leaf blotch (Pyrenophora avenae), spot blotch (Cochliobolus sativus) and stem rust (Puccinia graminis f. sp. tritici) appeared at the milk stage. The progression of these diseases was generally slow and none had reached a severe level at the soft dough stage when leaves started naturally senesce.
A total of nine diseases were observed at the soft dough stage (). Of the seven foliar diseases, BYDV, crown rust, halo blight and stem rust were the most prevalent and were found in all three fields at average severities of 5.3, 4.0, 3.7 and 3.7, respectively. Moderate to severe levels of these diseases were observed in 2, 2, 1 and 1 field, respectively. Yield reductions due to these diseases were estimated to be <20% in affected fields. The other foliar diseases were at slight and moderate levels and none would have resulted in measurable damage to the crop.
Table 1. Prevalence and severity of oat diseases in Ontario in 2020
Take-all (Gaeumannomyces graminis) was observed in all fields at a mean incidence of 5.0% (). Yield reduction from take-all was estimated at <5% in affected fields.
FHB was observed in all three fields at a mean FHB index of 0.1% (range 0.1% to 0.1%) (). Moderate to severe FHB infection was not observed. Yield and quality reductions due to FHB were estimated at <1%. Three Fusarium species were isolated from putatively infected kernels (). Fusarium sporotrichioides predominated and occurred in all three fields, while it was isolated from 9.4% of infected kernels and represented 70.5% of the pathogen population causing FHB. Fusarium avenaceum and F. equiseti were less common, occurring in 0.6% and 3.3% of kernels and represented 4.7% and 24.8% of the pathogen population, respectively.
Table 2. Prevalence of Fusarium species isolated from putatively infected oat kernels in Ontario in 2020
The nine diseases observed on oat on the CEF in Ottawa, Ontario in 2020 were among the 11 diseases recorded on oat in the survey of 20 commercial fields across Ontario in 2019 (Xue and Chen 2020). Overall, the incidence and severity of these diseases were generally lower in 2020 than in 2019. The hot and dry weather conditions in June and July 2020 compared with 2019 in Central and Eastern Ontario were likely responsible for the decreased disease severities observed. It is also worth noting that F. poae, the predominant species causing FHB of oat in Ontario during 2008-2017 (Xue et al. 2019), was the least frequently isolated among three Fusarium species causing FHB in 2020. The record hot and dry weather conditions across the province during the growing season in 2020 might be the cause of changes in prevalence among the etiological species causing FHB of oat.
REFERENCES
- Xue AG, Chen Y. 2020. Diseases of oat in Ontario in 2019. Can Plant Dis Surv. 100:65–66. In, Can J Plant Pathol. 42:sup 1.
- Xue AG, Chen Y, Seifert K, Guo W, Blackwell BA, Harris LJ, Overy D. 2019. Prevalence of Fusarium species causing head blight of spring wheat, barley and oat in Ontario during 2001–2017. Can J Plant Pathol. 41(3):392–402.
Fig. 1 Foliar disease progress curves for barley yellow dwarf (BYDV), Stagonospora leaf blotch (Stagonospora avenae f. sp. avenaria), halo blight (Pseudomonas syringae pv. coronafaciens), crown rust (Puccinia coronata f. sp. avenae), pyrenophora leaf blotch (Pyrenophora avenae), spot blotch (Cochliobolus sativus) and stem rust (Puccinia graminis f. sp. tritici) in oat fields in Ottawa, Ontario in 2020. Each point is the mean of three fields and three sites per field. The severity of these diseases was visually estimated on a scale of 0 to 9, six times during the growing season when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively
BARLEY AND OAT LEAF SPOT DISEASES IN MANITOBA – 2020
CROP: Barley and Oat
LOCATION: Manitoba
NAMES AND AGENCY:
M. BANIK1, A. KIRK2, D. KAMINSKI2, M. BEYENE1 & X. WANG1
1Morden Research and Development Centre, Agriculture and Agri-Food Canada, 101 Route 100, Morden, MB R6M 1Y5Telephone: (204) 822–7530; Facsimile: (204) 822–7507; E-mail: [email protected]
2Manitoba Agriculture and Resource Development, 65-3rd Avenue NE, Carman, MB R0G 0J0
ABSTRACT: In 2020, a total of 38 barley and 19 oat fields were surveyed for leaf spot diseases in Manitoba. Spot blotch, caused by Cochliobolus sativus, was the most common disease in barley, which was present in 57.9% fields. Pyrenophora leaf blotch was the most common leaf spot diseases found in oat and it was present in 47.4% of oat fields.
INTRODUCTION AND METHODS: Barley and oat crops in Manitoba were surveyed for leaf spot diseases at 57 field locations from July to August when crops were at the early- to soft-dough (ZGS 79–82) (Zadoks et al. 1974) stages of growth.
Infected leaves with typical symptoms were collected at each site, dried, and stored in paper envelopes. Subsequently, 10 surface-sterilized pieces of putatively infected leaf tissue were incubated on filter paper in moist chambers for 3–5 days to promote sporulation to identify the causal agent(s) and disease(s).
RESULTS AND COMMENTS: Barley: Cochliobolus sativus (causal agent of spot blotch) and Pyrenophora teres (net blotch) were the principal pathogens isolated from infected leaves and caused the most damage in the fields surveyed. The infection caused by C. sativus was found in 57.9% of barley fields and P. teres was found in 21.1% of fields (). Septoria passerinii (speckled leaf blotch) was isolated from two fields (2.6%).
Table 1. Isolation frequency of leaf spot pathogens of barley in Manitoba, 2020
Oat: In 2020, Pyrenophora avenae, the causal agent of pyrenophora leaf blotch, was the most prevalent leaf pathogen in oat (). This pathogen was isolated from 47.4% of fields which was at a level similar to those reported over the last few years. C. sativus and S. avenae (stagonospora leaf blotch) were isolated from 21.1% and 10.5% of fields, respectively.
Table 2. Incidence and isolation frequency of leaf spot pathogens oat in Manitoba, 2020
REFERENCES
- Zadoks JC, Chang TT, Konzak CF. 1974. A decimal code for the growth stages of cereals. Weed Res. 14(6):415–421. doi:https://doi.org/10.1111/j.1365-3180.1974.tb01084.x
BARLEY AND OAT FUSARIUM HEAD BLIGHT IN MANITOBA – 2020
CROP: Barley and Oat
LOCATION: Manitoba
NAMES AND AGENCY:
M. BANIK1, A. KIRK2, D, KAMINSKI2, M. BEYENE1 & X. WANG1
1Morden Research and Development Centre, Agriculture and Agri-Food Canada, 101 Route 100, Morden, MB R6M 1Y5Telephone: (204) 822–7530; Facsimile: (204) 822–7507; E-mail: [email protected]
2Manitoba Agriculture and Resource Development, 65-3rd Avenue NE, Carman, MB R0G 0J0
ABSTRACT: In 2020, a total of 44 barley fields and 19 oat fields were surveyed for Fusarium head blight (FHB) incidence and severity in Manitoba. Fusarium infections were detected in 95% of barley fields with a mean FHB index of 0.041. In oat, Fusarium infections were found in 100% of oat fields. On average, Fusarium pathogens were isolated from 12.7% of oat kernels.
INTRODUCTION AND METHODS: Barley and oat fields in Manitoba were surveyed for Fusarium head blight (FHB) at 63 locations from July to August when crops were at the early- to soft-dough (ZGS 79–82) (Zadoks et al. 1974) stages of growth. Fields and results were grouped into four zones by geographical location: Central, Eastern/Interlake, Northwest, and Southwest. The data are presented for all barley crops (two-row and six-row) combined, for each year.
Fifty barley spikes or fifty oat panicles were collected from late milk to early dough stages in each field. A sub-sample of 30 barley spikes was analyzed for visual FHB symptoms. The number of infected spikes and the number of infected spikelets in each spike, as a proportion of the total, were recorded. An FHB index was calculated as (% of spikes affected x mean proportion (%) of kernels infected)/100. The mean FHB index was calculated for each zone and the whole province.
Fifty kernels from each field surveyed were surface-sterilized in a laminar flow bench and then placed on potato dextrose agar (PDA, 25% strength) + streptomycin media. Identification of Fusarium species involved microscopic examination and morphological characterization using the criteria of Leslie and Summerell (2006).
RESULTS AND COMMENTS: Visual FHB symptoms were detected in 64.6% of barley fields with a provincial mean FHB index of 0.041. The highest FHB index occurred in samples from Southwest Manitoba (0.078), while the FHB index was lowest in samples from Northwest Manitoba (0.017) ().
Table 1. Prevalence and severity of Fusarium head blight (FHB) in barley crops in Manitoba in 2020
In 2020, Fusarium pathogens were isolated from 95% of barley fields (). F. poae was the most frequently isolated Fusarium spp. and was isolated from 9.0% of kernels. The occurrence of infection caused by F. graminearum was lower than that caused by F. poae. F. graminearum was isolated from 2.3% of kernels. The infection caused by F. sporotrichioides was also common, and was isolated from 1.4% of kernels.
Table 2. Fusarium spp. identified from barley kernels of 42 fields in Manitoba, 2020
In oat, Fusarium pathogens were detected in samples from all 19 oat fields. F. poae was present in 100% oat fields and isolated from 24% of kernels. The levels of infection caused by F. graminearum and F. sporotrichioides in oat were lower than that of F. poae, which were isolated from 0.95% and 0.63% of kernels, respectively ().
Table 3. Fusarium spp. identified from the oat kernels of 19 fields in Manitoba, 2020
REFERENCES
- Zadoks JC, Chang TT, Konzak CF. 1974. A decimal code for the growth stages of cereals. Weed Res. 14(6):415–421.
- Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Ames (IA): Blackwell.
FUSARIUM HEAD BLIGHT OF SPRING WHEAT AND WINTER WHEAT IN MANITOBA IN 2020
CROP: Spring Wheat and Winter Wheat
LOCATION: Manitoba
NAMES AND AGENCIES:
M.A. HENRIQUEZ1, D. KAMINSKI2, A. KIRK2, J. DOHERTY1, D. MIRANDA1 & O. GRUENKE1
1Agriculture and Agri-Food Canada, Morden Research and Development Centre, 101 Route 100, Morden, MB R6M 1Y5Telephone 204-822-7551; Facsimile 204-822-7507; E-mail: [email protected]
2Manitoba Agriculture and Resource Development, 65-3rd Avenue NE, Carman, MB R0G 0J0
ABSTRACT: In 2020, fusarium head blight incidence and severity were assessed in 136 spring wheat and seven winter wheat fields in Manitoba. In spring wheat and winter wheat the disease occurred in 33% and 57.1% of the wheat fields surveyed at a provincial mean FHB severity (FHB index) of 0.02% and 0.03% respectively. The most prevalent Fusarium species in spring wheat was F. graminearum.
INTRODUCTION AND METHODS: Spring wheat and winter wheat in Manitoba were surveyed for fusarium head blight (FHB) at 136 and seven field locations, respectively. The survey for FHB was conducted from late July to late August for spring wheat, and July for winter wheat when most of the crops were at growth stage ZGS 73 – 85 (Zadoks et al. 1974). In contrast to other disease surveys conducted in Manitoba, the fields were not surveyed at random. Instead, information on their location was obtained from producers. The proportion of infected spikes per field (incidence) and the proportion of infected spikelets in each spike (severity) were recorded from five heads (main stems) at 10 sites along a W-pattern in the field, while avoiding sampling tillers. An FHB index (overall severity) was determined for each field surveyed: (average % incidence x average % severity)/100.
Fifty spikes were processed for pathogen isolation and identification in the laboratory. Kernels from each field surveyed were surface-sterilized in a laminar flow bench and then placed on potato dextrose agar (PDA, 25% strength) + streptomycin media. Identification of Fusarium species involved microscopic examination and morphological characterization using the criteria of Leslie and Summerell (2006).
RESULTS AND COMMENTS: According to the Manitoba Agricultural Services Corporation’s Variety Market Share Report (MASC Citation2020), there were approximately 2,660,220 million acres of spring wheat seeded in Manitoba in 2020. The top five cultivars, based on seed acreage, were ‘AAC Brandon’ (62.6%), ‘AAC Viewfield’ (11.8%), ‘AAC Elie’ (5.7%), ‘AAC Redberry’ (5.1), and ‘Cardale’ (2.6%). ‘AAC Brandon’ was the predominant spring wheat cultivar grown in the fields sampled in this survey. FHB disease levels were lower in 2020 (0.02%) than the levels observed in 2019 (0.3%) (Henriquez et al. 2020a). Provincially, FHB was detected in sixty fields for a prevalence of 33%. The average incidence of the disease across all fields was 1.42%. The average severity (measured as the percentage of spikelets with infection) was 0.23% across all fields. The provincial mean FHB severity (FHB index) was 0.02%. Prevalence of FHB in spring wheat was highest in the Southwest region (56%), followed by the Central region (51%).
According to the Manitoba Agricultural Services Corporation’s Variety Market Share Report (MASC Citation2020), there were approximately 27,456 acres of commercial winter wheat seeded in Manitoba for 2020. The top cultivars, based on their seed acreage, were ‘AAC Elevate’ (33.7%), ‘AAC Gateway’ (30.4%), and ‘Emerson’ (25.1%). FHB disease levels were lower in 2020 (0.03%) than the levels observed in 2019 (0.04%) (Henriquez et al. 2020b). FHB was detected in three out of four fields for a prevalence of 57.1%. The average incidence of the disease across all fields was 2.57%. The average severity (measured as the percentage of spikelets with infection) was 0.64% across all fields. The average FHB index was 0.03% across all fields.
The results from spring wheat kernels plated on PDA (25% strength) + streptomycin media showed that Fusarium graminearum was the most frequently isolated pathogen species, accounting for 66.1% of isolations, followed by F. sporotrichioides (18.8%) and F. poae (11.6%) (). Fusarium graminearum was detected in 30.9% of surveyed fields. The frequency (92.7%) and prevalence (57.1%) of Fusarium graminearum was higher in 2019 than in 2020. Fusarium spp. isolates were not identified in winter wheat.
Table 1. Fusarium head blight incidence and severity (FHB index) in spring wheat fields in Manitoba in 2020
Table 2. Fusarium species isolated from kernels in FHB-affected spring wheat fields in Manitoba in 2020
ACKNOWLEDGEMENTS: We gratefully acknowledge the participation of Manitoba Agriculture Farm Production Extension Specialists, as well as Dr. Henriquez’s summer students.
REFERENCES
- Henriquez MA, Kaminski D, Doherty J, Miranda D, Gruenke O. 2020a. Fusarium head blight of spring wheat in Manitoba in 2019. Can Plant Dis Surv. 100:71–72. In, Can J Plant Pathol. 42:sup1.
- Henriquez MA, Kaminski D, Doherty J, Miranda D, Gruenke O. 2020b. Fusarium head blight of winter wheat in Manitoba in 2019. Can Plant Dis Surv. 100:73–74. In, Can J Plant Pathol. 42:sup1.
- Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Ames (IA): Blackwell.
- Manitoba Agricultural Services Corporation (MASC). 2020. Variety Market Share Report. https://www.masc.mb.ca/masc.nsf/sar_varieties_2020.pdf [accessed 10 April 2021]
- Zadoks JC, Chang TT, Konzak CF. 1974. A decimal code for the growth stages of cereals. Weed Res. 14(6):415–421.
LEAF SPOT DISEASES OF SPRING WHEAT AND WINTER WHEAT IN MANITOBA IN 2020
CROP: Spring Wheat and Winter Wheat
LOCATION: Manitoba
NAMES AND AGENCIES:
M.A. HENRIQUEZ1, D. KAMINSKI2, A. KIRK2, J. DOHERTY1, D. MIRANDA1 & O. GRUENKE1
1Agriculture and Agri-Food Canada, Morden Research and Development Centre, 101 Route 100, Morden, MB R6M 1Y5Telephone 204-822-7551; Facsimile 204-822-7507; E-mail: [email protected]
2Manitoba Agriculture and Resource Development, 65-3rd Avenue NE, Carman, MB R0G 0J0
ABSTRACT: In 2020, leaf spot (LS) diseases were assessed in 136 spring wheat and seven winter wheat fields in Manitoba. The disease occurred in 113 spring wheat fields surveyed at a provincial mean LS severity of 6.74%. The most prevalent LS species was Pyrenophora tritici repentis, followed by Parastagonospora nodorum. Leaf spot diseases were observed in all winter wheat fields surveyed. The provincial mean LS severity in winter wheat was 11.7% and the most prevalent LS species was Parastagonospora nodorum.
INTRODUCTION AND METHODS: A survey for leaf spot (LS) diseases of spring wheat was conducted between the milk and dough growth stages in 2020 (ZGS 73 – 85, Zadoks et al. 1974). A total of 137 spring wheat and seven winter wheat fields were sampled. In contrast to other disease surveys conducted in Manitoba, the fields were not surveyed at random. Instead, information on their location was obtained from producers. In each field, 50 flag leaves were collected at random and percentage of leaf area affected by LS (severity) was recorded using a scale from 1 (slightly affected) to 50 (leaves dead) (Fernandez Citation1998).
From each field, 1 cm2 surface-disinfested leaf pieces were plated on V8 juice agar media amended with 0.02% streptomycin sulfate to promote pathogen sporulation for disease identification. Identification of LS pathogens involved microscopic examination and morphological characterization.
RESULTS AND COMMENTS: According to the Manitoba Agricultural Services Corporation’s Variety Market Share Report (MASC Citation2020), there were approximately 2,660,220 million acres of spring wheat seeded in Manitoba in 2020. The top five cultivars, based on seed acreage, were ‘AAC Brandon’ (62.6%), ‘AAC Viewfield’ (11.8%), ‘AAC Elie’ (5.7%), ‘AAC Redberry’ (5.1) and ‘Cardale’ (2.6%). ‘AAC Brandon’ was the predominant spring wheat cultivar grown in the fields sampled in this survey.
Leaf spot diseases were observed in 113 spring wheat fields surveyed. The provincial mean LS severity was 6.7% (). This severity was lower than 2019 (11.9%) (Henriquez et al. 2020a). As reported in previous years (Henriquez et al. Citation2017a, Citation2018a, Citation2019a, 2020a), Pyrenophora tritici-repentis (tan spot) was the most prevalent and widespread LS pathogen in Manitoba, accounting for 61.1% of isolations. This species was detected in 37.5% of surveyed fields. This was followed by Parastagonospora nodorum (38.5%) detected in 42.6% of surveyed fields ().
Table 1. Leaf spot severity in spring wheat fields in Manitoba in 2020
Table 2. Prevalence and isolation frequency of leaf spot pathogens in spring wheat fields in Manitoba in 2020
According to the Manitoba Agricultural Services Corporation’s Variety Market Share Report (MASC Citation2020), there were approximately 27,456 acres of commercial winter wheat seeded in Manitoba for 2020. The top cultivars, based on their seed acreage, were ‘AAC Elevate’ (33.7%), ‘AAC Gateway’ (30.4%) and ‘Emerson’ (25.1%). Leaf spot diseases were observed in all fields surveyed. The provincial mean LS severity was 11.7% (). In previous reports (Henriquez et al. Citation2016, Citation2017b, Citation2018b, Citation2019b, 2020b), Pyrenophora tritici-repentis (tan spot) was the most prevalent and widespread LS pathogen in Manitoba. However, in 2020, the most prevalent pathogen was Parastagonospora nodorum, accounting for 83.3% of isolations. This species was detected in 42.9% of surveyed fields. This was followed by Pyrenophora tritici-repentis (16.7%) detected in 14.3% of surveyed fields ().
Table 3. Prevalence and isolation frequency of leaf spot pathogens in winter wheat fields in Manitoba in 2020
ACKNOWLEDGEMENTS: We gratefully acknowledge the participation of Manitoba Agriculture Farm Production Extension Specialists, as well as Dr. Henriquez’s summer students.
REFERENCES
- Fernandez MR. 1998. Percentage leaf spot infection. Swift Current (SK): Laboratory protocols. Agriculture and Agri-Food Canada (AAFC), Semiarid Prairie Agricultural Research Centre (SPARC).
- Henriquez MA, Kaminski D, Doherty J, Miranda D, Gruenke O. 2020a. Leaf spot diseases of spring wheat in Manitoba in 2019. Can Plant Dis Surv. 100:75–76. In, Can J Plant Pathol. 42:sup1.
- Henriquez MA, Kaminski D, Doherty J, Miranda D, Gruenke O. 2020b. Leaf spot diseases of winter wheat in Manitoba in 2019. Can Plant Dis Surv. 100:77–78. In, Can J Plant Pathol. 42:sup1.
- Henriquez MA, Derksen H, Doherty J, Miranda DE, Gruenke O. 2019a. Leaf spot diseases of spring wheat in Manitoba in 2018. Can Plant Dis Surv. 99:99. In, Can J Plant Pathol. 41:sup1.
- Henriquez MA, Derksen H, Doherty J, Miranda DE, Gruenke O. 2019b. Leaf spot diseases of winter wheat in Manitoba in 2018. Can Plant Dis Surv. 99:98. In, Can J Plant Pathol. 41:sup1.
- Henriquez MA, Derksen H, Doherty J, Miranda D, Gruenke O. 2018a. Leaf spot diseases of spring wheat in Manitoba in 2017. Can Plant Dis Surv. 98:125–126.
- Henriquez MA, Derksen H, Doherty J, Miranda DE, Gruenke O. 2018b. Leaf spot diseases of winter wheat in Manitoba in 2017. Can Plant Dis Surv. 98:127–128.
- Henriquez MA, Bajracharya P, De Rocquigny PJ, Derksen H, Yao Z, Miranda D, Gruenke O. 2017a. Leaf spot diseases of spring wheat in Manitoba in 2016. Can Plant Dis Surv. 97:129–130.
- Henriquez MA, Bajracharya P, De Rocquigny PJ, Derksen H, Miranda DE, Gruenke O. 2017b. Leaf spot diseases of winter wheat in Manitoba in 2016. Can Plant Dis Surv. 97:131–132.
- Henriquez MA, De Rocquigny PJ, Derksen H, Miranda DE, Gruenke O. 2016. Leaf spot diseases of winter wheat in Manitoba in 2015. Can Plant Dis Surv. 96:136–137.
- Manitoba Agricultural Services Corporation (MASC). 2020. Variety Market Share Report. https://www.masc.mb.ca/masc.nsf/sar_varieties_2020.pdf [accessed 10 April 2021]
- Zadoks JC, Chang TT, Konzak CF. 1974. A decimal code for the growth stages of cereals. Weed Res. 14(6):415–421.
LEAF RUST OF WHEAT IN MANITOBA IN 2020
CROP: Spring and Winter Wheat
LOCATION: Manitoba and Eastern Saskatchewan
NAMES AND AGENCY:
B. MCCALLUM, W. MCNABB & E. REIMER
Morden Research and Development Centre, Agriculture and Agri-Food Canada, 101 Route 100, Morden, MB R6M 1Y5Telephone: (204) 294-1837; Facsimile: (204) 822-7507; E-mail: [email protected]
ABSTRACT: The annual survey for leaf rust of wheat was conducted during early to mid-July for winter wheat and from late July to late August for spring wheat. A total of 35 rust-infected wheat leaf samples were collected from the winter wheat and 96 samples were obtained from spring wheat.
INTRODUCTION AND METHODS: The focus of the leaf rust survey was to collect specimens to determine the race structure of populations of leaf rust (Puccinia triticina Erikss.) For this reason, the majority of the survey sites were trap nurseries which did not receive fungicide applications. Less emphasis was placed on surveying commercial fields as most wheat fields are sprayed with fungicide to control disease. Trials of winter wheat were surveyed for rust at trap nurseries in Manitoba during early to mid-July. Trap nurseries, research trial sites and commercial fields of spring wheat in Manitoba and eastern Saskatchewan were examined for the incidence and severity of leaf rust from late July to late August 2020.
RESULTS AND COMMENTS: The growing season for the wheat crop in Manitoba provided an environment which allowed leaf rust to be established at moderately low levels. Precipitation in Central Manitoba was slightly below normal, while the Eastern region was close to normal. The Southwest region received normal levels of precipitation in most districts with the exception of the Brandon area which recorded above normal levels.
Winter wheat was surveyed at eight Manitoba Crop Variety Evaluation Trial (MCVET) locations with leaf rust symptoms present at 75% of the locations. The severity of leaf rust was generally low with the average level estimated at 2.6%.
Spring wheat was surveyed at 14 research locations which included 12 MCVET sites, one Uniform Rust Nursery (URN) trial and one Co-op trial site. Leaf rust symptoms were present at all of these locations. At the MCVET locations, many leaf rust-resistant entries were found to be free of the disease. The average disease severity across all locations was 7.1%, based on the entries that were symptomatic. The Neepawa location had the greatest degree of leaf rust with some entries reaching 30-40% disease severity. The Uniform Rust Nursery, where highly susceptible cultivars were grown, had up to 70% disease severity on the susceptible variety ‘Morocco’.
Eleven commercial fields of spring wheat were inspected in the Central and Western regions of Manitoba with only two fields showing trace levels of infection. The cultivation of resistant varieties coupled with the application of fungicide would account for the lower level of disease in commercial fields in comparison to the research trials.
The only Saskatchewan location that was surveyed was the Agriculture and Agri-Food Canada location at Indian Head. Leaf rust infection was found on susceptible cultivars and the severity of the disease was low, but was not measured.
STEM RUSTS OF CEREALS IN CANADA IN 2020
CROP: Barley, Oat and Wheat
LOCATION: Manitoba, Ontario, and eastern Saskatchewan
NAMES AND AGENCY:
T. FETCH, T. ZEGEYE & M. PENNER
Morden Research & Development Centre, Agriculture and Agri-Food Canada, 101 Route 100, Morden, MB R6M 1Y5Telephone: (204) 578-6591; Facsimile: (204) 578-6524; E-mail: [email protected]
ABSTRACT: Field surveys for stem rust were conducted from August to September 2020 in Manitoba, Ontario, and Saskatchewan. No stem rust was observed in wheat and was at low levels in barley and oat fields. For wheat and barley stem rust, only race QFCSC was identified in 2020. For oat stem rust, race TGN was dominant (49%), followed by races SGB (19%), TJS (9%) and SGD (8%). Six other races of oat stem rust were detected at low (1-4%) frequency in 2020. The high frequency of races TGN, SGB and SGD is unexpected, since all are avirulent on resistant Canadian oat cultivars that have gene Pg13.
INTRODUCTION AND METHODS: A total of 167 oat and 16 wheat and barley fields, as well as trap nurseries of barley, oat, and wheat, were sampled in 2020 to assess severity of infection of stem rust (Puccinia graminis Pers. f. sp. tritici Erikss. & E. Henn. and P. graminis Pers. f. sp. avenae Erikss. & E. Henn.) and determine the virulence spectrum in each pathogen population. The surveys were conducted in August and September and infected stem tissue samples were collected from each field surveyed. Urediniospores were obtained from collections and evaluated for virulence specialization on sets of host differential lines (Fetch and Jin Citation2007; Fetch et al. Citation2018).
RESULTS AND COMMENTS: In the eastern Prairie region where most of the samples were collected, mean temperature was warm (0 to +2°C) and mean precipitation was above average (85-150%) in July, but below average (40-85%) in August when rust infection normally occurs. Stem rust infection was absent in wheat fields and at low levels in barley fields, similar to 2019 (Fetch et al. Citation2020). Only race QFCSC of Puccinia graminis tritici was detected in 2020, from limited (only 16) samples due to the impact of COVID-19 on restricting the collection of samples.
Stem rust in cultivated oat fields and wild oat stands also was at low levels in western Canada in 2020. Race TGN was dominant (49%), followed by SGB at 19%, TJS at 9% and SGD at 8%. Six other races (TGB, TGD, TGL, TJB, TJJ and TJN) were detected at low (1-4%) frequency. While TJS can attack all Canadian oat cultivars, TGN, SGB and SGD are avirulent on resistant Canadian oat cultivars, which contain resistance gene Pg13.
REFERENCES
- Fetch T, Zegeye T, Penner M. 2020. Stem rust of cereals in western Canada in 2019. Can Plant Dis Surv. 100:80. In, Can J Plant Pathol. 42:sup1.
- Fetch T, Mitchell Fetch J, Zegeye T, Xue A. 2018. Races of Puccinia graminis on barley, oat, and wheat in Canada in 2011 and 2012. Can J Plant Pathol. 40(1):11–21. doi:https://doi.org/10.1080/07060661.2017.1396499
- Fetch TG Jr, Jin Y. 2007. Letter code system of nomenclature for Puccinia graminis f. sp. avenae. Plant Dis. 91(6):763–766. doi:https://doi.org/10.1094/PDIS-91-6-0763
LEAF SPOTTING DISEASES OF COMMON AND DURUM WHEAT IN SASKATCHEWAN IN 2020
CROP: Common and durum wheat
LOCATION: Saskatchewan
NAMES AND AGENCIES:
M.R. FERNANDEZ1, L. ABDELLATIF1, N. WAELCHLI1, C. KENNY2, F. WAELCHLI3, A. AKHAVAN4, C. PERU4 & S. HARTLEY5
1Agriculture and Agri-Food Canada, Swift Current Research and Development Centre, P.O. Box 1030, Swift Current, SK S9H 3X2Telephone: (306) 770-4459; E-mail: [email protected]
2Agriculture and Agri-Food Canada, Saskatoon Research and Development Centre, 107 Science Place, Saskatoon, SK S7N 0X2
3Saskatchewan Crop Insurance Corporation, Box 3000, 484 Prince William Drive, Melville, SK S0A 2P0
4Saskatchewan Ministry of Agriculture, Crops and Irrigation Branch, 3085 Albert St., Regina, SK S4S 0B1
5Saskatchewan Ministry of Agriculture, Crop Protection Laboratory, 1610 Park Street, Regina, SK S4N 2G1
ABSTRACT: The leaf spot (LS) disease complex was evaluated in common and durum wheat crops across Saskatchewan in 2020. Disease severity was compared relative to wheat species, soil zone, crop district, and cultivar. Mean LS severity was lower than in the previous three years. Common wheat had a numerically higher mean severity than durum wheat, which was lower in the Brown soil than in the other soil zones. Pyrenophora tritici-repentis was the most prevalent LS pathogen, followed by the septoria leaf complex.
INTRODUCTION AND METHODS: A survey for leaf spot (LS) diseases of common and durum wheat in Saskatchewan was conducted between the milk and dough growth stages in 2020. A total of 120 common and durum crops were sampled in 15 crop districts (CD) in the three soil zones (, ). This included 45 fields in the Brown soil zone, 37 in the Dark Brown soil zone, and 38 in the Black/Grey soil zone. Among the crops sampled, 81 were identified as common and 39 as durum wheat.
Table 1. Incidence and severity of leaf spotting diseases and percentage isolation of the most common leaf spotting pathogens in common and durum wheat crops surveyed in Saskatchewan in 2020
Information on the agronomic practices employed was obtained from the producers for most fields sampled.
Twenty-two common and 13 durum wheat cultivars were identified among the samples. The most popular cultivars (grown in at least five fields) were ‘AAC Brandon’ (15), ‘CDC Landmark’ (8) and ‘AAC Viewfield’ (7) for common wheat, and ‘Transcend’ (15) and ‘CDC Precision’ (5) for durum wheat.
For common wheat, of the 63 samples with a full crop rotation history, 39 had been preceded by an oilseed crop, 18 by a pulse, 4 by a cereal, and 2 by fallow; while the most frequently-grown crop two years previously was a cereal (44), an oilseed (11), a pulse (5), or had been fallowed (1). For durum wheat, of the 36 samples with a full crop rotation history, 11 had been preceded by an oilseed crop, 21 by a pulse, 2 by a cereal and 2 by fallow; while the most frequently-grown crop two years previously was a cereal (24), a pulse (7) or an oilseed (5).
Tillage system was classified as conventional, minimum-, or zero-till. Of the samples with tillage information, for common wheat, 44 were under zero-till and 26 under minimum-till, while for durum wheat, 32 were under zero-till, one under minimum-till, and one under conventional-till.
In regards to fungicide use, of the 73 common wheat samples with fungicide use information, 55% had been sprayed with a fungicide, while of the 37 durum wheat samples with fungicide use information, 32% had been sprayed. The most common time of fungicide application was from end-June to mid-July, which would have been at around flowering.
In each field, 50 flag leaves were collected at random and air-dried at room temperature. Percentage of leaf area affected by LS (severity) was recorded for each leaf, and a mean percentage leaf area with LS was calculated for each crop and CD. For crops with the greatest LS and which had not been sprayed with a fungicide, 1-cm2 surface-disinfested leaf pieces were plated on water agar for identification and quantification of the causal LS pathogens.
RESULTS AND COMMENTS: LS symptoms were observed in 41 of the 81 common, and 17 of the 39 durum, wheat crops evaluated in 2020. The rest of the samples collected were too dry for a proper evaluation of LS severity. In individual crops, percentage flag leaf area affected ranged from zero to 12.5% for common wheat, and zero to 6% for durum wheat. Individual samples with ≥5% of the flag leaf area affected constituted 13.6% of the common wheat, and 2.6% of the durum wheat samples. The overall mean percentage of spotting on the flag leaf was 1.1%, which is numerically lower than in the previous three years, 2017 at 2.6%, 2018 at 1.9% and 2019 at 2.6% (Fernandez et al. Citation2018, 2019, 2020). Overall mean LS severity was higher for common (1.4%) than durum (0.4%) wheat (). Most of the province experienced moderate to dry conditions in spring to early summer, the spring in 2020 was drier than in 2019, but 2020 had more moisture throughout the growing season than 2018 or 2017 (, Agriculture and Agri-Food Canada Citation2020).
Crops that had been sprayed with a fungicide(s) had a numerically lower mean LS severity, especially for durum wheat (0.7% and <0.1% for common and durum wheat, respectively), than unsprayed crops (1.6% and 0.6% for common and durum wheat, respectively).
Influence of soil zone and crop district on LS severity:
The Brown soil zone had the lowest mean LS severity for common wheat while the Dark Brown soil zone had the lowest mean LS severity for durum wheat (). In regards to CD, the numerically greatest mean LS severity in common wheat was observed in 5A/5B (east), followed by 8A/8B (north-east), with the lowest mean LS severity being in 9A/9B (north-west) (). For durum wheat, all CDs had a low mean LS severity, with the mean in 3A/3B (south-central) being numerically higher than the rest.
Influence of cultivar on LS severity:
Overall, for the most frequently-grown cultivars, the common wheat ‘AAC Brandon’ (mean LS of 2.1%) and the durum wheat ‘Transcend’ (0.6%) had numerically higher mean LS severities than the overall mean for each of these crop species, while the common wheat ‘CDC Landmark’ (1.4%) and ‘CDC Viewfield’ (<0.1%), and the durum wheat ‘CDC Precision’ (<0.1%), had a lower mean LS severity than their respective overall means.
Causal pathogens:
Pyrenophora tritici-repentis (tan spot) was the most frequently isolated pathogen, especially in durum wheat, followed by the septoria leaf complex (). For common wheat, P. tritici-repentis was isolated at the lowest level, and the septoria leaf complex at the highest level, especially in the Black/Gray soil zone. Cochliobolus sativus (spot blotch) was the least commonly isolated pathogen.
REFERENCES
- Agriculture and Agri-Food Canada. 2020. National Agroclimate Information Service (NAIS), in partnership with Environment Canada. http://www.agr.gc.ca/eng/programs-and-services/drought-watch/agroclimate-maps/?id=1463574557847. [accessed 12 April 2021]
- Fernandez MR, Abdellatif L, Waelchli N, Kenny C, Waelchli F, Ziesman B, Peru C, Hartley S. 2020. Leaf spotting diseases of common and durum wheat in Saskatchewan in 2019. Can Plant Dis Surv. 100:82–85. In, Can J Plant Pathol. 42:sup1.
- Fernandez MR, Kenny C, Abdellatif L, Lokuruge P, Waelchli F, Ziesman B, Peru C, Hartley S. 2019. Leaf spotting diseases of common and durum wheat in Saskatchewan in 2018. Can Plant Dis Surv. 99:126–130. In, Can J Plant Pathol. 41:sup1.
- Fernandez MR, Abdellatif L, Kenny C, Waelchli F, Ziesman B, Stephens D, Hartley S. 2018. Leaf spot diseases of common and durum wheat in Saskatchewan in 2017. Can Plant Dis Surv. 98:135–139.
Fig. 1 Soil zone map with common and durum wheat fields surveyed across Saskatchewan in 2020
Fig. 2 Three-month (May 3-July 31) percentage of average precipitation for 2020 on the Canadian prairies. Normal precipitation is based on 1981–2010 (Agriculture and Agri-Food Canada Citation2020)
DISEASES OF SPRING WHEAT IN OTTAWA, ONTARIO IN 2020
CROP: Spring wheat
LOCATION: Ottawa, Ontario
NAMES AND AGENCIES:
A.G. XUE & Y. CHEN
Ottawa Research and Development Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6Telephone: (613) 759-1513; Facsimile: (613) 759-1926; E-mail: [email protected]
ABSTRACT: Three spring wheat fields located on the Central Experimental Farm (CEF) in Ottawa, Ontario were monitored for the occurrence and severity of diseases during the growing season in 2020. Of the six diseases observed, bacterial leaf blight was the most prevalent, having moderate to severe levels of infection in all three fields. Fusarium head blight (FHB) was observed in all three fields with low severities. Fusarium sporotrichioides was the predominant species isolated from the FHB-infected kernels.
INTRODUCTION AND METHODS: The occurrence and severity of spring wheat diseases on the Central Experimental Farm (CEF) in Ottawa, Ontario were monitored during the 2020 growing season. Three fields located in Central 1, Central 6, and Central 12, respectively, were chosen at random. The fields were approximately 2-km apart.
The development of foliar diseases was monitored by visually estimating disease severity on 10 randomly selected plants at each of three random sites per field, using a rating scale of 0 (no disease) to 9 (severely diseased). Diagnosis was based on visual symptoms. Assessments were carried out six times dated June 11, June 21, July 2, July 9, July 16 and July 23, when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively. Average severity scores of <1, <3, <6 and ≥6 were considered as trace, slight, moderate and severe disease levels, respectively.
Severity of root and head diseases was assessed at the soft dough stage of growth. The severity of take-all was rated as the percent of plants infected at each of the three random sites per field. Fusarium head blight (FHB) was rated for incidence (% infected spikes) and severity (% infected spikelets in the affected spikes) based on approximately 200 spikes at each of the three sites per field. An FHB index ([% incidence x % severity]/100) was determined for each field. Average percentage of infected plants or FHB index values of <5, <10, <20 and ≥20% were considered as slight, moderate, severe and very severe disease levels, respectively.
Determination of the causal species of FHB was based on 60 infected spikes collected from each affected field. The spikes were air-dried at room temperature and subsequently threshed. Sixty discoloured kernels per sample were chosen at random, surface sterilized in 1% NaOCI for 60 s and plated in 9-cm diameter petri dishes on modified potato dextrose agar (10 g dextrose per liter amended with 50 ppm of streptomycin sulphate). The plates were incubated for 10-14 days at 22-25ºC and a 14-hour photoperiod using fluorescent and long wavelength ultraviolet tubes. Fusarium species isolated from kernels were identified by microscopic examination using standard taxonomic keys.
RESULTS AND COMMENTS: Four foliar diseases including bacterial leaf blight (Pseudomonas syringae pv. syringae), septoria/stagonospora leaf blotch (normally associated with the pathogens Zymoseptoria tritici and Parastagonospora spp.), spot blotch (Cochliobolus sativus), and tan spot (Pyrenophora tritici-repentis) were observed during the growing season (). A low level of infections from all four diseases was noticed at the first assessment on June 11, when plants were at the tillering stage of growth. However, these diseases progressed very slowly during the growing season and none had reached a severe level at the soft dough stage when leaves started to naturally senesce. Among these foliar diseases, bacterial blight was noticeably the predominant one throughout the season.
A total of six diseases were observed at the soft dough stage (). Bacterial leaf blight was the predominant foliar disease with average severities of 4.0. Moderate to severe levels of infection from bacterial leaf blight were observed in all three fields. Yield reduction due to this disease was estimated to have averaged <10% in affected fields. Other foliar diseases observed were septoria/stagonospora leaf blotch, spot blotch and tan spot; which occurred at trace to slight levels and caused minimal or no measurable damage to the crop.
Table 1. Prevalence and severity of spring wheat diseases in Ontario in 2020
Take-all (Gaeumannomyces graminis) was observed in all fields at mean incidences of 4.0% (). Moderate infection was observed in one field and the yield reduction was estimated at <3% in affected fields.
FHB was observed in all three fields at a mean FHB index of 0.9% (range 0.3% to 1.5%) (). Moderate to severe FHB infection was not observed. Yield and quality reductions due to FHB were estimated at <1%. Three Fusarium species were isolated from putatively infected kernels (). Fusarium sporotrichioides predominated and occurred in all three fields, isolated from 9.4% of infected kernels and represented 70.5% of the pathogen population causing FHB. Fusarium avenaceum and F. equiseti were less common, occurring in 0.6% and 3.3% of kernels and representing 4.7% and 24.8% of the pathogen population, respectively.
Table 2. Prevalence of Fusarium species isolated from putatively infected wheat kernels in Ontario in 2020
The six diseases observed on spring wheat on the CEF in Ottawa, Ontario in 2020 were among the 12 diseases recorded on spring wheat in the survey of 38 commercial fields across Ontario in 2019 (Xue and Chen 2020). Overall, the incidence and severity of these diseases were generally lower in 2020 than in 2019. The hot and dry weather conditions in June and July 2020 compared with 2019 in Central and Eastern Ontario were likely responsible for the decreased disease severities observed. It is also worth noting that F. graminearum, the principal species causing FHB in North America, was not isolated from the Fusarium-infected kernels in 2020. This result was also in contrast to our previous findings that F. graminearum was the predominant species causing FHB of spring wheat in Ontario during 2001-2017 (Xue et al. 2019). The record hot and dry weather conditions across the province during the growing season in 2020 might be the cause of changes in prevalence among the etiological species causing FHB in spring wheat.
REFERENCES
- Xue AG, Chen Y. 2020. Diseases of spring wheat in Ontario in 2019. Can Plant Dis Surv. 100:92–93. In, Can J Plant Pathol. 42:sup 1.
- Xue AG, Chen Y, Seifert K, Guo W, Blackwell BA, Harris LJ, Overy D. 2019. Prevalence of Fusarium species causing head blight of spring wheat, barley and oat in Ontario during 2001–2017. Can J Plant Pathol. 41(3):392–402. doi:https://doi.org/10.1080/07060661.2019.1582560
Fig. 1 Foliar disease progress curves for bacterial blight (Pseudomonas syringae pv. syringae), septoria/stagonospora leaf blotch (Zymoseptoria tritici and Parastagonospora spp.), spot blotch (Cochliobolus sativus) and tan spot (Pyrenophora tritici-repentis) in spring wheat fields in Ottawa, Ontario in 2020. Each point is the mean of three fields and three sites per field. Severities of these diseases were visually estimated on a scale of 0 to 9, six times during the growing season when plants were at the tillering, booting, heading, flowering, milk, and soft dough stages of growth, respectively
DISEASES OF WINTER WHEAT IN OTTAWA, ONTARIO IN 2020
CROP: Winter wheat
LOCATION: Ottawa, Ontario
NAMES AND AGENCIES:
A.G. XUE & Y. CHEN
Ottawa Research and Development Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, ON K1A 0C6Telephone: (613) 759-1513; Facsimile: (613) 759-1926; E-mail: [email protected]
ABSTRACT: Three winter wheat fields located on the Central Experimental Farm (CEF) in Ottawa, Ontario were monitored for the occurrence and severity of diseases during the growing season in 2020. Of the six diseases observed, bacterial leaf blight and septoria/stagonospora leaf blotch were the most prevalent, each having moderate levels of infection in one of the three fields. Fusarium head blight (FHB) was not observed in any of the three fields.
INTRODUCTION AND METHODS: The occurrence and severity of winter wheat diseases on the Central Experimental Farm (CEF) in Ottawa, Ontario were monitored during the 2020 growing season. Three fields located in Central 3, Central 7 and Scott 4, respectively, were chosen at random. The fields were approximately 2-km apart.
The development of foliar diseases was monitored by visually estimating disease severity on 10 randomly selected plants at each of three random sites per field, using a rating scale of 0 (no disease) to 9 (severely diseased). Diagnosis was based on visual symptoms. Assessments were carried out four times dated June 11, June 27, July 3 and July 10, when plants were at the heading, flowering, milk, and soft dough stages of growth, respectively. Average severity scores of <1, <3, <6 and ≥6 was considered as trace, slight, moderate and severe disease levels, respectively.
Severity of root and head diseases was assessed at the soft dough stage of growth. The severity of take-all was rated as the percent of plants infected at each of the three random sites per field. Fusarium head blight (FHB) was rated for incidence (% infected spikes) and severity (% infected spikelets in the affected spikes) based on approximately 200 spikes at each of the three sites per field. An FHB index ([% incidence x % severity]/100) was determined for each field. Average percentage of infected plants or FHB index values of <5, <10, <20 and ≥20% were considered as slight, moderate, severe and very severe disease levels, respectively.
RESULTS AND COMMENTS: Five foliar diseases were observed during the growing season (). Bacterial leaf blight (Pseudomonas syringae pv. syringae), was the only disease found at the heading stage of growth. Powdery mildew (Blumeria graminis f. sp. tritici) was first observed at the flowering stage. Other diseases including septoria/stagonospora leaf blotch (normally associated with the pathogens Septoria tritici and Stagonospora spp.), spot blotch (Cochliobolus sativus), and tan spot were found at the milk stage. All five foliar diseases progressed very slowly during the growing season and none had reached a severe level by the soft dough stage when leaves started to naturally senesce.
A total of six diseases were observed at the soft dough stage (). Bacterial leaf blight and septoria/stagonospora leaf blotch were equally predominant and the main foliar diseases with average severities of 2.3 and 2.3, respectively. A moderate level of infection from each disease was observed in one field only. Yield reductions due to these diseases were estimated to have averaged <5% in affected fields. Other foliar diseases observed were powdery mildew, spot blotch and tan spot; which occurred at the trace to slight levels and caused minimal to no measurable damage to the crop
Table 1. Prevalence and severity of winter wheat diseases in Ontario in 2020
Take-all (Gaeumannomyces graminis) was observed in one field only at an incidence of 0.5%, with an estimated yield reduction of <1% in affected fields ().
There have been no disease surveys on winter wheat in Ontario for over a decade. The six diseases observed on winter wheat on the CEF in Ottawa, Ontario in 2020 were among the 11 diseases recorded on winter wheat in the survey of 18 commercial fields across Ontario in 2003 and 2004 (Xue et al. Citation2004, Citation2005). Overall, the incidence and severity of these diseases were generally lower in 2020 than in 2003 and 2004. It is also worth noting that FHB, the economically most important disease of wheat in Ontario was not found in 2020. The record hot and dry weather conditions across the province during the growing season in 2020 were likely responsible for decreased disease severities and the lack of FHB symptoms observed.
REFERENCES
- Xue AG, Tenuta A, Chen Y, Sabo F. 2004. Diseases of winter wheat in Ontario in 2003. Can Plant Dis Surv. 84:84–85.
- Xue AG, Tenuta A, Chen Y, Sabo F. 2005. Fusarium head blight of winter wheat in Ontario in 2004. Can Plant Dis Surv. 85:58–59.
Fig. 1 Foliar disease progress curves for bacterial blight (Pseudomonas syringae pv. syringae), septoria/stagonospora leaf blotch (Septoria tritici and Stagonospora spp.), powdery mildew (Blumeria graminis f.sp. tritici), spot blotch (Cochliobolus sativus) and tan spot (Pyrenophora tritici-repentis) in winter wheat fields in Ottawa, Ontario in 2020. Each point is the mean of three fields and three sites per field. Severities of these diseases were visually estimated on a scale of 0 to 9, four times during the growing season when plants were at the heading, flowering, milk, and soft dough stages of growth, respectively
CAUSAL SPECIES OF FUSARIUM HEAD BLIGHT OF SPRING WHEAT AND WINTER WHEAT IN PRINCE EDWARD ISLAND IN 2020
CROP: Spring Wheat and Winter Wheat
LOCATION: Prince Edward Island
NAMES AND AGENCIES:
E. JOHNSTONE, R. MATTERS & A. FOSTER
Agriculture and Agri-Food Canada, Charlottetown Research and Development Centre, 440 University Avenue, Charlottetown, PE C1A 4N6Telephone: (902) 370-1397; Facsimile: (902) 370-1444; Email: [email protected]
ABSTRACT: Prince Edward Island (PEI) experienced a dry growing season resulting in low disease pressure of fusarium head blight (FHB). A total of 20 fields were sampled this season with a collection of 10 wheat spikes from each. Only 14 of 20 fields sampled were found to have Fusarium spp. present. Fusarium spp. were detected in 30.5% of all wheat spikes sampled. Fusarium sporotrichioides was found to be the most abundant species with F. cerealis detected as the second most abundant species. Unlike 2019, fewer isolates were collected in Prince county than Queens or Kings counties which had similar counts based on the number of sampling sites.
INTRODUCTION AND METHODS: A field survey of spring wheat and winter wheat on Prince Edward Island took place to determine the causal species of fusarium head blight. A total of 20 fields were sampled, 13 of which were spring wheat and seven winter wheat (). Post-anthesis (ZGS – 80-92), 10 wheat spikes were collected from each field on June 28 to July 5 for winter wheat and July 28 to August 3 for spring wheat. After ample moisture in May, Prince Edward Island entered a period of moderate drought and abnormally dry conditions. Only 29.5 mm and 44.6 mm of rainfall were recorded in June and July, respectively, at the Environment Canada Weather Station at the Agriculture and Agri-Food Canada Harrington Research Farm. Dry conditions continued into the harvest period.
Collected wheat spikes were surfaced sterilized with 70% ethanol for 30 s then plated onto potato dextrose agar (PDA) amended with 750 μg/mL pentachloronitrobenzene, 50 μg/mL tetracycline, 50 μg/mL streptomycin and incubated for 7 to 10 days at room temperature. Fungal colonies were examined for Fusarium spp. with phenotypes exhibiting pink, purple and red colours with white cottony mycelium. Colonies with these distinct characteristics were sub-cultured onto PDA amended with 100 μg/mL tetracycline and 50 μg/mL streptomycin and incubated at room temperature for an additional 7 to 10 days. Suspected Fusarium spp. were sub-cultured again onto PDA and synthetic nutrient agar. These cultures were placed in cold storage for one month before identification. Identification was carried out by observing morphological indicators as defined in FusKey (Seifert Citation1996) and the Fusarium laboratory manual (Leslie and Summerell 2006). Additional identification was performed by taking mycelia collected from colonies and testing it with PCR using a Phusion HSII High Fidelity Master Mix (ThermoFisher Scientific) and ITS1-F and ITS4 primers (Manter and Vivanco Citation2007), and EF1 and EF2 primers (O’Donnell et al. Citation1998). PCR products were sequenced by Eurofins Genomics (Toronto, Ontario) Sanger Sequencing services and analysed by NCBI BLAST against fungal type and reference material of the internal transcribed spacer region (ITS) database and translation elongation factor 1 (TEF) databases. Deviations from methods used in previous year’s surveys were made to accommodate for limited laboratory access due to COVID-19 restrictions.
RESULTS AND COMMENTS: A total of 200 wheat spikes were collected from which 61 Fusarium spp. isolates were identified in 2020 (). Fusarium spp. were identified in only 14 of 20 fields sampled. As in 2019, Fusarium sporotrichioides, which was isolated from 11 of 14 fields with Fusarium, was the most abundant species. F. sporotrichioides was detected in 14.5% of all wheat spikes sampled in PEI this year. Unlike 2019, Fusarium cerealis was detected this season and isolated in 6.5% of sampled wheat. F. cerealis, while only present at three spring wheat sites and one winter wheat site, was the second most abundant species found across the province. Other Fusarium spp. isolated included F. avenaceum, F. poae and F. graminearum, in 4%, 3.5% and 2% of samples, respectively. F. avenaceum was recorded at seven sites while F. poae and F. graminearum were each recorded at three sites. Weather conditions this season were not conducive to the development of fusarium head blight with only five sampled fields reporting >20% incidence of FHB symptoms. These higher incidences of disease could be attributed to localized periods of prolonged wetness at anthesis or field history, but further investigation of local environmental conditions is required to determine if this was a factor. The highest incidence rating was at a winter wheat site where moisture may have coincided with early anthesis. Fewer isolates were collected from Prince county spikes (2.3 isolates per site) than Queens or Kings counties (≥4.8 isolates per site) in 2020. However, in 2019, fewer isolates were collected from Queens and Kings counties (≤3 isolates per site) than Prince county (7.5 isolates per site). This shift could be due to regional differences in disease pressure or under-sampling of sites in Prince county in 2020 and Kings county in 2019.
Table 1. Incidence of visual FHB and number of Fusarium spp. isolated from wheat spikes in PEI in 2020
ACKNOWLEDGEMENTS: This work was made possible by funding from the Canadian Agricultural Partnership (CAP) AgriScience project led by the Atlantic Grains Council (Project ID: ASP-008).
REFERENCES
- Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Ames (IA): Blackwell.
- Manter DK, Vivanco JM. 2007. Use of the ITS primers, ITS1F and ITS4, to characterize fungal abundance and diversity in mixed-template samples by qPCR and length heterogeneity analysis. J Microbiol Methods. 71(1):7–14. doi:https://doi.org/10.1016/j.mimet.2007.06.016
- O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc Natl Acad Sci. 95(5):2044–2049. doi:https://doi.org/10.1073/pnas.95.5.2044
- Seifert K. 1996. Fuskey-Fusarium interactive key. Ottawa (ON): Agriculture and Agri-Food Canada.
Fig. 1 Google maps screen capture with sample locations indicated and provincial counties labeled
WHEAT AND BARLEY LEAF DISEASE SURVEY IN CENTRAL ALBERTA, 2020
CROP: Wheat and Barley
LOCATION: Alberta
NAMES AND AGENCIES:
S. WATERMAN & K. XI
Field Crop Development Centre, Olds College, 5030 50th Street, Lacombe, AB T4L 1W8Telephone: (403) 782-8026; E-mail: [email protected]
ABSTRACT: In August of 2020, 15 barley, 21 spring wheat fields and the breeding sites of the Field Crop Development Centre (FCDC) were surveyed primarily for foliar diseases in central Alberta. Likely due to a greater amount of precipitation during the growing season of 2020, scald of barley was found in all fields surveyed and the leaf spotting complex of wheat was also higher in severity this year than in 2019. The results of the commercial fields surveyed are reported in detail.
INTRODUCTION AND METHODS: Leaf diseases were surveyed in 15 barley and 21 spring wheat fields in central Alberta at the soft dough stage from August 5 to 13, 2020. Surveyed areas included Kneehill, Mountain View, and Ponoka County within central Alberta. Starting at least 20 m from the field edge, each field was assessed in a W-pattern and rated for disease severity at five to seven points. At each point, plants in a 1-m2 sample were rated using the CIBA scale (Saari and Prescott Citation1975) for scald, netted and spotted form of net blotch, and spot blotch of barley. Spring wheat was assessed for septoria, tan spot, and stripe rust. Any barley or wheat head disease present at the assessment point was noted also. Based on the number of spots recorded in each field, an average disease severity for that field was then calculated. Samples were also collected for pathogen isolation and identification in the laboratory.
RESULTS AND COMMENTS: Results of the barley and wheat surveys for the areas within central Alberta are presented in , respectively. Each field was categorized as light, intermediate, or severe based on disease severity.
Table 1. Disease severity and incidence for 15 barley fields surveyed during the 2020 growing season in central Alberta
Table 2. Disease severity and incidence for 21 spring wheat fields surveyed during the 2020 growing season in central Alberta
Of the 15 barley fields surveyed, 13 were 2-row barley, one was a 6-row and another a mix of 2- and 6-row. Scald was present in all 15 fields with two of them having severe ratings. Netted and spotted net blotch, or spot blotch were found in seven of the barley fields, at light severity levels (). High levels of foliar diseases were observed on barley at the Lacombe and Trochu FCDC breeding sites (data not shown). Only trace levels of stripe rust of barley were observed at the Olds breeding site this year.
For the 21 spring wheat fields surveyed, the leaf spotting complex, involving parastagonospora/septoria leaf blight and tan spot, was observed in 16 fields, with six of them having severe levels of the complex (). Five separate fields had parastagonospora/septoria leaf blight ranging from intermediate to severe levels. Of the 21 spring wheat fields surveyed, five fields in the Rimbey area had only the septoria complex present. Only trace levels of stripe rust were observed in surveyed spring wheat fields this year.
REFERENCES
- Saari EE, Prescott JM. 1975. A scale for appraising the foliar intensity of wheat diseases. Plant Dis Rep. 59:377–380.
CEREAL CROP DISEASE SURVEYS IN NORTH-CENTRAL ALBERTA, 2020CROP: Spring wheat (Triticum aestivum L.), Barley (Hordeum vulgare L.), Oats (Avena sativa L.), Triticale (X triticosecale Wittmack)
LOCATION: North-Central Alberta
NAMES AND AGENCIES:
Y.X. WANG1, K.F. CHANG2, R. FREDUA-AGYEMAN1, F. CAPETTINI2, S.F. HWANG1 & S.E. STRELKOV1
1Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB T6G 2P5Telephone: (780) 492-1969; Facsimile: (780) 492-4265; E-mail: [email protected]
2Field Crop Development Centre, Alberta Agriculture and Forestry, Lacombe, AB T4L 1W8
ABSTRACT: A total of 53 fields, including 39 wheat, 11 barley, two oat and one triticale crop located near Bon Accord, Edmonton, Gibbons, Morinville and Redwater, in north-central Alberta, were surveyed for disease in early to late August, 2020. All foliar diseases were observed at similar rates of incidence and severity compared with 2019. Tan spot of wheat and barley scald were predominant. In contrast, smut, ergot, stripe rust and powdery mildew occurred only at a low incidence in a few fields. Fusarium head blight of barley was identified in one field near Edmonton, with an average incidence of 10.4%.
INTRODUCTION AND METHODS: The occurrence and severity of cereal diseases were estimated visually in 53 cereal crops distributed across north-central Alberta, including the areas around Bon Accord, Edmonton, Gibbons, Morinville, and Redwater (). The crops were surveyed in early to late August, 2020. Leaf blotch (Parastagonospora nodorum), tan spot (Pyrenophora tritici-repentis) and spot blotch (Cochliobolus sativus) of spring wheat sometimes occurred on the same leaves and therefore were evaluated together, with symptoms assessed following Bailey et al. (Citation2003). Seven randomly selected points along a ‘W’-shaped sampling pattern were inspected in each crop. At each of the sampling sites, 100 plants were randomly selected from within a 1-m2 area to determine foliar disease incidence (DI, % plants diseased) and severity (DS). Severity was assessed on a 0-9 scale as described by Xi et al. (Citation2018). The crops also were evaluated for ergot (Claviceps purpurea) and smut (Ustilago tritici, U. nuda), which were recorded as the number of infected spikes/m2. Some diseased leaf samples from each location were collected and transported back to the laboratory for further assessments.
Table 1. Incidence and severity of cereal diseases in 53 fields in northern Alberta in August, 2020
RESULTS AND COMMENTS: Frequent rain showers and thunder storms occurred from late May to mid-August in north-central Alberta (Government of Alberta 2020), resulting in high soil moisture and standing water in many fields, which may have promoted foliar disease development in this region.
Tan spot (P. tritici-repentis) was the most common foliar disease of wheat. The DI of tan spot averaged 94.2% and ranged from 11.2% to 100% depending on the field, while DS averaged 6.8 on a 0-9 scale and ranged from 2.6 to 8.8. Few symptoms of leaf blotch (P. nodorum) or spot blotch (C. sativus) were observed during the surveys. Both powdery mildew (Blumeria graminis) and stripe rust (Puccinia striiformis) were identified in one field each near Redwater at a very low DI, but were localized to one area and occurred at a late growing stage of the crop. No fusarium head blight (FHB) was found. Ergot (C. purpurea) of wheat occurred in six fields near Redwater and Bon Accord, but at a low incidence (<1%). Overall, the incidence of ergot on wheat crops was lower than last year (Chang et al. Citation2020). One crop of triticale near Bon Accord also showed mild symptoms of the disease.
Barley scald (Rhynchosporium commune) was the most prevalent foliar disease and was identified in six of the 11 crops surveyed, with a DI ranging from 15.0% to 100% and averaging 49.0%. The DS ranged from 2.6 to 9.0 and averaged 5.3 on a 0-9 scale. Spot blotch (C. sativus) was found in four crops near Edmonton and Redwater. The spot form of net blotch (Pyrenophora teres f. maculata) occurred together with scald in four crops near Redwater and Gibbons. The mixed infection by these pathogens did not increase the overall disease severity in most cases. Loose smut (U. nuda) of barley occurred in four fields near Edmonton and Morinville, but at a low incidence (<1%). Fusarium head blight (Fusarium graminearum and other Fusarium spp.) was found in one field near Edmonton, with an average incidence of 10.4% and a range of 5% to 20%. It also occurred in two fields near Morinville, but at a very low incidence.
Leaf blotch (Pyrenophora avenae, Stagonospora avenae) of oats was identified in two fields near Edmonton and Redwater. The incidence of leaf blotch ranged from 0 to 56.6% with an average DI of 28.3%. DS ranged from 0 to 4.4 (on a 0-9 scale) with an average of 2.2.
ACKNOWLEDGEMENTS: We gratefully acknowledge the financial support provided by the Department of Agriculture and Forestry, Government of Alberta, and the in-kind support of the University of Alberta. We also thank Shelby Reid, Sturgeon Valley Fertilizers Inc., St. Albert, AB, and Chelsea Tomlinson, True Seeds, Redwater, AB, for providing field locations and grower contact information.
REFERENCES
- Government of Alberta. 2020. Agricultural Moisture Situation Update: July 22, August 5, and August 27, 2020. https://open.alberta.ca/publications/moisture-situation-update [accessed 12 April 2021]
- Bailey KL, Gossen BD, Gugel RK, Morrall RAA. 2003. Diseases of Field Crops in Canada. 3rd ed. Saskatoon (SK): The Canadian Phytopathological Society and University Extension Press, University of Saskatchewan.
- Chang KF, Turnbull GD, Fredua-Agyeman R, Laribi M, Capettini F, Hwang SF, Strelkov SE. 2020. Cereal crop disease surveys in northern Alberta, 2019. Can Plant Dis Surv. 100:86–88. In, Can J Plant Pathol. 42:sup1.
- Xi K, Kumar K, Waterman S. 2018. Wheat and barley disease survey in central Alberta, 2017. Can Plant Dis Surv. 98:100–101.
STRIPE (YELLOW) RUST OF CEREAL IN ALBERTA, 2020
CROP: Wheat
LOCATION: Alberta
NAME AND AGENCY:
R. ABOUKHADDOUR1, R. GOURLIE1, T. DESPINS1, M. HARDING2, H.W. KLEIN-GEBBINCK3, J. FENG4 & B. MCCALLUM5
1Lethbridge Research and Development Centre, Agriculture and Agri-Food Canada, 5403 1st Avenue South, Lethbridge, AB T1J 4B1Telephone: (403) 317-2222; Facsimile: (403) 382-3156; E-mail: [email protected]
2Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticultural Station Road East, Brooks, AB T1R 1E6
3Agriculture & Agri-Food Canada, Lacombe Research Centre, 6000 C&E Trail, Lacombe, AB T4L 1W1
4Alberta Agriculture and Forestry, Crop Diversification Centre North, 17507 Fort Road NW, Edmonton, AB T5Y 6H3
5Morden Research and Development Centre, Agriculture and Agri-Food Canada, 101 Route 100, Morden, MB R6M 1Y5
ABSTRACT: During the 2020 growing season, a total of 80 fields in southern Alberta were surveyed for stripe rust incidence and severity. Data were collected from 57 spring wheat, eight winter wheat, and 14 fields of barley. The area surveyed extended from Carmangay to Warner (north to south) and Etzikom to Granum (east to west) (). Stripe rust was found in two barley, two winter wheat, and 32 spring wheat fields, for a total of 36 (45%) infected fields. The highest severity rating of 75% was reported on spring wheat near Etzikom, however, this field had very low incidence of infection. The highest severity rating, 50%, combined with a high incidence, 100%, was found in a spring wheat field near Warner. Compared to previous years, stripe rust was very prevalent this year and with higher than average severity. Trap nurseries were set up at Lethbridge, Brooks, Edmonton and Beaverlodge, AB and at Morden, MB. At each site, 18 resistance genes in the Avocet background were tested under natural infection conditions. The genes Yr1, Yr5, Yr15, and YrSp were resistant to stripe rust infection at all sites in summer 2020.
INTRODUCTION AND METHODS: Monitoring disease incidence and severity over time is an essential component of disease management. Commercial fields of winter and spring wheat, and spring barley in several counties in the region of southern Alberta were surveyed from mid-July to early August, 2020. Fields were inspected in “W” pattern until 10 sites separated by approximately 25 m were evaluated for both disease incidence and severity. Incidence ratings are reported as the number of infected plants within 1-m2, and severity as the average percent of the total leaf surface area covered with stripes or pustules per plant. Fields were classified based on the severity of infection as: clean (0%), trace & light (1-5%), moderate (6-15%) and severe (>15%).
Single replicate field trap nurseries were setup in Brooks, Beaverlodge, Edmonton and Lethbridge, Alberta to represent south, central and northern Alberta and in Morden, Manitoba, using a race-differential set which consists of 18 lines, each of which contains a single stripe rust resistance gene (Yr1, Yr5, Yr15, Yr6, Yr7, Yr8, Yr9, Yr10, Yr17, Yr24, Yr27, Yr32, Yr43, Yr44, Yr76 [Tyee], Sp, Exp2, Tr1) in the susceptible Avocet parent background (Wellings et al. Citation2009).
RESULTS AND COMMENTS: In total, 80 commercial fields were surveyed in the summer of 2020. Nearly half of all fields surveyed contained stripe rust with 18 (22.5%) having light or trace levels of infection, eight (10%) rated as moderate, and 10 (12.5%) had severe infection (, ). The incidence and severity of stripe rust infection was very high relative to the past three years with 2016 being the last year having similar levels of infection. Cool, wet weather during critical periods of the early growing season, combined with a reportedly high inoculum load coming from the Pacific Northwest region of the United States early in the spring are the likely causes of the increase of stripe rust in 2020.
Table 1. Number of wheat and barley fields surveyed and the corresponding stripe rust severity levels recorded in southern and central Alberta during the summer of 2020, 2019, 2018, 2017 and 2016
In Alberta, the trap trials showed that isogenic lines with Yr-genes Yr1, Yr5, Yr15, and YrSp were resistant to stripe rust and these genes were still effective at all locations (). Several other genes: Yr10, Yr17, YrExp2, and Yr76 (Tyee) were effective at three of the four locations, but failed to prevent infection in Beaverlodge. Beaverlodge was the most northern and most severely affected site; it is possible that inoculum delivered to this region was from a different source than the more southern sites. Subsequent race characterization from this location should clarify these results. In Morden, no stripe rust was detected on any of the tested lines, which indicates that conditions this year were not conducive for stripe rust infection in the eastern prairies. It is worth nothing that resistance gene Yr24 seemed to be defeated in most locations this year.
Table 2. Severity of natural stripe rust infection (percentage of leaf area covered with pustules) on a set of 18 differential wheat lines in the susceptible Avocet background grown at four sites in Alberta: Brooks, Lethbridge, Beaverlodge and Edmonton
REFERENCES
- Wellings C, Singh R, Yahyaoui A, et al.. 2009. The development and application of near-isogenic lines for monitoring cereal rust pathogens. In Proceedings of Oral Papers and Posters, 2009 Technical Workshop, BGRI, Cd. Obregón, Sonora, Mexico.
Fig. 1 Locations of cereal fields surveyed for incidence and severity of stripe rust in southern Alberta, July 2020. Severity as percentage of leaf covered with stripes: green = 0%; yellow = <5%; orange = 5 to 15%; red = >15%. Incidence as estimated percentage of total field infected: small circle = <5%; circle with square = 5 to 15%; circle with diamond = >15%
CEREAL SMUT SURVEYS IN MANITOBA, 2020
CROPS: Spring Wheat, Barley, Oat, Rye
LOCATION: Manitoba
NAMES AND AGENCIES:
J.G. MENZIES, Z. POPOVIC, S. DECEUNINCK & H. DERKSEN
Morden Research and Development Centre, Agriculture and Agri-Food Canada, 101 Route 100, Morden, MB R6M 1Y5Telephone: (204) 822-7522; Facsimile: (204) 822-7507; E-mail: [email protected]
ABSTRACT: Fifty-three fields of hexaploid spring wheat, 10 fields of 2-row barley and 25 fields of oats were assessed for the smut diseases caused by Ustilago spp. in Manitoba in 2020. No smutted plants were observed in any of the fields.
INTRODUCTION AND METHODS: Field surveys in Manitoba were conducted during July 7th and July 9th, 2020, to assess the incidence and severity of the smut diseases caused by Ustilago hordei, U. nigra, U. nuda, U. tritici, U. avenae and U. kolleri. The area surveyed in Manitoba included crop districts 1, 2, 7, 8, 9 and 11. Fields were selected at random at approximately 15-30 km intervals, depending on the frequency of the crops in the area. An estimate of the percentage of infected plants (i.e., plants with sori) was made while walking an ovoid path of approximately 100 m in each field. Levels of smut greater than trace were estimated by counting plants in a one m2 area at a minimum of two sites on the path. Fields with <0.01% were considered as having trace infection levels.
An isolate of smut was collected from each field with smutted plants in Manitoba. This was compared with a carboxin-sensitive isolate, ‘72-66ʹ, of U. nuda from Canada, and a carboxin-resistant isolate, ‘Viva’, of U. nuda (Newcombe and Thomas 1991) from France, using the teliospore germination assay of Leroux (Citation1986) and Leroux and Berthier (Citation1988) to determine resistance to the fungicide carboxin. Teliospores of each isolate were streaked onto half-strength potato dextrose agar (PDA) amended with 1.0 μg mL−1 of carboxin or unamended PDA. The cultures were incubated at 20oC in a controlled environment chamber and examined for teliospore germination after 24 h.
RESULTS AND COMMENTS: No smutted plants (infected with U. tritici) were observed in 53 fields of hexaploid spring wheat assessed in Manitoba in 2020. No fields of durum were assessed. Ten fields of 2-row barley were assessed, with no smut-infected plants (U. nuda) observed. No fields of 6-row barley were assessed. No smut-infected plants were observed among the 25 oat fields surveyed.
REFERENCES
- Leroux P. 1986. Caractéristiques des souches d’Ustilago nuda, agent du charbon nu de l’orge, résistantes à la carboxine. Agronomie 6(2):225–226. doi:https://doi.org/10.1051/agro:19860213
- Leroux P, Berthier G. 1988. Resistance to carboxin and fenfuram in Ustilago nuda (Jens.) Rostr., the causal agent of barley loose smut. Crop Prot. 7(1):16–19. doi:https://doi.org/10.1016/0261-2194(88)90031-2
- Newcombe G, Thomas PL 1991. Incidence of carboxin resistance in Ustilago nuda. Phytopathology 81(3):247–250. doi:https://doi.org/10.1094/Phyto-81-247
SEED-BORNE FUSARIUM ON CEREAL CROPS IN SASKATCHEWAN IN 2019
CROP: Cereal crops (Wheat, Durum, Barley and Oats)
LOCATION: Saskatchewan
NAMES AND AGENCIES:
B. OLSON1, B. ERNST2, S. FATIMA3, M. JAPP4, S. JUNEK5, H.R. KUTCHER6, T. PRASAD7 & J. WENAUS3.
1Box 88, Hazlet, SK S0N 1E0Telephone: (306) 774-5643; E-mail: [email protected]
2Prairie Diagnostic Seed Lab, 1105 Railway Ave., Weyburn, SK S4H 3H
320/20 Seed Labs Inc., 507-11th Ave., Nisku, AB T9E 7N5
4Saskatchewan Ministry of Agriculture, 3085 Albert St., Regina, SK S4S 0B1
5Discovery Seed Labs Ltd., 450 Melville St., Saskatoon, SK S7J 4M2
6Crop Development Centre, University of of Saskatchewan, 51 Campus Dr., Saskatoon, SK S7N 5A8
7Lendon Seed Lab, 147 Hodsman Road, Regina, SK S4N 5W5
ABSTRACT: Commercial plate tests from four seed labs for seed-borne Fusarium graminearum and total Fusarium spp. in 2019 are summarized. A total of 2361 wheat, 1030 durum, 899 barley, and 239 oat samples were reported in 2019. Compared to 2018, the combined frequency of F. graminearum-free samples declined to 59.4% and mean percent infection rates were up slightly at 1.8%. Total Fusarium spp. frequency and severity increased compared to those reported in 2018.
INTRODUCTION AND METHODS: Test results from four seed testing laboratories were acquired and combined. These tests were from either agar-plating or quantitative PCR techniques. In the case of PCR tests, the presence or absence of DNA of all Fusarium spp. or of F. graminearum allowed calculation of percent infection. No attempt to select fusarium-damaged kernels (FDK) was performed, so the samples can be considered random. The percent frequency of all Fusarium spp. including F. graminearum (total Fusarium) and the percent frequency of F. graminearum alone were calculated. The mean percent infection was calculated for both total Fusarium spp. and F. graminearum. Individual Fusarium spp. (other than F. graminearum) were not reported, as not all labs provided that information. The results of 4529 tests were combined and reported by Saskatchewan Crop Districts, and provincial means were determined. The tests were conducted from September of 2019 through May 2020 and were assumed to be from the 2019 crop.
RESULTS AND COMMENTS: The 2019 crop year began with cool dry conditions delaying seeding (Saskatchewan Ministry of Agriculture Citation2019). By the beginning of June, however, seeding was largely finished in line with 5 year averages. Germination was patchy with slow crop growth. Conditions remained very dry until mid-summer when substantial rainfall was received. Cool, wet conditions in late September and October resulted in much of the crop harvested tough or damp. Quality was below average for almost all crops due to sprouting, staining and bleaching.
Cereal yields, with the exception of durum, were in line with 5-year averages (Saskatchewan Ministry of Agriculture Citation2019). The average wheat yield was 45 bu/acre compared to the 5 year average of 44.3 bu/acre. Durum yield was 39 bu/acre compared to the 5-year average of 41.2 bu/acre. Average barley yield was 66 bu/acre in line with the 5-year average of 63.3 bu/acre. Oat yield was unchanged at 88 bu/acre down slightly from the 5-year average of 91.8 bu/acre.
A total of 2361 wheat, 1030 durum, 899 barley and 239 oat samples were processed during the period covered by this report. Compared to 2018, this represented an increase in samples of durum (43.3%), oats (35.0%), wheat (30.3%) and barley (50.8%) (Olson et al. Citation2020b).
Fusarium graminearum frequency and severity (mean % infection) was calculated for wheat, durum, barley, and oat individually and combined. Frequency and severity of total Fusarium spp. was calculated individually and combined as well (–). The frequency of F. graminearum was 40.6%. This was significantly higher than the 22.0% reported in 2018 and 23.1% in 2017 (Olson et al. Citation2020a, b). Severity of F. graminearum increased as well (). Total Fusarium frequency was 82.4%, which was up from the previous year (). Total Fusarium severity was 4.5%, up from the 3.3% reported in 2018 ().
Table 1. Five-year summary of frequency (% PFS) and severity (mean % infection) of Fusarium graminearum and total Fusarium spp. of wheat, durum, barley and oat combined
Table 2. Number of wheat samples tested from September 2019 to May 2020 and levels of infection with Fusarium graminearum and Fusarium spp. in each Saskatchewan Crop District
Table 3. Number of durum samples tested from September 2019 to May 2020 and levels of infection with Fusarium graminearum and total Fusarium spp. in each Saskatchewan Crop District
Table 4. Number of barley samples tested from September 2019 to May 2020 and levels of infection with Fusarium graminearum and total Fusarium spp. in each Saskatchewan Crop District
Table 5. Number of oat samples tested from September 2019 to May 2020 and levels of infection with Fusarium graminearum and total Fusarium spp. in each Saskatchewan Crop District
Wheat – The percentage of F. graminearum-free samples in 2019 was 56.1% (), down from the 76.4% reported in 2018 (Olson et al. Citation2020b). The mean infection rate was 1.8%, also up from the 1.3% reported in 2018. Total Fusarium spp.-free samples were 15.0% compared to 27.8% in 2018. The mean percent infection increased from 2018 at 4.9%.
Durum – Of the 1030 samples, 52.0% were found to be F. graminearum-free. Mean percent infection was 2.2% (). In 2018, the frequency of F. graminearum-free samples was 75.1% and the mean percent infection was 1.7% (Olson et al. Citation2020b). The total Fusarium spp.-free frequency was 23.0%, down from 38.0% reported in 2018 and the mean percent infection was 3.8%, up from the 2.0% in 2018.
Barley – F. graminearum-free samples were 69.9% in 2019, down from 81.5% in 2018 (Olson et al. Citation2020b). Mean infection was 1.3% compared to 1.4% in 2018. Total Fusarium spp.-free samples were 19.7%, down from 21.6% in 2017 (Olson et al. Citation2020a). Total Fusarium spp. mean infection was 3.8%, up from 3.3% in 2018 ().
Oat – Samples tested for F. graminearum were found to be 84.5% pathogen-free. This was lower than the 92.7% of 2018 (Olson et al. Citation2020b). Mean infection was 0.8%, up slightly from 0.6% reported in 2018. Total Fusarium spp.-free samples was 13.8% down from the 16.9% in 2018. Total Fusarium spp. mean infection was 6.2%, down from 7.4% in 2018. ().
The combined total Fusarium-free samples dropped slightly from 28.4% in 2018 to 17.6% in 2019 (). Combined mean infection rates remained low at 4.5%. Combined F. graminearum-free samples declined from 78% in 2018 to 59.4% in 2019 and the combined mean % infection rates were not significantly changed from 2018 at 1.8% ().
ACKNOWLEDGEMENTS: We would like to acknowledge the cooperation of 20/20 Seed Labs Inc., Lendon Seed Lab, Prairie Diagnostic Seed Lab, and Discovery Seed Labs Ltd. in providing seed testing results that made this report possible. We also wish to acknowledge the funding support of the Saskatchewan Wheat Development Commission, the Saskatchewan Barley Development Commission and the Saskatchewan Oat Development Commission.
REFERENCES
- Olson BD, Blois T, Ernst B, Junek S, Kutcher HR, Ziesman B. 2018a. Seed-borne Fusarium on cereal crops in Saskatchewan in 2015. Can Plant Dis Surv. 98:83–87.
- Olson BD, Blois T, Ernst B, Junek S, Kutcher HR, Ziesman B. 2018b. Seed-borne Fusarium on cereal crops in Saskatchewan in 2016. Can Plant Dis Surv. 98:88–92.
- Olson BD, Blois T, Ernst B, Japp M, Junek S, Kutcher HR, Prasad T, Ziesman B. 2020a. Seed-borne Fusarium on cereal crops in Saskatchewan in 2017. Can Plant Dis Surv. 100:96–99. In Can J Plant Pathol. 42:sup1.
- Olson BD, Blois T, Ernst B, Japp M, Junek S, Kutcher HR, Prasad T, Ziesman B. 2020b. Seed-borne Fusarium on cereal crops in Saskatchewan in 2018. Can Plant Dis Surv. 100:100–103. In Can J Plant Pathol. 42:sup1.
- Saskatchewan Ministry of Agriculture. 2019. 2019 Crop Reports. Regina (SK). https://pubsaskdev.blob.core.windows.net/pubsask-prod/114689/Crop-Report-FInal-November-12-18-2019-complete.pdf. [accessed 12 April 2021]
2020 WHEAT DISEASE SURVEY IN SOUTHERN ALBERTA
CROP: Wheat
LOCATION: Southern Alberta
NAMES AND AGENCY:
B.L. PUCHALSKI & B.J. PUCHALSKI
Paramoria Agri-Science, 216 23rd St. S., Lethbridge, AB T1J 3M6Telephone: (403) 328-5036; E-mail: [email protected]
ABSTRACT: In 2020, 166 random commercial wheat fields were surveyed for foliar leaf disease levels and the application of fungicides in southern Alberta. The most prevalent diseases found were stripe rust and tan spot, with census district 1 having the highest prevalence of stripe rust at 40%, and district 2 the highest for tan spot at 27%. The stripe rust incidence and severity observed suggests that the effectiveness of current varieties resistance is in decline. Half of all fields surveyed were not sprayed with fungicides, with half of those fields experiencing minimal disease, suggesting farmers are forgoing fungicide applications.
INTRODUCTION AND METHODS: From June 22, 2020 until August 10, 2020, 166 wheat fields within 10 of the 12 counties in southern Alberta were confirmed by conversations with seed growers servicing the area. Sprayed fields were determined by the presence of sprayer tracks or by the complete absence of all active fungal pathogens on the crop and on the weedy grassy species within the crop and crop margins. Fields surveyed were re-examined within two weeks to confirm diagnosis. Severity and incidence were recorded for stripe rust (Puccinia striiformis), leaf spots (Parastagonospora nodorum and Septoria tritici), fusarium head blight (FHB) (Fusarium graminearum and other Fusarium spp.), powdery mildew (Blumeria graminis), and when unusual disease events were encountered. Ten sites within each field were selected by following a “V” pattern towards the center of field. Disease severity of stripe rust was determined by using a modified Cobbs scale for 20 infected leaves (Peterson et al. Citation1948). Leaf spot severity was evaluated using a modified scale of leaf area diseased for 20 random leaf spot-infected leaves (Adee and Pfender 1989). Stripe rust severity was assessed on infected leaves instead of random leaves due to the risk of type II error. Progression of disease was confirmed in subsequent visits to fields. FHB was also determined visually by the number of bleached heads showing FHB symptoms.
RESULTS AND COMMENTS: Southern Alberta experienced significant rain events during May 19-21 and June 27-30, where daily accumulation was 40 mm for each event (Alberta Agriculture 2020). The Vulcan region over a 3-day period from June 27-29 experienced 70 mm of rainfall. The wet conditions stalled ground spraying operations and when conditions were dry, winds often exceeded operational limits for spraying effectively.
Stripe rust was found in all surveyed census districts except district 3 (). District 1 had the highest prevalence of stripe rust, with 40% of the surveyed fields being infected. District 2 had the highest average incidence and severity of stripe rust, at 21.2% and 10.1% respectively, followed by district 1 which had 1.6% average incidence and 5.2% average severity. All classes of wheat showed levels of infection higher than what the presently grown varieties would suggest, considering their reported resistances. Current resistance genes may be leaking in the face of emerging new stripe rust strains.
Table 1. Stripe rust incidence and severity on wheat in southern Alberta in 2020
Tan spot was found in all districts surveyed (). While present, however, the prevalence of tan spot was only significant in district 2, with 27% of the surveyed fields being infected. Average incidence and severity of tan spot in district 2 was 39.6% and 9.9% respectively, comparable to stripe rust’s numbers for the year. Most fields observed however had minor infections, the data being skewed by heavily infested fields near Magrath and Highway 36.
Table 2. Tan spot incidence and severity on wheat in southern Alberta in 2020
For the time surveyed, an insignificant number of fields were found with FHB and powdery mildew. FHB was likely present, but diagnostic symptoms at the time were not conclusive.
Fungicide appears not to have been applied to approximately half of all spring and winter wheat surveyed in southern Alberta (). Thirty percent of spring and winter wheat fields, experienced zero to light disease pressure for all foliar diseases when surveyed. Moderately and severely infected fields constituted 19% of the surveyed winter wheat fields and 22% of the spring wheat fields. More fields of durum were proportionally sprayed compared to the others, though that may be the result of insufficient sampling. Fungicide application, as indicated by the presence of sprayer tracks, and lack of disease progression over subsequent visits within crops and in headlands, generally resulted in disease-free fields, yet the most affected fields surveyed showed symptoms of chemical damage as well as signs of severe disease pressure. Despite potential disease risks, a significant population of wheat producers appear to be forgoing one or more fungicide applications.
Table 3. Application of fungicides and disease pressure found on surveyed wheat fields
REFERENCES
- Adee EA. 1989. The effect of primary inoculum level of Pyrenophora tritici-repentis on tan spot epidemic development in wheat. Phytopathology 79(8):873–877. doi:https://doi.org/10.1094/Phyto-79-873
- Alberta Agriculture. 2020. Current and historical Alberta weather station data viewer. http://agriculture.alberta.ca/acis/weather-data-viewer.jsp [accessed 19 April 2021]
- Peterson RF, Campbell AB, Hannah AE. 1948. A diagrammatic scale for estimating rust intensity on leaves and stems of cereals. Can J Res. 26c(5):496–500. doi:https://doi.org/10.1139/cjr48c-033
OILSEEDS, PULSES, FORAGES AND SPECIAL CROPS/OLÉAGINEUX, PROTÉAGINEUX, PLANTES FOURRAGÈRES ET CULTURES SPÉCIALES
CANOLA AND MUSTARD DISEASE SURVEY IN ALBERTA, 2020
CROP: Canola and Mustard
LOCATION: Alberta
NAMES AND AGENCIES:
M.W. HARDING1, G.C. DANIELS1, D.A. BURKE1, C.A. PUGH1, T.B. HILL1, K. ZAHR2, A. SARKES2 & J. FENG2
1Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticulture Station Road E., Brooks, AB T1R 1E6Telephone: (403) 362-1338; Facsimile: (403) 362-1326; E-mail: [email protected]
2Alberta Agriculture and Forestry, Crop Diversification Centre North, 17507 Fort Road NW, Edmonton, AB T5Y 6H3
ABSTRACT: Diseases of canola and mustard can cause yield loss, reductions in quality, and affect market acceptability. Blackleg, sclerotinia stem rot and verticillium stripe were evaluated in fields representing approximately 1% of canola acres in Alberta in 2020. Three hundred and fifty canola fields and five mustard fields were surveyed and found to have disease levels lower than those of recent years. Prevalence of blackleg and stem rot was 45% and 5%, respectively, and disease incidence was 6.4% and 0.72%, respectively. Verticillium stripe was not found.
INTRODUCTION AND METHODS: Canola (Brassica napus L.) is an important field crop in Alberta that was produced on 5.9 million acres in 2020 (Statistics Canada 2020). Additionally, mustard (Brassica spp. L.) was also grown on approximately 257,000 acres in southern Alberta and Saskatchewan (Statistics Canada 2020). Leptosphaeria maculans (Sowerby) P.Karst., the causal agent of blackleg, can cause disease symptoms on all above-ground parts of canola. Alberta’s 2020 canola disease survey targeted 1% of canola fields in each county/municipality as defined by the 2016 Agricultural Census for Alberta (Statistics Canada Citation2017). In total, 350 canola fields and five mustard fields were surveyed in 54 counties and municipal districts across the province (). The purpose of the survey was primarily to evaluate blackleg disease on canola (and mustard) in Alberta; other stem and root diseases were evaluated as well. Surveyors were encouraged to visit fields near swathing time, or within seven days post-swathing. Ten stems were collected at each of ten locations along a W-shaped survey transect. Sampling locations were ≥ 20 m from one another, and from field margins. The lower stems (bottom 6-12 in (15-30 cm)) were collected at each sampling location for a total of 100 stems per field. All stems were sent directly to the Crop Diversification Centre South, Brooks, AB where they were evaluated for the presence of blackleg symptoms such as stem cankers, lesions with pycnidia and internal stem blackening. Blackleg prevalence was calculated as the percentage of fields with symptoms and incidence as the percentage of stems showing blackleg symptoms. Blackleg severity was estimated using a 0-5 scale for rating vascular discolouration (WCC/RRC 2009; ).
Table 1. A rating scale to estimate blackleg severity on canola (WCC/RCC 2009)
Three other diseases were also evaluated on the roots and lower main stems. Sclerotinia stem rot (S. sclerotiorum Lib. de Bary) infections occurring on lower main stems were recorded when they were soft and would shred when twisted, and/or when sclerotia were observed inside the stem. Prevalence was calculated as percentage of fields with stem rot and incidence as percentage of stems showing symptoms. Stem rot severity was not calculated. Symptoms of verticillium stripe (Verticillium longisporum (C. Stark) Karapapa, Bainbr. & Heale (1997) also were recorded when discoloration of the internal stem tissues appeared in a ‘starburst’ pattern, rather than sectoring. Verticillium stripe prevalence and incidence were calculated in the same manner as for sclerotinia stem rot. Colonization of symptomatic host tissues by V. longisporum was confirmed by probe-based qPCR using the primers/probe set: GGGAGGACTCACAGATCGAA/CCGTGAATTCAGAGGCAGAT/6FAM-TCACGACCTCTGGTCATGAC-IABkFQ. When the test for V. longisporum was negative, the same DNA sample was tested by qPCR for Verticillium albo-atrum and V. dahliae using the primer/probe sets as described by Maurer et al. (Citation2013), and for Leptosphaeria maculans using primer/probe set: CCTCACACTCTCGACCCCTA/GCATGTTCTTGAACCGCTAC/HEX/CACAGCCATATCATCCTGCA/IABkFQ, and for L. biglobosa using the primer/probe set: GAAGAATGGCAAAATCACAGG/AGCTCTGCGCGACCTTTT/6FAM/AGGAAGAAGCAGCCATAGGC/IABkFQ. For all qPCR tests, DNA from healthy canola plants as well as the corresponding fungal culture and known infected plant samples were included as controls. Finally, clubroot symptoms were rated and recorded and the results presented in a separate report.
RESULTS AND COMMENTS: Of the 350 canola fields, and five mustard fields evaluated, 161 were found to have blackleg symptoms for an overall prevalence of 45.4% (). The average incidence of blackleg on canola and mustard stems was 6.4%, while overall average severity was 0.08 on a 0 to 5 scale. These prevalence, incidence and severity values were the lowest reported in recent years (Harding et al. Citation2020, 2019, Citation2018), and suggested that blackleg remains relatively widespread, is generally not severe, and is not increasing in prevalence (; ).
Table 2. Blackleg prevalence, incidence and severity in canola fields in Alberta in 2020
Sclerotinia stem rot was observed in 19 of 355 fields for a prevalence of 5.3% and mean disease incidence of 0.7% (). This was also lower than the prevalence and incidence of stem rot in recent years.
Table 3. Prevalence and incidence of sclerotinia stem rot on canola lower main stems in Alberta, 2020
Finally, symptoms of verticillium stripe were seen in four fields, but PCR analyses of all samples gave negative test results for the presence of V. longisporum, V. albo-atrum and V. dahliae. Instead, Leptosphaeria maculans, but not L. biglobosa, was identified within symptomatic tissues in three out of the four fields.
ACKNOWLEDGEMENTS: We gratefully acknowledge the significant contributions of the Alberta Association of Agricultural Fieldmen, and their staff, for assistance with collecting canola stems from across the province. Finally, we express appreciation for the landowners and producers that allowed access to their fields.
REFERENCES
- Harding MW, Daniels GC, Burke DA, Pugh CA, Hill TB, Zahr K, Sarkes A, Feng J. 2020. A survey for blackleg and sclerotinia stem rot on canola in Alberta in 2019. Can Plant Dis Surv. 100:113–116. In Can J Plant Pathol. Vol. 42:sup 1.
- Harding MW, Daniels GC, Pugh CA, McConnell CL, Hill TB, Burke DA, Zuzak K, Zahr K, Sarkes A, Feng J. 2019. A survey for blackleg and sclerotinia stem rot on canola in Alberta in 2018. Can Plant Dis Surv. 99:126–128. In, Can J Plant Pathol. Vol. 41:sup 1.
- Harding MW, Hill TB, Daniels GC, Rennie DC, Zuzak K, Feng J, McDonald J. 2018. A survey for blackleg and sclerotinia stem rot on canola in Alberta in 2017. Can Plant Dis Surv. 98:164–168.
- Karapapa VK, Bainbridge BW, Heale JB. 1997. Morphological and molecular characterization of Verticillium longisporum comb, nov., pathogenic to oilseed rape. Mycol Res. 101(11):1281–1294. doi:https://doi.org/10.1017/S0953756297003985
- Maurer KA, Radišek S, Berg G, Seefelder S. 2013. Real-time PCR assay to detect Verticillium albo-atrum and V. dahliae in hops: development and comparison with a standard PCR method. J Plant Dis Protect. 120(3):105–114. doi:https://doi.org/10.1007/BF03356461
- Statistics Canada. 2020. Principal field crop areas, June 2020. https://www150.statcan.gc.ca/n1/daily-quotidien/200629/dq200629c-eng.htm [accessed 2020 Dec 4]
- Statistics Canada. 2017. The 2016 census of agriculture. https://www.statcan.gc.ca/eng/ca2016 [accessed 2021 Jan 27]
- Western Canada Canola/Rapeseed Recommending Committee (WCC/RRC) Incorporated. 2009. Procedures of the Western Canada Canola/Rapeseed Recommending Committee for the evaluation and recommendation for registration of canola/rapeseed candidate cultivars in western Canada.
Fig. 1 Location and severity of blackleg symptoms in 350 canola fields and five mustard fields in 2020
THE OCCURRENCE AND SPREAD OF CLUBROOT ON CANOLA IN ALBERTA IN 2020
CROP: Canola
LOCATION: Alberta
NAMES AND AGENCIES:
S.E. STRELKOV1, V.P. MANOLII1, Y. AIGU1, M.W. HARDING2, S.F. HWANG1, & G.C. DANIELS2
1Department of Agricultural, Food and Nutritional Science, University of Alberta, 410 Agriculture/Forestry Centre, Edmonton, AB T6G 2P5Telephone: (780) 492-1969; Facsimile: (780) 492-4265; E-mail: [email protected]
2Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticultural Station Road East, Brooks, AB T1R 1E6
ABSTRACT: A survey of 620 canola (Brassica napus) and four mustard (Brassica juncea) crops in Alberta identified 66 new records of clubroot, caused by Plasmodiophora brassicae. All positive identifications occurred on canola, with 39 crops mildly infected, 24 moderately infected and three crops severely infected. An additional 313 cases of clubroot were found during inspections by county and municipal personnel, for a grand total of 379 confirmed infestations recorded in 2020. These included the first reports of clubroot in the Municipal District of Smoky River and in the counties of Grande Prairie and Wheatland.
METHODS: A survey for the occurrence and severity of clubroot, caused by Plasmodiophora brassicae Wor., was carried out in 620 canola (Brassica napus L.) and four mustard (Brassica juncea L. Czern.) crops across Alberta in 2020. Most crops were visited after swathing, and selected either randomly or because there had been reports of clubroot in the area. Briefly, about 50-100 canola roots were sampled from a 20-30 m2 area near the entrance to each field, and examined visually for symptoms of clubroot. If symptoms were observed, the entire crop was surveyed more extensively by sampling the roots of all plants within a 1-m2 area at each of 10 points along a ‘W’ sampling pattern. If no symptoms were found, then the crop was not sampled further, since clubroot is most commonly identified near field entrances (Cao et al. Citation2009). The sampled plants were evaluated for clubroot symptom severity on a 0-3 scale following Kuginuki et al. (1999), where 0 = no galling, 1 = a few small galls, 2 = moderate galling and 3 = severe galling. The ratings on the individual plants were used to calculate a disease severity index (DSI) for each crop according to the formula of Horiuchi and Hori (Citation1980) as modified by Strelkov et al. (Citation2006):
DSI (%) = [((n × 0) + (n × 1) + (n × 2) + (n × 3))/(N × 3)] × 100, where 0, 1, 2 and 3 are the symptom severity classes, n is the number of plants in each class, and N is the total plant number. Crop visits were coordinated with the agricultural fieldman in each county or municipal district. Whenever possible, survey information from independent inspections conducted by the fieldmen was collected and combined with the data from the Alberta-wide clubroot survey.
RESULTS AND COMMENTS: Root galling typical of clubroot was observed in 66 of the 620 canola crops surveyed (), while no symptoms were found in any of the four mustard crops visited. Clubroot severity in 39 of the symptomatic crops was mild, with an average DSI < 10%. Moderate levels of clubroot (DSI = 10-60%) were found in another 24 crops, while three crops were severely (DSI > 60%) infected. In addition to the 66 records of clubroot identified in the province-wide survey, 313 cases of the disease were recorded during independent inspections by agricultural fieldmen, for a total of 379 confirmed infestations in 2020 (). These included the first reports of clubroot in the Municipal District of Smoky River and in the counties of Grande Prairie and Wheatland ().
Table 1. Distribution of Plasmodiophora brassicae-infected canola crops identified in Alberta in 2020
The identification of clubroot in two more districts (Smoky River and Grande Prairie) in the Peace River region of northwestern Alberta indicates further spread of the disease into this important canola-producing area, where clubroot was not identified until 2017 (Strelkov et al. Citation2021). Similarly, the confirmation of the disease for the first time in Wheatland County suggests the continued spread of clubroot into southern Alberta (). In contrast, Special Area 3, where a single putative case of clubroot was reported in 2012 (Strelkov et al. Citation2013), has been removed from the list of districts with confirmed infestations, as the disease has not been identified there in the past eight years. Since the start of clubroot surveillance in 2003, the disease has been confirmed in 44 counties and municipal districts in Alberta, as well as in rural areas of the cities of Edmonton and Medicine Hat, and the Town of Stettler. Only 22 of the 66 counties, municipal districts and special areas growing canola within the province do not have an official report of the disease.
ACKNOWLEDGEMENTS: The authors thank T. Adolf, J. Babcock, D. Beckett, G. Bloom, N. Boulet, H. Brook, C. Erichsen-Arychuk, J. Fulton, J. Guidolin, A. Hampton, E. Kozak, K. Langlois, C. McIntosh, D. McNaughton, S. Miller, R. Muenchrath, H. Musterer, A. Ouellett, L. Poile, T. Ponath, J. Porter, J. Robley, J. Schwindt, F. Sherlock, C. Verpy and C. Wolf for their assistance with the survey. This report would not have been possible without the financial support provided by Alberta Canola and the Strategic Research and Development Program of Alberta Agriculture and Forestry. In-kind support from Alberta Agriculture and Forestry, the University of Alberta, and the counties and municipal districts is also gratefully acknowledged.
REFERENCES
- Cao T, Manolii VP, Strelkov SE, Hwang S-F, Howard RJ. 2009. Virulence and spread of Plasmodiophora brassicae [clubroot] in Alberta, Canada. Can J Plant Pathol. 31(3):321–329. doi:https://doi.org/10.1080/07060660909507606
- Horiuchi S, Hori M. 1980. A simple greenhouse technique for obtaining high levels of clubroot incidence. Bull Chugoku Natl Agric Exp Stn E (Environ Div). 17:33–55.
- Kuginuki Y, Yoshikawa H, Hirai M. 1999. Variation in virulence of Plasmodiophora brassicae in Japan tested with clubroot-resistant cultivars of Chinese cabbage (Brassica rapa L. ssp. pekinensis). Eur J Plant Pathol. 105(4):327–332. doi:https://doi.org/10.1023/A:1008705413127
- Strelkov SE, Hwang S-F, Manolii VP, Turnbull G, Fredua-Agyeman R, Hollman K, Kaus S. 2021. Characterization of clubroot (Plasmodiophora brassicae) from canola (Brassica napus) in the Peace Country of Alberta, Canada. Can J Plant Pathol. 43(1):155–161. doi:https://doi.org/10.1080/07060661.2020.1776931
- Strelkov SE, Manolii VP, Rennie DC, Manolii EV, Fu H, Strelkov IS, Hwang SF, Howard RJ, Harding MW. 2013. The occurrence of clubroot in Alberta in 2012. Can Plant Dis Surv. 93:145–148.
- Strelkov SE, Tewari JP, Smith-Degenhardt E. 2006. Characterization of Plasmodiophora brassicae populations from Alberta, Canada. Can J Plant Pathol. 28(3):467–474. doi:https://doi.org/10.1080/07060660609507321
Fig. 1 Cumulative cases of clubroot diagnosed in canola crops in Alberta. Since the start of clubroot surveillance in 2003, the disease has been confirmed in 44 counties and municipal districts in the province, as well as in rural areas of the cities of Edmonton and Medicine Hat, and the Town of Stettler
SOILBORNE PATHOGENS OF CANOLA IN CENTRAL AND NORTHERN ALBERTA IN 2020
CROP: Canola
LOCATION: Central and northern Alberta
NAMES AND AGENCIES:
C.X. YANG1, S.F. HWANG1, K.F. CHANG2, R. FREDUA-AGYEMAN1 & S.E. STRELKOV1
1Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB T6G 2P5Telephone: (780) 492-6693; Facsimile: (780) 492-4265; E-mail: [email protected]
2 Field Crop Development Centre, Alberta Agriculture and Forestry (AAF), Lacombe, AB T4L 1W8
ABSTRACT: Canola root samples (n=1016) were collected from 11 crops in central and northern Alberta in August 2020, and incubated on potato dextrose agar to test for the presence of soilborne pathogens. Fusarium spp. were the most frequently recovered at all locations, occurring at an average incidence of 29.2%. The second most frequent were Pythium spp. (incidence of 5.7%), followed by Rhizoctonia spp. (incidence of 0.7%) and Sclerotinia sclerotiorum (incidence of 0.3%).
INTRODUCTION: Canola (Brassica napus L.) is an important cash crop in Alberta, with 2.4 million ha seeded in 2020 (Statistics Canada 2020). Unfortunately, soilborne diseases can negatively affect canola yield and quality ( and ). A survey of 11 canola crops was conducted in central and northern Alberta in August 2020, with root samples collected to evaluate the incidence of soilborne pathogens.
METHODS: Eleven canola fields were sampled near Wetaskiwin, Ponoka, Gibbons, Lacombe and Edmonton, using W-shaped transects of each field, and 1016 canola root samples were collected at random from low-lying areas in the fields ( and ). The root samples were sectioned and surface-sterilized, and then incubated on potato dextrose agar for 10-12 days under ambient light at room temperature. The fungal isolates obtained were sub-cultured for purification, and evaluated visually for identification. The percentage of pathogen-free samples (% PFS) and the mean percent incidence (Mean %) of each pathogen were calculated for the root samples from each location. Unidentified fungi were discarded.
RESULTS AND DISCUSSION: The pathogen isolates recovered in this study are summarized in . Fusarium spp. and Pythium spp. were recovered from root samples at all locations, while Rhizoctonia spp. were isolated from samples collected near Lacombe, Ponoka and Wetaskiwin. Sclerotinia sclerotiorum (Lib.) de Bary was isolated only from samples collected near Wetaskiwin and Lacombe. Fusarium spp. were recovered most frequently, occurring at an incidence of 29.2% across all samples. The next most common were Pythium spp. (incidence of 5.7%), Rhizoctonia spp. (0.7%) and S. sclerotiorum (0.3%). In contrast, 28.0% of the samples were pathogen-free and 36.1% of samples had unidentified fungal colonies.
Table 1. Incidence of pathogens recovered from canola roots collected in central and northern Alberta, 2020
At Wetaskiwin, the mean percent incidence of Fusarium spp. was 43.7%, while 36.6% of the samples were pathogen-free. The mean percent incidence of Pythium spp., Rhizoctonia spp. and S. sclerotiorum was 2.9%, 0.4% and 1.3%, respectively (). At Ponoka, the incidence of pathogen-free samples was 50.0%. Fusarium spp. were found in 21.4% of the samples, Pythium spp. in 5.4%, and Rhizoctonia spp. in 1.8% of the samples. No S. sclerotiorum was isolated. At Gibbons, only Fusarium spp. and Pythium spp. were isolated, with an incidence of 33.3% and 8.1%, respectively. Symptoms of root disease were most severe at Lacombe ( and ). While most of the samples collected in Lacombe were pathogen-free (26.9%), all four of the pathogens were recovered from this area. In Edmonton, the incidence of Fusarium spp. was 27.3%, while only 2.7% of the samples were pathogen-free. Excessive moisture during the growing season in the surveyed areas may have contributed to disease development (Government of Alberta 2020).
More research on the interaction between Fusarium spp. and Pythium spp. may be needed, because these two pathogens often occurred together in the same crops and in the same plant roots.
ACKNOWLEDGEMENTS: This survey was supported financially by the Department of Agriculture and Forestry, Government of Alberta, with in-kind support from the University of Alberta.
REFERENCES
- Government of Alberta. 2020. Agricultural moisture situation update. https://open.alberta.ca/publications/moisture-situation-update [accessed 2020 Dec 29].
- Statistics Canada. 2020. Production of principal field crops, July 2020. Government of Canada. https://www150.statcan.gc.ca/n1/en/daily-quotidien/200831/dq200831a-eng.pdf?st=B4-fjm8 [accessed 2020 Dec 29].
Fig. 1 Canola crop affected by severe root disease in lower lying areas of a field in Lacombe County, Alberta, in 2020
Fig. 2 Diseased canola plants; note lodging, yellowing and senescence in the crop
LENTIL DISEASE SURVEY IN SOUTHERN ALBERTA, 2020
CROP: Lentil
LOCATION: Southern Alberta
NAMES AND AGENCIES:
M.W. HARDING, G.C. DANIELS & D.A. BURKE
Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticulture Station Road E., Brooks, AB T1R 1E6Telephone: (403) 362-1338; Facsimile: (403) 362-1326; E-mail: [email protected]
ABSTRACT: Nineteen lentil fields were surveyed for root rot, foliar blight and stem rot diseases in southern Alberta in 2020. Symptoms of root rot, ascochyta blight and sclerotinia stem rot were observed. Root rot was the most prevalent disease (89.5%) followed by ascochyta blight (10.5%) and sclerotinia white mould (5.3%). Disease incidences were 13.9%, 1.3% and 0.16%, respectively.
INTRODUCTION AND METHODS: Lentil in Alberta is produced primarily in three or four counties in the southeast corner of the province, and is the main pulse crop in rotation in that region. In 2019, there were 374,200 acres of this crop in Alberta that produced 162,600 metric tonnes of lentils (Alberta Pulse Growers Citation2020). Lentils can be attacked by a number of plant pathogens that cause diseases such as root rots (Aphanomyces euteiches Dreschs., Fusarium spp.), ascochyta blight (Ascochyta lentis Vass.), anthracnose (Colletotrichum lentis Damm), white mould (Sclerotinia sclerotiorum (Lib.) de Bary), grey mould (Botrytis fabae Sardiña, B. cinerea Pers.: Fr.), and stemphylium blight (Stemphylium botryosum Wallr.). A survey to characterize lentil diseases in Alberta was conducted between July 30 and August 12, 2020 by walking a W-shaped pattern and assessing 10 plants at 10 sites within each field, for a total of 100 plants assessed in each field. Assessment sites were >20 m from one another and from the field margin. Prevalence was calculated as the percentage of fields with disease symptoms and incidence as the percentage of plants with disease symptoms. Root rot disease intensity was estimated using a visual 1-7 rating scale (Chatterton et al. 2019). Leaf disease severity was rated using a visual 0-9 scale based on the percent plant area affected (). Sclerotinia white mould and botrytis grey mould were rated using a visual 1-5 canopy area affected scale ().
Table 1. Plant area affected (PAA) foliar blight intensity rating scale for lentil
Table 2. Canopy area affected (CAA) rating scale for Botrytis spp. and Sclerotinia sclerotiorum.
RESULTS AND COMMENTS: Overall, lentil crops were very healthy, with few severe disease symptoms. Root rots had the highest prevalence (89%), incidence (13.9%) and severity (1.36) (). Ascochyta blight was seen in two fields (prevalence of 10.5%) with a disease incidence of 1.3% and severity of 0.02. Sclerotinia white mould was seen in one field on 3/100 stems. Stemphylium blight, anthracnose and botrytis grey mould were not reported.
ACKNOWLEDGEMENTS: The authors express appreciation to Dr. Michelle Hubbard and Dr. Syama Chatterton for guidance on disease rating scales.
REFERENCES
- Alberta Pulse Growers. 2020. Lentils. https://albertapulse.com/growing-lentils/ [accessed 2020 Dec 10].
- Chatterton S, Harding MW, Bowness R, Mclaren DL, Banniza S, Gossen BD. 2019. Importance and causal agents of root rot on field pea and lentil on the Canadian prairies, 2014–2017. Can J Plant Pathol. 41(1):98–114. doi:https://doi.org/10.1080/07060661.2018.1547792
A SURVEY FOR PEA DISEASES IN ALBERTA, 2020
CROP: Pea
LOCATION: Alberta
NAMES AND AGENCIES:
M.W. HARDING1, G.C. DANIELS1, D.A. BURKE1, R. NEESER-CARAZO1, K. ZAHR2, A. SARKES2, T. DUBITZ3, J. FENG2, R. BOWNESS3 & S. CHATTERTON4
1Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticulture Station Road E., Brooks, AB T1R 1E6Telephone: (403) 362-1338; Facsimile: (403) 362-1326; E-mail: [email protected]
2Alberta Agriculture and Forestry, Crop Diversification Centre North, 17507 Fort Road NW, Edmonton, AB T5Y 6H3
3Alberta Agriculture and Forestry, Lacombe Research Centre, 6000 C&E Trail, Lacombe, AB T4L 1W1
4Agriculture and Agri-Food Canada, Lethbridge Research and Development Centre, P. O. Box 3000, Lethbridge, AB T1J 4B1
ABSTRACT: A survey of pea diseases in Alberta was conducted in 2020. One hundred and nine fields were visited in 46 counties and municipal districts. Damage due to flooding and standing water was evident in a majority of fields, and in many of these, drowning was a much larger issue than disease loss. Root rot was the most prevalent disease in pea and was found in 100% of fields. Mycosphaerella/Ascochyta blight was also very prevalent (99%). Sclerotinia stem rot and bacterial blight were observed in fewer fields. Powdery mildew and downy mildew were not observed.
INTRODUCTION AND METHODS: Between July 14 and August 5, 2020, 109 pea fields (), in 46 Alberta counties, were surveyed for root rot (Aphanomyces euteiches Dreschs. and Fusarium spp.), mycosphaerella/ascochyta blight (Mycosphaerella pinodes (Berk. & Blox.) Vestergr./Ascochyta pisi Lib.), stem rot (Sclerotinia sclerotiorum (Lib.) de Bary), and bacterial blight (Pseudomonas syringae pv. pisi (Sackett) Dye & Wilkie). Ten locations were sampled in each field along a W-shaped transect with each location >20 m apart and 50 m from the field margin. Ten plants were rated at each location for a total of 100 plants/field. Whole plants were rated for disease intensity of root rot, mycosphaerella/ascochyta blight of leaves and stems, sclerotinia stem rot and bacterial blight. Prevalence was defined as the percentage of fields with disease symptoms and incidence as the percentage of plants with symptoms in each field. The severity of root rot disease was estimated using a visual disease intensity scale of 1 to 7, based on root discoloration and root mass reduction as described by Chatterton et al. (2019). The severity of mycosphaerella/ascochyta leaf blight and stem blight diseases was rated using visual 1-7 scales modified from Liu et al. (2013) and Wang (1998), respectively. Sclerotinia stem rot and bacterial blight were rated as present/absent, and thus only prevalence and incidence were calculated for these two diseases. The prevalence of A. euteiches will be presented in a separate report.
RESULTS AND COMMENTS: Drowning was a significant issue in many pea fields in June and July of 2020 (). Root rots had the highest prevalence (100%), and an incidence of 66.7% and severity of 2.64 (). Mycosphaerella/Ascochyta blights on leaves had a 99.1% prevalence, and the highest incidence (93.6%) and severity (2.81). Disease prevalence, incidence and severity on stems were 71.3%, 3.9%, and 2.12, respectively. While root rot was seen in every field, the disease incidence and severity varied from field to field and from county to county (). Sclerotinia and bacterial blight were less common and were sporadically reported, averaging 13.0% and 27.9% prevalence, respectively.
Table 3. Prevalence, incidence and severity of lentil diseases in southern Alberta, 2020
Table 1. Prevalence, incidence and severity of pea diseases in southern Alberta, 2020
Table 2. Disease incidence and severity by individual Alberta municipal district (M.D.)/county
ACKNOWLEDGEMENTS: Thanks to James Wills, Harry Brook, Trisha Jones, Matthew McNaught and Taryn McNaught for assistance with the survey. The authors express appreciation to landowners and producers that allowed access to their fields.
REFERENCES
- Chatterton S, Harding MW, Bowness R, McLaren DL, Banniza S, Gossen BD. 2019. Importance and causal agents of root rot on field pea and lentil on the Canadian prairies, 2014–2017. Can J Plant Pathol. 41(1):98–114.
- Liu J, Cao T, Feng J, Chang K-F, Hwang S-F, Strelkov SE. 2013. Characterization of the fungi associated with ascochyta blight of field pea in Alberta, Canada. Crop Prot. 54:55–64. doi:https://doi.org/10.1016/j.cropro.2013.07.016
- Wang TF. 1998. Evaluation of mycosphaerella blight resistance in pea [M.Sc. Thesis]. Saskatoon (SK): University of Saskatchewan.
Fig. 1 Survey locations for Alberta’s 2020 pea disease survey
Fig. 2. Main issues observed in Alberta pea fields in 2020: A, drowned low spot in pea field; B, mycosphaerella blight on pea leaves; C, ascochyta blight on pea leaves; D, rot of pea roots
A SURVEY FOR SOYBEAN DISEASES IN ALBERTA IN 2020
CROP: Soybean
LOCATION: Southern Alberta
NAMES AND AGENCIES:
M.W. HARDING, D.A. BURKE & G.C. DANIELS
Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticulture Station Road E., Brooks, AB T1R 1E6Telephone: (403) 362-1338; Facsimile: (403) 362-1326; E-mail: [email protected]
ABSTRACT: Eight soybean fields in southern Alberta were surveyed for root rot, stem rot, foliar diseases and nodulation in 2020. The prevalence, incidence and severity of diseases and nodulation were recorded. Foliar leaf spots caused by bacterial blight or septoria brown spot had the highest prevalence, incidence and severity. Sclerotinia stem rot was observed in one field, and no root rot was observed. Nodulation was observed in every field ranging from 1 to 97% incidence with an overall average of 55%.
INTRODUCTION AND METHODS: Cool temperatures at critical times, early frost and poor harvest conditions have made soybean production challenging in Alberta in recent years (Harding Citation2019). As a result, fewer soybean fields were found in 2020 and all were in southern Alberta. The 2020 growing season had abundant moisture in spring and early summer across much of the province, but became hot and dry in August with a long, open fall very well-suited for soybean maturity and harvest. The disease survey was performed between August 17 and August 25, 2020 in eight soybean fields in southern Alberta (). Five sample locations were visited in each field along a W-shaped transect with each location >20 m apart and from the field margin. Twenty plants were rated at each location for a total of 100 plants/field. Whole plants were rated for root rot, leaf spot, sclerotinia stem rot and nodulation. Prevalence was defined as the percentage of fields with disease symptoms and incidence as the percentage of plants with disease symptoms. Severity of diseases and nodulation was estimated using 0-4 rating scales as described in Harding (Citation2019). Foliar leaf spots could have been caused by bacterial blight (Pseudomonas syringae Van Hall pv. glycinea) or brown spot (Septoria glycines Hemmi), or both.
RESULTS AND COMMENTS: Foliar leaf spots caused by bacterial blight or septoria brown spot had the highest prevalence, incidence and severity (). However, when disease prevalence was moderate to high for all diseases, the incidence and severity of diseases were not. Sclerotinia stem rot (Sclerotinia sclerotiorum Lib. De Bary) was found in 20% of fields and no root rot symptoms were observed. Once again, diseases did not appear to be a major production constraint for soybean in Alberta. While there was widespread distribution and occurrence of some pathogens, the disease pressure was low. Nodulation was seen in every field, and ranged from 1 to 97% incidence.
Table 1. Prevalence, incidence and severity of three soybean diseases and nodulation in southern Alberta in 2020
ACKNOWLEDGEMENTS: The author expresses appreciation to landowners and producers that allowed access to their fields for the collection of these data.
REFERENCES
- Harding MW. 2019. A survey for soybean diseases in Alberta in 2018. Can Plant Dis Surv. 99:139–140. In, Can J Plant Pathol. Vol. 41, sup 1.
Fig. 1 Eight soybean disease survey locations in Alberta, 2020
SOYBEAN ROOT ROT AND PHYTOPHTHORA ROT IN WESTERN CANADA IN 2020
CROP: Soybean
LOCATION: Manitoba, Saskatchewan and Alberta
NAMES AND AGENCIES:
Y.M. KIM1, D.L. MCLAREN1, D. KAMINSKI2, S. PHELPS3, M.W. HARDING4, B.D. GOSSEN5, C. TKACHUK6, L. SCHMIDT6, D. LANGE7, A. FAROOQ8, S. ROBERTS9, N. CLOUSON10, A. AKHAVAN9, C. PERU9, T.L. HENDERSON1, N.J. VACHON1, W.C. PENNER11, G.C. DANIELS4 & M.J. THOMPSON1
1Agriculture and Agri-Food Canada (AAFC), Brandon Research and Development Centre, 2701 Grand Valley Road, Brandon, MB R7A 5Y3Telephone: (204) 578-6691; Facsimile: (204) 578-6524; E-mail: [email protected]
2Manitoba Agriculture and Resource Development (MARD), Box 1149, Carman, MB R0G 0J0
3Saskatchewan Pulse Growers, 207-116 Research Drive, Saskatoon, SK S7N 3R3
4Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticulture Station Road E., Brooks, AB T1R 1E6
5AAFC, Saskatoon Research and Development Centre, 107 Science Place, Saskatoon, SK S7N 0X2
6Manitoba Pulse and Soybean Growers, Box 1760, Carman, MB R0G 0J0
7MARD, Box 969, Altona, MB R0G 0B0
8MARD, 1129 Queens Ave, Brandon, MB R7A 1L9
9Saskatchewan Ministry of Agriculture, 3085 Albert St., Regina, SK S4S 0B1
10MARD, 120-6th Ave N, Swan River, MB R0L 1Z0
11AAFC, Morden Research and Development Centre, Unit 101, Route 100, Morden, MB R6M 1Y5
ABSTRACT: In 2020, 63, 16 and eight soybean crops were surveyed in Manitoba, Saskatchewan and Alberta, respectively, for root diseases. Samples from all fields were rated for root rot severity. Root samples from 40, 16 and eight Manitoba, Saskatchewan and Alberta fields, respectively, were assessed in the laboratory for root pathogens and fusarium root rot was the most prevalent root disease. Sixty-eight Manitoba soybean crops were assessed for phytophthora rot along with 16 Saskatchewan and eight Alberta crops. In 2020, Phytophthora sojae was not detected in any of the soybean plant samples that were received from Manitoba, Saskatchewan and Alberta.
INTRODUCTION: For the first time in a decade, Manitoba soybean production was lower in 2018 than in 2017 with 2.29 million acres and 1.89 million acres seeded in 2017 and 2018, respectively (Soy Canada Citation2020). Soybean production in Manitoba has decreased for three consecutive years (2018-2020) to 1.15 million acres in 2020. Seeded area in Saskatchewan increased from 240,000 acres in 2016 to 850,000 acres in 2017, but declined in 2018 and 2019 to 407,500 and 150,000 acres, respectively (Soy Canada Citation2020). In 2020, soybean production in Saskatchewan decreased further to 126,700 acres. In Alberta,18,300 acres were seeded to soybean in 2018 followed by a reduction to approximately 7,000 and 2,500 acres in 2019 and 2020, respectively (Soy Canada Citation2020). The 2018 and 2019 field seasons were difficult for soybean growers – dry weather with lower yields in some cases may have influenced producers to reduce soybean acreages in 2020.
Root rot was a problem in Manitoba, Saskatchewan and Alberta and also was a constraint in other areas of Canada where soybean production has been established (Chang et al. Citation2013; Nyandoro et al. Citation2019; OMAFRA Citation2011). This disease complex may become more of an issue in western Canada with the increased development and cultivation of early maturing soybean varieties as well as the association of Fusarium species with numerous field crops. Phytophthora rot has been identified in Manitoba, Saskatchewan and Alberta soybean crops and an annual survey for P. sojae is of utmost importance in order to characterize these isolates and provide information on the pathotype diversity that now exits.
METHODS: Soybean crops were surveyed for root diseases at 63 different locations in Manitoba in 2020. Areas of the crop survey were expanded to include not only randomly chosen fields from regions in south-central and southwest Manitoba, where soybean is commonly grown, but fields from non-traditional soybean areas into which the crop is expanding.
The survey for root diseases was conducted during mid-August to early September with at least 10 plants uprooted at each of three random sites in each crop surveyed. Root diseases were rated on a scale of 0 (no disease) to 9 (death of plant) in all 63 fields. For 40 crops, 15 symptomatic roots were collected for fungal isolation and identification in the laboratory. Fusarium spp. were identified by visual assessment, microscopic examination and morphological characterization of fungal colonies on growth media using the criteria of Leslie and Summerell (2006). Fifteen roots from each of the 40 soybean crops surveyed were frozen for future PCR analysis of root rot pathogens.
In Manitoba, the 63 crops that were surveyed for root rot and five additional crops were assessed in mid-August to early September for phytophthora rot. Soybean plants were collected by staff of AAFC-Brandon, AAFC-Morden, Manitoba Agriculture and Resource Development (MARD), and the Manitoba Pulse and Soybean Growers. In Saskatchewan during mid- to late August, soybean plants were collected from 16 crops by employees of the Saskatchewan Pulse Growers and the Government of Saskatchewan, Ministry of Agriculture. In Alberta, plant samples from eight soybean crops were collected during mid- to late August by employees of Alberta Agriculture and Forestry. All plants were shipped to Manitoba, rated for root rot, and those that were symptomatic for phytophthora disease were identified at AAFC-Brandon for further assessment in the laboratory. Approximately 85, 62 and 92 stems from Manitoba, Saskatchewan and Alberta soybean plants, respectively, were placed on selective media to identify Phytophthora spp. based on their morphological characteristics (Gallegly and Hong Citation2008).
RESULTS AND COMMENTS: A drier than normal summer occurred in western Canada, except for most of Alberta and northern Saskatchewan. Favourable weather conditions helped producers complete early harvesting of many crops including soybean. The percentage of the soybean harvest completed in Manitoba, Saskatchewan and Alberta was 97% by October 20th (MARD Citation2020), 100% by October 19th (Saskatchewan Agriculture Citation2020) and 99% by October 20th (Alberta Agriculture 2020). Yields were variable depending on moisture conditions during the growing season, but were reported to range from 15 to 60 bu/ac throughout Manitoba with a mean yield of 25 bu/ac for soybean in Saskatchewan. Expected soybean yields in Alberta were not available.
Root rot was observed in all 63, 16 and eight Manitoba, Saskatchewan and Alberta soybean crops, respectively, that were surveyed. Root rot severity ratings ranged from 3.8 to 7.0 with a mean of 5.0 (Manitoba), 2.9 to 6.6 with a mean of 5.0 (Saskatchewan) and 3.9 to 5.1 with a mean of 4.7 (Alberta). The microorganisms most frequently isolated from roots of infected plants from all 87 crops were Fusarium spp. (). Rhizoctonia root rot (Rhizoctonia solani) was not detected in any of the 40 Manitoba crops surveyed in 2020. Pythium root rot was not detected in any of the soybean crops surveyed. Assessment of frozen samples for root pathogens using PCR is planned for the near future.
Table 1. Prevalence of phytophthora rot (PRR) and prevalence and severity of root rot in 63 (68 for PRR), 16 and 8 crops of soybean in Manitoba, Saskatchewan and Alberta, respectively, in 2020
Phytophthora rot was not identified in any of the 68 Manitoba fields and was not detected in any plant samples received from Saskatchewan or Alberta in 2020 (). Pathotype identification of the 2019 P. sojae isolates from Manitoba is in progress at both AAFC-Brandon and AAFC-Morden.
ACKNOWLEDGEMENTS: We gratefully acknowledge the support of Dale Risula and Samantha Marcino with the Saskatchewan Ministry of Agriculture and Katey Makohoniuk and Joanne Kwasnicki with the Saskatchewan Association of Rural Municipalities.
REFERENCES
- Alberta Agriculture. 2020. Alberta crop report: Crop conditions as of October 20 – Final report for 2020. https://open.alberta.ca/publications/2830245 [accessed 2021 Jan 27]
- Chang KF, Nyandoro R, Howard RJ, Hwang SF, Turnbull GD, Laflamme P, Strelkov SE, McLaren DL. 2013. Occurrence of soybean root rot in southern Alberta, Canada in 2011 and 2012. Can Plant Dis Surv. 93:170–173.
- Gallegly ME, Hong C. 2008. Phytophthora: identifying species by morphology and DNA fingerprints. St. Paul (MN): APS Press.
- Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Ames (IA): Blackwell.
- Manitoba Agriculture and Resource Development (MARD). 2020 October 20. Crop report summary. https://www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/pubs/crop-report-season-summary-2020-10-20.pdf [accessed 2021 Jan 27]
- Nyandoro R, Chang KF, Hwang SF, Ahmed HU, Turnbull GD, Strelkov SE, Willenborg C. 2019. Management of root rot of soybean in Alberta with fungicide seed treatments and genetic resistance Can J Plant Sci. 99(4):499–509. doi:https://doi.org/10.1139/cjps-2018-0266
- Ontario Ministry of Agriculture, Food and Rural Affairs (OMAFRA). 2011. Agronomy guide for field crops: soybean diseases. Publication #811. http://www.omafra.gov.on.ca/english/crops/pub811/pub811.pdf [accessed 2021 Jan 27]
- Saskatchewan Agriculture. 2020. Final crop report: October 13 to 19, 2020. https://www.saskatchewan.ca/crop-report [accessed 2021 Jan 27]
- Soy Canada. 2020. Canadian soybean seeded acres (1980 to current). https://soycanada.ca/statistics/seeded-area-acres/ [accessed 2021 Jan 27]
SURVEY OF CANOLA DISEASES IN SASKATCHEWAN, 2020
CROP: Canola
LOCATION: Saskatchewan
NAMES AND AGENCIES:
A. AKHAVAN1, C. PERU1, D. CUBBON2, J. GIROYED2, B. ESAU2, O. DARCY2, C. JACOB1, J. IPPOLITO1, K. KINDRACHUK1, E. CAMPBELL1, S. CHANT1, S. TETLAND1, J. PERU1, A. NOBLE1, L. COWELL3, C. ROBINSON3, K. STONEHOUSE1, S. MARCINO1, M. BROWN1, K. ANDERSON4, K. MAKOHONIUK5, J. KWASNICKI5, C. NEUBERGER 5, C. FENNIG5, B. JOHNSON5 & L. ROSZELL5
1 Saskatchewan Ministry of Agriculture, 3085 Albert St., Regina, SK S4S 0B1Telephone: (306) 787-4671; Facsimile: (306) 787-0428; E-mail: [email protected]
2 Prairie Co-op, Meadow Lake, SK S9X 1A0
3 Nutrien, Saskatoon, SK S7K 7G3
4 Bayer Crop Science Inc., Saskatoon, SK S7K 4B5
5 Saskatchewan Association of Rural Municipalities, Regina, SK S4V 3A4
ABSTRACT: The annual survey in Saskatchewan covered 261 canola fields across six large regions of the province. Sclerotinia stem rot was the most prevalent disease with symptoms in 79.3% of the crops surveyed. The mean incidence of sclerotinia stem rot among all crops surveyed in Saskatchewan was 16.8% but ranged from 2.7% to 26.1% among regions. Blackleg was observed in 81.2% of crops surveyed with a mean disease incidence of 14.6% (ranging from 7.6% to 23.6%).
METHODS: A total of 261 canola crops were surveyed between August 11 and September 21, 2020 in the major canola growing regions of Saskatchewan. The number of surveyed crops was highest in the Northwest with 85 out of 261 fields being located in this region. The distribution of surveyed crops across the rest of the province was as follows: 34 (Northeast), 34 (West-central), 44 (East-central), 35 (Southwest) and 29 (Southeast). Where possible, the survey was conducted before swathing when plants were between growth stages 5.1 and 5.5 (Harper and Berkenkamp 1975). Disease assessments were made by examining 20 plants from each of five sites in each field. Individual sample sites were located at least 20 m from the field edge and separated from each other by at least 20 m. Fields were assessed for both prevalence (percentage of fields with symptoms of the disease) and incidence (percentage of plants surveyed with symptoms of the disease per field). The diseases assessed included: sclerotinia stem rot (Sclerotinia sclerotiorum), blackleg (Leptosphaeria maculans), aster yellows (AY phytoplasma), foot rot (Rhizoctonia spp., Fusarium spp.), alternaria black spot (Alternaria brassicae, A. raphani), fusarium wilt (F. oxysporum f.sp. conglutinans), verticillium stripe (Verticillium longisporum), powdery mildew (Erysiphe cruciferarum), downy mildew (Peronospora parasitica), white rust (Albugo candida), grey stem (Pseudocercosporella capsellae), bacterial pod spot (Pseudomonas syringae pv. maculicola) and clubroot (Plasmodiophora brassicae). Severity ratings also were conducted for both sclerotinia stem rot and blackleg. For sclerotinia stem rot, each plant (100 per field) was rated for severity according to a rating scale of 0 to 5 as described by Kutcher and Wolf (2006) (). For blackleg, plant stems were cut and then scored for basal stem cankers severity using a rating scale ranging from 0 to 5 (WCC/RRC 2009) (). Average severity values for blackleg and sclerotinia stem rot in each field were calculated as the sum of the severity ratings divided by the total number of plants examined. Stem lesions were recorded when observed on the upper stem or when associated with a basal canker. The prevalence of alternaria black spot (A. brassicae, A. raphani) in the fields was recorded. For all of the diseases assessed, prevalence and average disease incidence or severity values were calculated across the entire province and separately for each of six regions within Saskatchewan.
Table 1. Sclerotinia rating scale (Kutcher and Wolf 2006)
Table 2. Blackleg rating scale (WCC/RRC 2009)
RESULTS AND COMMENTS: In 2020, approximately 4,588,800 hectares (11,339,200 acres) were seeded to canola in Saskatchewan. As of early February 2021, 4,574,100 hectares (11,302,800 acres) of canola were harvested in Saskatchewan (Statistics Canada 2021). The Saskatchewan Crop Report (Saskatchewan Ministry of Agriculture 2020) estimated that 100% of the Saskatchewan canola crop had been harvested by October 19, 2020.
Sclerotinia stem rot was observed in 79.3% of the canola crops surveyed. The average incidence in the province was 16.8% (21.2% in infested crops) (). The incidence of sclerotinia stem rot was higher in 2020 than 2019 (13% in all crops and 16% in infested crops) and 2018 (6% in all crops and 10% in infested crops) (). Incidence was highest in the Northwest region (26.1%) and lowest in the Southeast region (2.7%). The average severity of sclerotinia stem rot in canola crops in Saskatchewan was 0.4. The severity of sclerotinia stem rot was highest in the Northwest region (0.8) and lowest in the Southeast region (0.1) ().
Table 3. Mean disease incidence and severity of sclerotinia stem rot of canola in Saskatchewan in 2020
Table 4. Mean disease incidence and severity of blackleg basal cankers in Saskatchewan in 2020
Table 5. Prevalence of alternaria pod spot, aster yellows, and foot rot of canola fields surveyed in Saskatchewan in 2020
Table 6. Mean disease incidence and sclerotinia severity reported as the average severity among infected plants and the average severity among all plants surveyed per field, 2011-2020 (Peru et al. 2020)
Symptoms of blackleg basal infection (rated after cutting of lower stems) were present in 81.2% of the Saskatchewan canola crops included in the survey (). The average incidence in the province was 14.6% (17.9% in infested crops). The levels of blackleg were higher than those in 2019 (69% prevalence), and 2018 (74% prevalence) and above the levels documented for the time period between 2011 and 2017 (). The high provincial average of blackleg incidence, severity and prevalence in 2020, 2019, 2018 and 2017 compared to previous years was, in part, influenced by the higher portion of surveyed fields located in the Northwest region where canola acreage is high and conditions often favor blackleg development. In 2020, the average incidence was highest in the Northwest region (23.6%) and lowest in the Northeast and Southeast regions (7.6% and 9.6%, respectively). The average severity of blackleg basal cankers in the province was 0.2. Average severity was highest in the Northwest region (0.3) and lowest in the Northeast, Southeast and Southwest regions (0.1). Blackleg stem lesions were present in 50.6% of canola crops with an average incidence of 3.8% (data not shown). The highest average blackleg stem lesion incidence occurred in the West-central region (7.7%). The lowest incidence was in the Northeast region (2.2%). Both blackleg basal cankers and stem lesions were present on the same plant in 37.2% of crops across the province (data not shown).
Table 7. Mean blackleg canker severity reported as the average severity among infected plants and the average severity among all plants surveyed per field, 2011–2019 (Peru et al. 2020)
Aster yellows had a prevalence of 22.2% () with an average incidence of 0.7% (3.3% in infested fields). This was higher than in 2019, when the average incidence in Saskatchewan was 0.3% (2.9% in infested fields) (Peru et al. Citation2019). The highest prevalence of aster yellows in 2020 was in the Northwest region (50.6%) with an average incidence of 1.2% (). Province-wide, aster yellows was observed in 35.6% of surveyed canola fields (this includes observations in surveyed fields where infected plants were seen outside of the 100-plant sample: data not shown).
Foot rot was recorded in 2.3% of canola crops in the province. The highest incidence was in the East-central region (6.8%). Foot rot was not detected in the Northwest, Southeast or Southwest regions of Saskatchewan (). In 2020, alternaria pod spot was assessed in five regions in the province with the highest prevalence observed in the West-central region (100%) ().
No symptoms of powdery mildew, downy mildew, white rust, or bacterial pod spot were found in any of the fields surveyed.
REFERENCES
- Harper FR, Berkenkamp B. 1975. Revised growth-stage key for Brassica campestris and B. napus. Can J Plant Sci. 55(2):657–658. doi:https://doi.org/10.4141/cjps75-103
- Kutcher HR, Wolf TM. 2006. Low-drift fungicide application technology for sclerotinia stem rot control in canola. Crop Prot. 25(7):640–646. doi:https://doi.org/10.1016/j.cropro.2005.09.003
- Saskatchewan Ministry of Agriculture. 2020. Saskatchewan crop report for the period October 13 to October 19, 2020. https://www.saskatchewan.ca/business/agriculture-natural-resources-and-industry/agribusiness-farmers-and-ranchers/market-and-trade-statistics/crops-statistics/crop-report [accessed 2021 Feb 6]
- Statistics Canada. 2021. Estimated areas, yield, production, average farm price and total farm value of principal field crops, in metric units, annual. Table 32-10-0359-01. CANSIM database. https://www150.statcan.gc.ca/t1/tbl1/en/tv.action?pid=3210035901 [accessed 2021 Feb 6]
- Western Canada Canola/Rapeseed Recommending Committee (WCC/RRC) Incorporated. 2009. Procedures of the Western Canada Canola/Rapeseed Recommending Committee for the evaluation and recommendation for registration of canola/rapeseed candidate cultivars in western Canada.
- Peru C, Ziesman B, Cubbon D, Giroyed J, Esau B, Friesen S, Hicks L, Ippolito J, Jacob C, Jurke C, et al.2019. Survey of canola diseases in Saskatchewan, 2019. Can Plant Dis Surv. 100:126–129. In Can J Plant Pathol. 42:sup1.
2020 SURVEY OF LENTIL DISEASES IN SASKATCHEWAN
CROP: Lentil
LOCATION: Saskatchewan
NAMES AND AGENCIES:
A. AKHAVAN1, C. PERU1, J. IPPOLITO1, K. KINDRACHUK1, S. CHANT1, S. TETLAND1, M. BROWN1, S. MARCINO1, D. RISULA1, E. CAMPBELL1, K. BOERE1, K. MAKOHONIUK2, J. KWASNICKI2, C. NEUBERGER2, C. FENNIG2 & B. JOHNSON2
1 Saskatchewan Ministry of Agriculture, 3085 Albert St., Regina, SK S4S 0B1Telephone: (306) 787-4671; Facsimile: (306) 787-0428; E-mail: [email protected]
2 Saskatchewan Association of Rural Municipalities, 2301 Windsor Park Rd., Regina, SK S4V 3A4
ABSTRACT: A total of 68 lentil crops were surveyed in Saskatchewan in 2020. Anthracnose, ascochyta blight, root rot, and stemphylium blight were the most prevalent diseases observed in the survey, though variation in the prevalence of these diseases was found across lentil-growing regions in Saskatchewan. Overall, sclerotinia stem and pod rot and botrytis stem and pod rot levels were low throughout the province.
INTRODUCTION AND METHODS: A total of 68 lentil fields were surveyed for the presence and incidence of diseases in Saskatchewan in 2020. The survey was conducted between July 23 and August 13 when crop stage ranged from R1 (early bloom, one open flower at any node) to R8 (90% of pods are golden-brown). The number of surveyed crops was highest in Southwest Saskatchewan, with 36 of the 68 crops surveyed located in this region. The distribution of the surveyed crops across the rest of the province was as follows: 16 (West-central), 9 (Southeast), 5 (East-central) and 2 (Northwest). Disease assessments were made by visually examining 10 plants from each of 10 sites along a W-pattern in each field. Individual sites were located at least 50 m from the field edge and at least 30 m apart. Crops were assessed for the incidence of anthracnose (Colletotrichum truncatum), ascochyta blight (Ascochyta lentis), sclerotinia stem and pod rot (Sclerotinia sclerotiorum), botrytis stem and pod rot (Botrytis cinerea) and stemphylium blight (Stemphylium spp.), as well as the prevalence of root rot complex (Fusarium spp./Pythium spp./Rhizoctonia solani/Aphanomyces euteiches) and all other diseases listed above.
Prevalence of each of these diseases (percentages of the crops surveyed showing symptoms) was calculated for each region surveyed (–), as well as provincial totals () and compared to totals from the previous five years (Ziesman et al. Citation2020). The average incidence of anthracnose, ascochyta blight, sclerotinia stem and pod rot, botrytis stem and pod rot and stemphylium blight was calculated and averaged for each region and on a provincial level ().
Table 1. Prevalence of plant diseases in lentil crops surveyed in West-central Saskatchewan, 2012-2020
Table 2. Prevalence of plant diseases in lentil crops surveyed in Southwest Saskatchewan, 2012-2020
Table 3. Prevalence of plant diseases in lentil crops surveyed in Southeast Saskatchewan, 2012-2020
Table 4. Prevalence of plant diseases in lentil crops surveyed in East-central Saskatchewan, 2012-2020
Table 5. Prevalence of plant diseases in lentil crops surveyed Northeast Saskatchewan, 2012-2020
Table 6. Prevalence of plant diseases in lentil crops surveyed Northwest Saskatchewan, 2012-2020
Table 7. Prevalence of plant diseases in lentil crops surveyed in Saskatchewan, 2012-2020
Table 8. Average disease incidence in Saskatchewan lentil crops surveyed in 2020
RESULTS AND COMMENTS: Approximately 1.5 million hectares (3.8 million acres) of lentils were seeded in Saskatchewan in 2020. This is similar to the 1.4 million hectares (3.4 million acres) seeded in 2019 and 2018 and slightly lower than the 1.6 million hectares (3.9 million acres) seeded in 2017 (Statistics Canada 2021). This could be partially due to the high prevalence and severity of root rot experienced in 2016 (Chatterton et al. 2016). As of January 2021, 1.5 million hectares (3.8 million acres) of lentils were harvested (Statistics Canada 2021) in Saskatchewan. The Saskatchewan Crop Report (Saskatchewan Ministry of Agriculture 2020) estimated that 100% of the Saskatchewan lentil crop had been harvested by October 19, 2020.
Anthracnose (Colletotrichum lentis) was observed in 83.8% (57 fields) of fields surveyed in 2020 (). The highest prevalence was found in the Northwest (100%), and East-central (100%) regions followed by the Southwest (86.1%), and West-central (81.3%) regions. The lowest prevalence occurred in the Southeast (66.7%) region. The average incidence of anthracnose was 44.4% when averaged across the province (). The incidence of anthracnose was highest in West-central Saskatchewan (56.3%) followed by the Southwest (43.8%) and Southeast (39.8%).
Ascochyta blight symptoms (Ascochyta lentis) were observed in 72.1% of crops surveyed in 2020 (). Ascochyta blight was less prevalent in lentil crops in 2019 (35%). The average incidence of ascochyta blight was higher than last year with an average incidence of 13.7% across the province. Among regions, the prevalence ranged from 0% in the Northwest (only two fields were surveyed) to 83.3% in the Southwest, while the average incidence ranged from 0% in the Northwest to 20.2% in the Southwest. It is important to note that diagnosis was only based on visual symptoms in the field. Plants having visual symptoms that were consistent with ascochyta blight were not confirmed with additional testing. The low levels of ascochyta blight seen in 2014-2018 are thought to be due to improved resistance in lentil varieties. As a result, it is important to watch for and prevent the breakdown of resistance in lentil crops grown under tight rotations and/or when conditions are conducive to disease development.
Root rot was observed in 70.6% of the fields included in the 2020 survey (). The highest prevalence was found in the Southeast (100%) followed by the West-central (81.3%) regions. Root rot was present in 63.9% of the fields surveyed in the Southwest region and 60% in the East-central region in 2020. Root rot has been a notable issue in pea and lentil crops in recent years, with a number of potential pathogenic causes (Fusarium spp./Pythium spp./Rhizoctonia solani/Aphanomyces euteiches) in addition to environmental stresses due to excess moisture. No sampling or further testing was performed to confirm causal pathogens.
Stemphylium blight (Stemphylium spp.) was found in 70.6% of lentil fields surveyed. The highest prevalence was observed in the Northwest region (100%; only two fields surveyed) followed by the West-central (81.3%), Southeast (77.8%), and Southwest (72.2%) regions. This is a higher level of prevalence compared to previous years (). The average incidence of stemphylium blight was 11.7% across all fields surveyed in 2020 ().
Sclerotinia stem and pod rot (Sclerotinia sclerotiorum) was noted in 19.1% of fields surveyed in 2020 () and observed in all regions, with the highest prevalence in the Northwest (50%) and East-Central (40%) regions. The incidence of sclerotinia stem and pod rot was also low across the province with an average incidence of 1.4% (). The highest average incidence was observed in the Northwest region (18.5%). Symptoms of botrytis stem and pod rot (Botrytis cinerea) were also observed in 8.8% of fields with an average incidence of 1.6%. Botrytis stem and pod rot/grey mould had not been observed in any of the fields surveyed in 2019 ().
REFERENCES
- Saskatchewan Ministry of Agriculture. 2020. Saskatchewan crop report for the period October 13 to October 19, 2020. https://www.saskatchewan.ca/business/agriculture-natural-resources-and-industry/agribusiness-farmers-and-ranchers/market-and-trade-statistics/crops-statistics/crop-report [accessed 2021 Jan 29]
- Statistics Canada. 2021. Estimated areas, yield, production, average farm price and total farm value of principal field crops, in metric units, annual, CANSIM database: Table 32-10-0359-01. https://www150.statcan.gc.ca/t1/tbl1/en/tv.action?pid=3210035901 [accessed 2021 Jan 29]
- Ziesman B, Peru C, Jacob C, Ippolito J, Kindrachuk K, Chant S, Roberts S, Banniza S, Makohoniuk K, Kwasnicki J, et al. 2020. Can Plant Dis Surv. 100:1137–1140. In, Can J Plant Pathol. 42:sup 1.
2020 SURVEY OF FIELD PEA DISEASES IN SASKATCHEWAN
CROP: Field pea
LOCATION: Saskatchewan
NAMES AND AGENCIES:
A. AKHAVAN1, C. PERU1, J. IPPOLITO1, K. KINDRACHUK1, E. CAMPBELL1, K. BOERE1, S. CHANT1, M. BROWN1, S. MARCINO1, D. RISULA1, S. TETLAND1, K. MAKOHONIUK3, J. KWASNICKI2, C. NEUBERGER2, C. FENNIG2, L. ROSZELL2 & B. JOHNSON2
1 Saskatchewan Ministry of Agriculture, 3085 Albert St., Regina, Saskatchewan S4S 0B1Telephone: (306) 787-4671; Facsimile: (306) 787-0428; E-mail: [email protected]
2 Saskatchewan Association of Rural Municipalities, 2301 Windsor Park Rd., Regina, SK S4V 3A4
ABSTRACT: A total of 41 field pea crops were surveyed in Saskatchewan in 2020. Root rot complex and mycosphaerella blight were the most prevalent diseases in 2020 and were present in all the surveyed crops. Symptoms consistent with bacterial blight were identified in 51.2% of crops and white mould was present in 14.6% surveyed field pea crops in Saskatchewan in 2020.
INTRODUCTION AND METHODS: In total, 41 field pea crops were surveyed in Saskatchewan in 2020. The distribution of fields across the six regions in the province is described in . The highest number of surveyed crops were located in West-central and East-central Saskatchewan with 11 and 10 of the surveyed field located in these two regions. The survey was conducted between July 6 and 23 when crop growth stage ranged from BBCH growth stage of 60 (first flowers open sporadically) to 79 (pods have reached typical size (green ripe); peas fully formed). Disease assessments were made by examining 10 plants from each of 10 sites along a W-pattern with at least 20 m between sampling sites. Crops were assessed for the incidence of root rot complex (Aphanomyces euteiches, Fusarium spp., Rhizoctonia spp., and Pythium spp.), mycosphaerella blight and ascochyta foot rot (Peyronellaea (Mycosphaerella) pinodes, Ascochyta pisi and Phoma medicaginis f. sp. pinodella) and white mould (Sclerotinia sclerotiorum). The severity of the root rot complex, mycosphaerella blight (leaf lesions) and ascochyta foot rot (including foot and stem lesions) was assessed for each plant using the rating scales described below (–). The presence of bacterial blight (Pseudomonas syringae pv. pisi) was also assessed. All disease assessments were made based on visual symptoms in the field. No additional testing was conducted to confirm diagnosis.
Table 1. Prevalence of root rot complex, mycosphaerella blight, ascochyta foot rot, white mould and bacterial blight in Saskatchewan field pea crops in 2020
Table 2. Incidence and severity of field pea diseases in Saskatchewan in 2020
Table 3. Severity scale for root rot complex of field pea (Chatterton et al. 2019)
Table 4. Severity rating scale for mycosphaerella blight of field pea (modified from Liu et al. 2013)
Table 5. Ascochyta foot rot stem rating guide (modified from Wang 1998)
RESULTS AND COMMENTS: Approximately 939,600 hectares (2.3 million acres) of field pea were seeded in Saskatchewan in 2020. This is similar to 944,900 hectares (2.3 million acres) seeded in 2019 (Statistics Canada 2021). As of mid-January, 933,100 hectares (2.3 million acres) of field pea were harvested (Statistics Canada 2021) in Saskatchewan. The Saskatchewan Crop Report (Saskatchewan Ministry of Agriculture 2020) estimated that 100% of the Saskatchewan field pea crop had been harvested by October 19, 2020.
Root rot complex was present in all of the surveyed field pea crops with an average incidence of 61.1% across the province (). Average disease incidence ranged from 36.0% (East-central) to 88.0% (Southeast). Disease severity was generally low with an average severity of 2.5 across the province.
Mycosphaerella blight was present in 100% of surveyed fields and was assessed based on leaf lesions. Average incidence was 83% and ranged from 72.9% (South-west) to 93% (West-central) and average severity was 2.4 across the province. Ascochyta foot rot was present in 92.7% of surveyed fields and was assessed based on stem lesions. Average incidence was 36.2% and ranged from 16.6% (South-west) to 63.3% (Northwest). Severity was generally low with an average of 1.7 across the province.
White mould was only present in 14.6% of surveyed fields with an average incidence of 0.9%. White mould symptoms were not present in Northeast and Southeast Saskatchewan.
Symptoms consistent with bacterial blight were present in 51.2% of crops. Bacterial blight was not observed in Northeast Saskatchewan. Additional testing was not conducted to confirm the diagnosis or identify the causal organism. Presence of this disease may be influenced by crop damage due to adverse weather in these regions.
REFERENCES
- Chatterton S, Harding MW, Bowness R, McLaren DL, Banniza S, Gossen BD. 2019. Importance and causal agents of root rot on field pea and lentil on the Canadian prairies, 2014–2017. Can J Plant Pathol. 41(1):98–114.
- Liu JF, Cao TS, Feng J, Chang K-F, Hwang S-F, Strelkov SE. 2013. Characterization of the fungi associated with ascochyta blight of field pea in Alberta, Canada. Crop Prot. 54:55–64.
- Saskatchewan Ministry of Agriculture. 2020. Saskatchewan crop report for the period October 13 to October 19, 2020. https://www.saskatchewan.ca/business/agriculture-natural-resources-and-industry/agribusiness-farmers-and-ranchers/market-and-trade-statistics/crops-statistics/crop-report [accessed 2021 Jan 29]
- Statistics Canada. 2021. Estimated areas, yield, production, average farm price and total farm value of principal field crops, in metric units, annual, CANSIM database: Table 32-10-0359-01. https://www150.statcan.gc.ca/t1/tbl1/en/tv.action?pid=3210035901 [accessed 2021 Jan 29]
- Wang TF. 1998. Evaluation of mycosphaerella blight resistance in pea. [M.Sc. Thesis]. Saskatoon (SK): University of Saskatchewan.
SEED-BORNE PATHOGENS OF PULSE CROPS IN SASKATCHEWAN IN 2019
CROP: Pulse crops (Pea, Lentil and Chickpea)
LOCATION: Saskatchewan
NAMES AND AGENCIES:
B. D. OLSON1, S. BANNIZA2, B. ERNST3, S. FATIMA4, S. JUNEK5, S. PHELPS6, T. PRASAD7, D. RISULA8 & J. WENAUS4
1Box 88, Hazlet, SK S0N 1E0Telephone: (306) 774-5643; Email: [email protected]
2Crop Development Centre, University of Saskatchewan, 51 Campus Dr., Saskatoon, SK S7N 5A8
3Prairie Diagnostic Seed Lab, 1105 Railway Ave., Weyburn, SK S4H 3H5
420/20 Seed Labs Inc., 507 – 11th Ave., Nisku, AB T9E 7N5
5Discovery Seed Labs Ltd., 450 Melville St., Saskatoon, SK S7J 4M2
6Saskatchewan Pulse Growers, 207 – 116 Research Drive, Saskatoon, SK S7N 3R3
7Lendon Seed Lab, 147 Hodsman Road, Regina, SK S4N 5W5
8Saskatchewan Ministry of Agriculture, 3085 Albert St., Regina, SK S4S 0B1
ABSTRACT: Results of commercial plate tests for seed-borne pathogens of 1172 field pea, 1253 lentil and 298 chickpea samples were summarized. The percentage of pathogen-free samples in most crops and for most pathogens continues to be very high. Ascochyta levels have significantly increased in field peas and chickpeas in recent years.
METHODS: Commercial agar plate tests for pathogens in seed samples of field pea, lentil, and chickpea across Saskatchewan were conducted and results summarized by four companies during the fall of 2019 through early spring of 2020. All samples were assumed to be from the 2019 crop year. Seeds were assessed for the presence of the following pathogens:
Ascochyta (Mycosphaerella) pinodes, Didymella (Ascochyta) pisi, and Phoma medicaginis var. pinodella (Ascochyta pinodella) complex, which causes ascochyta blight of field pea;
Didymella (Ascochyta) lentis, causal agent of ascochyta blight of lentil;
Didymella (Ascochyta) rabiei, causal agent of ascochyta blight of chickpea;
Colletotrichum lentis, causal agent of anthracnose of lentil;
Botrytis spp. which causes botrytis stem and pod rot (grey mould) of field pea, lentil and chickpea;
Sclerotinia sclerotiorum, causal agent of sclerotinia stem and pod rot (white mould) of field pea, lentil and chickpea.
A total of 2723 samples were tested for ascochyta blight pathogens, 2660 samples were tested for Botrytis spp., 1247 samples for C. lentis and 2658 samples for S. sclerotiorum. The mean incidence (%) of seed infection in diseased samples and percentage of pathogen-free samples were calculated for each crop district and a provincial average was determined.
RESULTS AND COMMENTS: Lentil production in Saskatchewan increased from 3.3 million acres seeded in 2018 to 3.4 million acres in 2019. The 5-year average is 3.8 million acres. The growing season started off with very dry conditions followed by heavier amounts of precipitation later in the season, the opposite of weather conditions expected during the growing season. This caused more variability in yield throughout the province. The average 2019 lentil yield was 1336 lbs/acre, up from the 1270 lbs/acre reported in 2018 and slightly above the 5-year average (2014-2018) of 1321 lbs/acre (Government of Saskatchewan Citation2019).
The environmental impact on growth of field peas was variable during 2019 and yields varied accordingly. Saskatchewan suffered through a very dry spring and many of the seeded peas did not germinate. When rain did come, it was later in the year and too much precipitation became an issue. Some of the problems experienced in previous years began to show up again, such as aphanomyces and fusarium root rots. Overall, the pea crop seemed to cope quite well with the varying conditions and reached maturity without too many problems. Insects, such as aphids, were an issue in some areas but not widespread. Field pea acreage was 2.3 million acres, up from the 1.9 million acres seeded in 2018. The 2019 average yield was reported at 37.0 bu/acre, up slightly from the 34.5 bu/acre reported in 2018 and above the 5-year average (2014-2018) of 34.4 bu/acre (Government of Saskatchewan Citation2019).
Fewer seeded acres and lower yields of chickpea resulted in decreased production. Chickpea is an indeterminate crop and requires more days to reach maturity than other pulses grown in Saskatchewan. Much of the latter-season rains led to increased vegetative growth and less energy directed toward seed production. The 2019 seeded acres were 331800, less than the 368600 reported in 2018 but significantly above the 5-year average of 191300 acres. Yields in 2019 were reported at 1522 lbs/acre which was down from the 1689 lbs/acre in 2018 and below the 5-year average of 1586 lbs/acre (Government of Saskatchewan Citation2019).
A total of 1172 field pea, 1253 lentil and 298 chickpea samples were processed during the period covered by the report. This represents an increase of 36% in chickpea samples compared to 2018 (Olson et al. Citation2020). Although chickpea samples have increased, total sample numbers remain relatively low compared to lentil and pea samples. Based on the location of chickpea production, samples would originate from southern and south-western crop districts but seed testing labs from these areas are under-represented in this report. Lentil samples increased by 37.5% and field peas by 34.9% compared to 2018. The increased number of samples received by some seed labs was indicative of producer’s concerns related to disease.
Pea – The percentage of Ascochyta-free samples was 36.3%, down from the 59% reported in 2018 (). The mean percent infection was 4.7% (). The percentage of Botrytis-free samples was 93.6%, down from the previous year of 99.1% (). The mean percent infection level of 1.0% was only a slight increase from the 0.9% reported in 2018. The percentage of S. sclerotorium-free samples was 99%, in line with the previous year. The provincial mean percent infection was 0.6%, the same as reported in 2018 (Table 1).
Table 1. Summary of pathogens detected in pulse seed samples tested from 2015 to 2019 in Saskatchewan
Table 2. Number of field pea samples tested from September 2019 to May 2020 and levels of infection with Ascochyta spp., Botrytis spp. and Sclerotinia sclerotiorum for each Saskatchewan Crop District
Lentil – The percentage of A. lentis-free samples was 95.5% (), in line with previous years (). The provincial mean percent infection was 0.8% (), up from the 0.4% reported for 2018 (). The percentage of C. lentis-free samples was 89.2% with a mean percent infection of 0.9% (), compared to 94.1% and 0.5% in 2018 (). The frequency of Botrytis-free samples was 93.2% (), down slightly from 96.2% in 2018 (). The mean percent infection was 1.0% () unchanged from 1.0% in 2018 (). The frequency of S. sclerotiorum-free samples remained high at 96.0% () compared to 97.7% in 2018 (). The mean percent infection rate was 0.7% (), up slightly from 0.5% in 2018 ().
Table 3. Number of lentil seed samples tested from September, 2019 to May, 2020 and levels of infection with Ascochyta lentis, Colletotrichum lentis, Botrytis spp., and Sclerotinia sclerotiorum for each Saskatchewan Crop District
Chickpea – Chickpea production in Saskatchewan is largely centered in the southern and south-western regions of the province where small numbers of samples were evaluated by the four contributing companies. The overall percentage of Ascochyta rabiei-free samples was 51.3% () down from the 74.9% of 2018 (). The mean infection percentage was 3.2% (), higher than the 1.2% of 2018 (). The frequency of Botrytis-free samples was 86.6% () down from 96.3% in 2018 (). The mean infection rate was 1.9% (), up from the 1.1% reported in 2018 (). The frequency of S. sclerotiorum-free samples was 89.8% (), down from the 98.1% reported in 2018 (). The mean percent infection was 0.9% ().
Table 4. Number of chickpea seed samples tested from September 2019 to May 2020 and levels of infection with Ascochyta rabiei, Botrytis spp., and Sclerotinia sclerotiorum for each Saskatchewan Crop District
ACKNOWLEDGEMENTS: We would like to acknowledge the cooperation of 20/20 Seed Labs Inc., Lendon Seed Lab, Prairie Diagnostic Seed Lab, and Discovery Seed Labs Ltd. for providing seed testing results. We also wish to recognize the financial support of the Saskatchewan Pulse Growers.
REFERENCES
- Government of Saskatchewan. 2019. Specialty crop report. Regina (SK). https://publications.saskatchewan.ca/#/products/103821 [accessed 2020 Dec 23]
- Olson B, Banniza S, Blois T, Ernst B, Junek S, Phelps S, Prasad T, Ziesman B. 2020. Seed-borne pathogens of pulse crops in Saskatchewan in 2018. Can Plant Dis Surv. 100:130–133. In, Can J Plant Pathol. Vol. 42:sup 1.
- Olson B, Banniza S, Blois T, Ernst B, Junek S, Phelps S, Prasad T, Ziesman B. 2019a. Seed-borne pathogens of pulse crops in Saskatchewan in 2017. Can Plant Dis Surv. 99:150–154. In, Can J Plant Pathol. Vol. 41:sup 1.
- Olson B, Banniza S, Blois T, Ernst B, Junek S, Phelps S, Ziesman B. 2019b. Seed-borne pathogens of pulse crops in Saskatchewan in 2016. Can Plant Dis Surv. 99:145–149. In, Can J Plant Pathol. Vol. 41:sup 1.
- Olson B, Banniza S, Blois T, Ernst B, Junek S, Phelps S, Ziesman B. 2019c. Seed-borne pathogens of pulse crops in Saskatchewan in 2015. Can Plant Dis Surv. 99:141–144. In, Can J Plant Pathol. Vol. 41:sup 1.
2020 SURVEY OF SOYBEAN DISEASES IN SASKATCHEWAN
CROP: Soybean
LOCATION: Saskatchewan
NAMES AND AGENCIES:
A. AKHAVAN1, C. PERU1, C. JACOB1, D. RISULA1, J. KWASNICKI2, K. MAKOHONIUK2, S. MARCINO1 & S. ROBERTS1
1 Saskatchewan Ministry of Agriculture, 3085 Albert St., Regina, SK S4S 0B1Telephone: (306) 787-4671; Facsimile: (306) 787-0428; E-mail: [email protected]
2Saskatchewan Association of Rural Municipalities, 2301 Windsor Park Rd., Regina, SK S4V 3A4
ABSTRACT: A total of 16 soybean crops were surveyed in Saskatchewan in 2020. Bacterial blight and brown spot were the most prevalent diseases in 2020 soybean crops with 100% and 93.8% of survey crops showing symptoms, respectively. Frogeye leaf spot symptoms were observed in 68.8% of surveyed crops with an overall average incidence of 20.9%. Downy mildew was only present in 12.5% of crops (two fields) with an overall average incidence of 4.5%. Average severity of infected plants in fields with symptoms present was 1.1. White mould, anthracnose, soybean rust and charcoal rust were not present in any of the 16 surveyed soybean crops in 2020.
INTRODUCTION AND METHODS: The 16 Saskatchewan soybean crops were surveyed between August 11 and 25 when crops were between growth stage R3 (beginning pod) to R6 (full seed). Fields were located across the major soybean production area in Saskatchewan. Disease assessments were made by examining 10 plants from each of five sites along a “W” pattern in each field, for a total of 50 plants per field. Each of the 50 plants were assessed for the presence of the following diseases: brown spot (Septoria glycines), bacterial blight (Pseudomonas savastanoi pv. glycinea), downy mildew (Peronospora manshurica), white mould (Sclerotinia sclerotiorum), pod and stem blight (Diaporthe sojae), anthracnose (Colletotrichum spp.), frogeye leaf spot (Cercospora sojina) and phytophthora root rot (Phytophthora spp.). Disease severity was also assessed for brown spot, bacterial blight and downy mildew using a 0 to 5 rating scale where 0 = no disease present and 5 = severe symptoms in the mid to upper canopy. The prevalence of iron chlorosis, sudden death syndrome (Fusarium virguliforme), soybean rust (Phakopsora meibomiae and P. pachyrhizi), charcoal rot (Macrophomina phaseolina) and soybean cyst nematode (Heterodera glycines) was estimated by recording the presence or absence in the field. All disease assessments were made based on visual symptoms in the field.
RESULTS AND COMMENTS: In 2020, approximately 51,300 hectares (126,700) acres seeded to soybean in Saskatchewan. This was lower than the 60,700 hectares (150,000 acres) seeded in 2019 (Statistics Canada 2021). As of mid-January 2021, 51,100 hectares (126,300 acres) of soybean were harvested in Saskatchewan (Statistics Canada 2021). The Saskatchewan Crop Report (Saskatchewan Ministry of Agriculture 2020) estimated that 100% of the Saskatchewan soybean crop had been harvested by October 19, 2020.
The most prevalent disease in Saskatchewan in 2020 was bacterial blight, which was present in all fields with an average incidence of 82.6% when averaged across all surveyed fields (). The average disease severity of infected plants in fields with symptoms present was 1.8 as rated on a 0 to 5 rating scale.
Table 1. Prevalence, incidence and severity of bacterial blight, brown spot and downy mildew in Saskatchewan soybean fields in 2020
Symptoms consistent with brown spot were observed in 93.8% of surveyed crops with an overall average incidence of 33.3% and an average severity of 1.3 on infected plants in fields with symptoms present.
Frogeye leaf spot symptoms were observed in 68.8% of surveyed crops with an overall average incidence of 20.9%.
Downy mildew was only present in 12.5% of crops (two fields) with an overall average incidence of 4.5%. Average severity on infected plants in fields with symptoms present was 1.1.
Symptoms suspected to be phytophthora root rot were observed in six fields in Southeast Saskatchewan and were submitted to Dr. Debra McLaren for further analysis. Also, symptoms suggesting sudden death syndrome were observed in three crops, but these were not further evaluated at a lab.
Pod and stem blight was observed only in one field with an incidence of 4% in the infected field. Iron chlorosis was also observed in three of the fields surveyed. No additional diseases including white mould, anthracnose, soybean rust and charcoal rust were observed.
REFERENCES
- Statistics Canada. 2021. Estimated areas, yield, production, average farm price and total farm value of principal field crops, in metric units, annual, CANSIM database: Table 32-10-0359-01. https://www150.statcan.gc.ca/t1/tbl1/en/tv.action?pid=3210035901 [accessed 2021 Jan 29]
- Saskatchewan Ministry of Agriculture. 2020. Saskatchewan crop report for the period October 13 to October 19, 2020. https://www.saskatchewan.ca/business/agriculture-natural-resources-and-industry/agribusiness-farmers-and-ranchers/market-and-trade-statistics/crops-statistics/crop-report [accessed 2021 Jan 29]
DISEASES OF DRY BEAN IN MANITOBA IN 2020
CROP: Dry bean
LOCATION: Manitoba
NAMES AND AGENCIES:
Y.M. KIM1, D.L. MCLAREN1, A. HOU2, N. VACHON1 & W.C. PENNER2
1Agriculture and Agri-Food Canada (AAFC), Brandon Research and Development Centre, 2701 Grand Valley Rd., Brandon, MB R7A 5Y3Telephone (204) 578-6691; Facsimile (204) 578-6524 E-mail: [email protected]
2AAFC, Morden Research and Development Centre, Unit 101, Route 100, Morden, MB R6M 1Y5
ABSTRACT: A total of 40 and 39 bean crops were surveyed for root and foliar diseases, respectively. Fusarium root rot was the most prevalent root disease and common bacterial blight the most widespread foliar disease throughout the province. Halo blight and sclerotinia stem and pod rot were also observed. In 2020, rhizoctonia root rot, rust and anthracnose were not detected in any of the surveyed dry bean crops.
METHODS: Crops of dry bean in Manitoba were surveyed for root and foliar diseases at 40 and 39 different locations, respectively. The survey for root diseases was conducted during late July when most plants were at the early to mid-flowering stage. The majority of the crops surveyed were selected at random from regions in southern Manitoba where most of the dry bean crops are grown, with 10% of the crops located outside of the traditional bean growing regions. During the root disease survey, the severity of halo blight (Pseudomonas syringae pv. phaseolicola) also was assessed. When the plants were starting to mature during mid-August, the foliar disease survey was carried out on the same fields assessed for root rot.
For the root diseases, at least 10 plants were sampled at each of three random sites in each crop surveyed. Root diseases were rated on a scale of 0 (no disease) to 9 (death of plant). Fifteen symptomatic roots were collected from each of the 40 crops for fungal isolation and identification. Identification of Fusarium species involved visual assessment, microscopic examination and morphological characterization using the criteria of Leslie and Summerell (2006). Fifteen roots from each of the 40 crops surveyed were frozen for future PCR analysis of root rot pathogens. Foliar diseases were identified by their symptoms. Common bacterial blight (CBB) (Xanthomonas axonopodis pv. phaseoli) was assessed based on the percent incidence of leaf infection and on a severity scale of 0 (no disease) to 5 (50-100% of the leaf area covered by lesions). Anthracnose (Colletotrichum lindemuthianum), rust (Uromyces appendiculatus), white mould (Sclerotinia sclerotiorum) and halo blight (Pseudomonas syringae pv. phaseolicola) severity were assessed as percentages of infected plant tissue.
RESULTS AND COMMENTS: In early May, completing harvest of the 2019 crops remained a priority with a piecemeal approach to seeding in all regions based on fields being dry enough to support equipment. In many areas, soils remained wet to saturated inhibiting movement of farm machinery and restricting seeding operations. By June 2nd, seeding of the dry bean crop was 95% completed (Manitoba Agriculture and Resource Development (MARD) 2020). Most areas of agro-Manitoba received between 70 to 80% of normal precipitation for the season, though certain districts experienced more or less, particularly where intense thunderstorms left flooded fields north of Brandon and in the extreme southeast of the province.
Six percent of harvest was completed by September 8th, similar to 2019, compared to the 3-year (2016-2018) average of 25% completed by the same date (Manitoba Agriculture Citation2019a). In 2019, harvest was slowed down due to widespread rainfall with 69% of the crop harvested by October 29th compared with 99% of crop harvested by October 6, 2020 (MARD Citation2020).
Edible bean harvested yields were considered to be above average at 1800 to 2200 lbs/acre (MARD Citation2020). Overall quality was good except for some later planted fields west of the escarpment that suffered from the first frost. In 2019, average yields ranged from 1000 to 1500 lb/ac (Manitoba Agriculture Citation2019b) compared with the 2018 yields of 1400 to 2000 lb/ac (Manitoba Agriculture Citation2018).
Fusarium root rot was observed in all of the 40 dry bean crops surveyed (), with severity ratings ranging from 2.4 to 6.3, and a mean of 4.0. It has remained the most prevalent root disease of dry bean for several years (Conner et al. Citation2011; Henriquez et al. Citation2013; Kim et al. Citation2019, Citation2020). A number of Fusarium spp. including F. redolens, F. acuminatum, F. oxysporum and F. avenaceum were isolated from symptomatic root tissue. Rhizoctonia root rot (Rhizoctonia solani) and pythium root rot (Pythium spp.) were not detected in any of the crops surveyed based on microscopic examination and morphological characterization. Seventeen crops (43%) had average root rot severity ratings >4 (i.e., symptoms were present on 50% of the root system and plants were stunted) and this would have had a detrimental effect on yield. These results were similar to those of 2019 (35%). There were more surveyed crops with average root rot ratings >4 in 2018 (68%) and 2017 (63%). However, in 2016, a much wetter year, 93% of bean crops had severity ratings above 4, which represents the highest percentage of bean crops surveyed with yield-robbing root rot severity ratings over the past six years. In 2020, halo blight was assessed in the 40 crops surveyed and was observed in 10 (25%) of crops with an average of 6% leaf area infected ().
Table 1. Prevalence and severity of root diseases and halo blight in 40 crops of dry bean in Manitoba in late July in 2020
Two foliar diseases were observed during the survey in August (). Common bacterial blight (CBB) symptoms were observed in 82% (32/39) of crops. The incidence of CBB leaf infection ranged from 1.7 to 30% with a mean of 11.6%, while severity ranged from 0.3 to 3.0, with a mean of 1.5. Anthracnose was not detected from 2014 to 2020, unlike many years prior to this period. Rust was not observed in any of the crops surveyed in 2020. White mould symptoms were detected in 31% (12/39) of the crops with 3.1% of tissue infection. Seasonal precipitation in many of the bean growing regions of Manitoba was above normal in 2016, but below normal in 2017, 2018 and 2019 which would have contributed to the reduced risk of yield losses due to white mould in the latter three years. In 2020, disease impacts were variable with some fields having more infection and other with no disease impact at all.
Table 2. Prevalence and severity of foliar diseases in 39 crops of dry bean in Manitoba in August in 2020
REFERENCES
- Conner RL, McLaren DL, Penner WC, Kerley TJ. 2011. Diseases of field bean in Manitoba in 2010. Can Plant Dis Surv. 91:107–108.
- Henriquez MA, McLaren DL, Conner RL, Penner WC, Kerley TJ. 2013. Diseases of field bean in Manitoba in 2012. Can Plant Dis Surv. 93:143–144.
- Kim YM, McLaren DL, Conner RL, Penner WC, Kerley TJ. 2019. Diseases of field bean in Manitoba in 2018. Can Plant Dis Surv. 99:170–171. In, Can. J. Plant Pathol. 41:sup1.
- Kim YM, McLaren DM, Conner RL, Penner WC, Kerley TJ. 2020. Diseases of dry bean in Manitoba in 2019. Can Plant Dis Surv. 100:153–154. In, Can J Plant Pathol. 42:sup1.
- Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Ames (IA): Blackwell.
- Manitoba Agriculture. 2018. Crop report summary. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- Manitoba Agriculture. 2019a September 10. Crop report survey. Issue 20. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- Manitoba Agriculture. 2019b November 5. Crop report survey. Issue 28. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- Manitoba Agriculture and Resource Development (MARD). 2020 October 20. Crop report summary. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
SURVEY OF CANOLA DISEASES IN MANITOBA IN 2020
CROP: Canola
LOCATION: Manitoba
NAMES AND AGENCIES:
D.L. McLAREN1, D. KAMINSKI2, J. GRAHAM3, M. PRADHAN4, E. BARGEN2, A. BRACKENREED5, T. BUSS2, N. CLOUSON2, J. CORNELSEN5, T. CUMMER2, A. FAROOQ2, J. FREY2, D. FROESE2, N. HARI2, J. HEARD2, T. HENDERSON1, N. VACHON1, L. KASKIW2, I. KRISTJANSON2, A. KUBINEC2, D. LANGE2, L. MITCHELL2, M. McCRACKEN2 & R. PICARD2
1Agriculture and Agri-Food Canada, Brandon Research and Development Centre, 2701 Grand Valley Rd., Brandon, MB R7A 5Y3.Telephone: (204) 578-6561; Facsimile: (204) 578-6524; E-mail: [email protected]
2Manitoba Agriculture and Resource Development (MARD), Carman, MB R0G 0J0
381 Ellesmere Ave, Winnipeg, MB R2M 0G5
4MARD, Crop Diagnostic Centre, 201-545 University Crescent, Winnipeg, MB R3T
5Canola Council of Canada, 400-167 Lombard Ave, Winnipeg, MB R3B 0T6
ABSTRACT: A total of 161 canola crops were surveyed in Manitoba for the prevalence and incidence or severity of sclerotinia stem rot, blackleg, alternaria pod spot, aster yellows, fusarium wilt, foot rot and clubroot. Blackleg (basal canker) was the most prevalent disease throughout the province. Canola plants collected from one canola crop (1/161) were confirmed to have clubroot. Verticillium stripe was identified in 14 canola samples submitted to the Manitoba Crop Diagnostic Centre.
METHODS: A total of 161 canola crops were surveyed in the southwest (70), northwest (39), eastern/interlake (12) and central (40) regions of Manitoba between August 4 and September 4, 2020. All crops were Brassica napus and the majority were surveyed before swathing while plants were between growth stages 5.1 and 5.5 (Harper and Berkenkamp 1975). In each canola crop, 100 plants were selected in a regular pattern starting at a corner of the field or at a convenient access point. The edges of the fields were avoided. Twenty plants were removed from each of five points of a “W” pattern in the field. Points of the “W” were at least 20 paces apart. All plants were pulled up, removed from the field and examined for the presence of diseases. For soil collection from 20 fields, samples were obtained from each of the five points of the “W”, or if the field entrance was identifiable, they were collected at five points near the entrance.
Canola crops were assessed for the prevalence (percent crops infested) and incidence (percent plants infected per crop) of sclerotinia stem rot (Sclerotinia sclerotiorum), aster yellows (Candidatus Phytoplasma asteris), foot rot (Fusarium spp. and Rhizoctonia sp.), blackleg (Leptosphaeria maculans), fusarium wilt (F. oxysporum f. sp. conglutinans) and clubroot (Plasmodiophora brassicae). For sclerotinia stem rot, each plant was also scored based on the possible impact of infection on yield using a disease severity scale of 0 (no symptoms) to 5 (main stem lesion with potential effects on seed formation and filling of entire plant) (Kutcher and Wolf 2006). Blackleg lesions that occurred on the upper portions of the stem were assessed separately from basal stem cankers. Stem lesions were recorded as present or absent. Basal stem cankers were scored using a disease severity scale of 0 to 5 based on area of diseased tissue in the stem cross-section where 0 = no diseased tissue visible in the cross section and 5 = diseased tissue occupying 100% of the cross section and plant dead (WCC/RRC 2009). If present, clubroot symptoms were rated using a scale of 0 to 3 where 0 = no galling and 3 = severe galling (Kuginuki et al. 1999). The prevalence and percent severity (Conn et al. Citation1990) of alternaria pod spot (Alternaria spp.) were also determined. When diseases were observed in the crop, but not in the sample of 100 plants, they were recorded as “trace” for incidence and counted as 0.1%. Mean disease incidence or severity values were calculated for each region. In addition to the visual assessment of diseases, soil samples were collected from approximately 20 of the surveyed canola fields in Manitoba for DNA analysis (Cao et al. Citation2007) to test for the presence of the clubroot pathogen. Canola samples symptomatic for verticillium stripe were submitted to the Manitoba Agriculture Crop Diagnostic Centre for confirmation of the disease.
RESULTS: A number of diseases were present in each of the four regions of Manitoba. Plants that were symptomatic of clubroot were collected from one of the 161 crops surveyed. An additional three fields from outside of this survey were confirmed to have clubroot based on visual symptoms. The 2020 results include two rural municipalities where clubroot had not previously been found in any surveyed field.
Information on the monitoring and occurrence of clubroot in Manitoba in previous years is provided by Froese et al. (Citation2019), Kubinec et al. (Citation2014) and Derksen et al. (Citation2013). A map of clubroot distribution in Manitoba (2009-2020) is available online (Manitoba Agriculture and Resource Development (MARD) 2020a) and has been updated for the 2020 canola crops. The map will be updated again for any soil samples positive for clubroot DNA once analyses are completed.
Sclerotinia stem rot was prevalent in 39% of the crops surveyed, ranging from a high of 53% in the southwest region to 19% in the northwest region with a provincial mean of 39% (). Mean disease incidence averaged across all crops was 2.1% and ranged from 2.9% in the southwest region to 0.6% in the northwest region. For infested crops only, mean disease incidence was 5.5%. Throughout the province, mean severity of sclerotinia stem rot was 1.0 and ranged from 0.4 in the northwest region to 1.6 in the southwest region.
Table 1. Mean prevalence, incidence and severity of sclerotinia stem rot and blackleg in Manitoba in 2020
Aster yellows was observed in 3.1% of canola crops in Manitoba with an average disease incidence of 1.6% in these crops (). The prevalence of this disease was substantially less than in 2012 (95%), when record high levels of aster yellows were observed in all regions of Manitoba. Contributing factors to the high level of aster yellows in 2012 included drought in the midwestern United States, the early arrival of aster leafhoppers from the southern U.S. and the higher-than-normal percentage of infected individuals (10–15%) in the leafhopper population. The reduced risk of aster yellows in recent years has been due to lower numbers of leafhoppers and a percentage of infected aster leafhoppers that is normally 2–3% in Manitoba (Gavloski Citation2017; MARD Citation2020b).
Table 2. Mean prevalence and incidence or severity of alternaria pod spot, aster yellows, fusarium wilt and foot rot in Manitoba in 2020
Table 3. Distribution of incidence (sclerotinia, blackleg, aster yellows, fusarium wilt and foot rot) and severity (alternaria pod spot) classes in 161 crops of Brassica napus in Manitoba in 2020
Blackleg basal cankers occurred in 83% of the crops surveyed in 2020 (), with prevalence ranging from 92% in the eastern/interlake region to 84% in the northwest region. The mean incidence of basal cankers averaged across all crops was 19%, while the mean incidence in infested crops was 23%. The severity of blackleg basal cankers was similar in recent years with mean ratings of approximately 2 or less. A value of 2 indicates that 26-50% of the basal stem cross-section was diseased. The mean prevalence of blackleg stem lesions in 2020 was 53%. In previous years, 52% and 54% and 47% of crops had stem lesions in 2017, 2018, and 2019 respectively (McLaren et al. Citation2018, 2019, 2020). The average incidence of blackleg stem lesions was 13% in infested crops and 7% in all crops.
The mean prevalence of alternaria pod spot in 2020 was 17% and ranged from 58% in the eastern/interlake region to 6% in the southwest region (). The mean severity of alternaria pod spot was 1.1% in infested crops.
Fusarium wilt was observed in 30% of canola crops surveyed in Manitoba, with a mean incidence of 13% in diseased fields (). Foot rot occurred in 9% of canola crops surveyed with a provincial mean disease incidence of <1%. Foot rot was observed in the northwest (6%) and southwest (19%) regions only (). White rust (Albugo candida) has not been confirmed in any crop of B. napus since 2011 (McLaren et al. Citation2012). Fourteen samples submitted to the Crop Diagnostic Centre were confirmed positive for verticillium stripe.
The distribution of incidence (sclerotinia, blackleg, aster yellows, fusarium wilt and foot rot) and severity (alternaria pod spot) classes in 161 crops of Brassica napus in Manitoba in 2020 is presented in .
ACKNOWLEDGEMENTS: We thank the Manitoba Canola Producers for their continued support of this survey work and both the Manitoba Canola Growers Association and the Canola Council of Canada for their financial assistance.
REFERENCES
- Cao T, Tewari J, Strelkov SE. 2007. Molecular detection of Plasmodiophora brassicae, causal agent of clubroot of crucifers, in plant and soil. Plant Dis. 91(1):80–87. doi:https://doi.org/10.1094/PD-91-0080
- Conn KL, Tewari JP, Awasthi RP. 1990. A disease assessment key for Alternaria blackspot in rapeseed and mustard. Can Plant Dis Surv. 70:19–22.
- Derksen H, Kubinec AM, McLaren DL. 2013. Detection of Plasmodiophora brassicae in Manitoba, 2011. Can Plant Dis Surv. 93:159.
- Froese RD, Derksen H, Kubinec A, Guo X, McLaren DL. 2019. Monitoring and occurrence of clubroot in Manitoba in 2018. Can Plant Dis Surv. 99:179. In, Can J Plant Pathol. 41:sup1.
- Gavloski J. 2017 December. Summary of insects on crops in Manitoba in 2017. Manitoba Agriculture. www.gov.mb.ca/agriculture/crops/insects/pubs/insect-summary-2017.pdf [accessed 2021 Jan 28]
- Harper FR, Berkenkamp B. 1975. Revised growth-stage key for Brassica campestris and B. napus. Can J Plant Sci. 55(2):657–658.
- Kubinec AM, Derksen H, Desjardins M, McLaren DL. 2014. Monitoring and occurrence of clubroot in Manitoba in 2013. Can Plant Dis Surv 94:184–185.
- Kuginuki Y, Yoshikawa H, Hirai M. 1999. Variation in virulence of Plasmodiophora brassicae in Japan tested with clubroot-resistant cultivars of Chinese cabbage (Brassica rapa L. ssp. pekinensis). Eur J Plant Pathol.105(4):327–332.
- Kutcher HR, Wolf TM. 2006. Low-drift fungicide application technology for sclerotinia stem rot control in canola. Crop Prot. 25(7):640–646.
- Manitoba Agriculture and Resource Development (MARD). 2020a. Clubroot distribution in Manitoba: cumulative testing 2009–2020. www.gov.mb.ca/agriculture/crops/plant-diseases/clubroot-distribution-in-manitoba.html [accessed 2021 Jan 28]
- MARD. 2020b. Aster leafhoppers and aster yellows. www.gov.mb.ca/agriculture/crops/insects/aster-leafhoppers-yellows.html [accessed 2021 Jan 28]
- McLaren DL, Platford RG, Kubinec A, Kutcher HR, Bisht V, Derksen H, Kristjanson I, Phillips K, Henderson TL, Hausermann DJ, et al. 2012. Survey of canola diseases in Manitoba in 2011. Can Plant Dis Surv. 92:130–132.
- McLaren DL, Derksen H, Graham J, Ariyaratne I, Bargen E, Brackenreed A, Brar D, Buss T, Clouson N, Cummer T, et al. 2018. Survey of canola diseases in Manitoba in 2017. Can Plant Dis Surv. 98:175–179.
- McLaren DL, Derksen H, Graham J, Ariyaratne I, Arnott S, Bargen E, Berthelette C, Bonser G, Brackenreed A, Buss T, et al. 2019. Survey of canola diseases in Manitoba in 2018. Can Plant Dis Surv. 99:175–178. In, Can J Plant Pathol. 41:sup1.
- McLaren DL, Kaminski D, Graham J, Bargen E, Buss T, Clouson N, Cummer T, Farooq A, Forbes B, Froese D, et al. 2020. Survey of canola diseases in Manitoba in 2019. Can Plant Dis Surv. 100:149–152. In, Can J Plant Pathol. 42:sup1.
- Western Canada Canola/Rapeseed Recommending Committee (WCC/RCC). 2009. Procedures for evaluation and recommendation for registration of canola/rapeseed candidate cultivars in western Canada. Appendix B. Disease Testing Protocols, p. 11.
DISEASES OF FLAX IN MANITOBA AND SASKATCHEWAN IN 2020
CROP: Flax
LOCATION: Manitoba and Saskatchewan
NAMES AND AGENCIES:
K. NABETANI1, T. ISLAM1, H. R. KUTCHER1, M. REZA1, C. PERU2, M. BEAITH3, C. JACOB2, S. ROBERTS2, E. CAMPBELL2, J. IPPOLITO2, M. BROWN2, S. MARCINO2, A. BOWDITCH2 & G. KRUGER2
1Crop Development Centre, University of Saskatchewan, 51 Campus Drive, College of Agriculture and Bioresources, Saskatoon, SK S7N 5A8Telephone: (306) 966–8661; Facsimile: (306) 966–5015; Email: [email protected]
2Crops Branch, Saskatchewan Ministry of Agriculture, 3085 Albert Street, Regina, SK S4S 0B1
3Saskatchewan Flax Development Commission, 8-3815 Thatcher Avenue, Saskatoon, SK S7R 1A3
ABSTRACT: In the 86 flax crops surveyed in 2020, pasmo was the most prevalent disease found in 54% of crops in Saskatchewan and 91% in Manitoba, followed by alternaria blight observed in 20% of crops in Saskatchewan and 64% in Manitoba. Fusarium wilt was observed in 7% of all crops surveyed and the prevalence of aster yellows was 9%. No powdery mildew or rust was observed on flax crops.
METHODS: In 2020, a total of 86 flax crops were surveyed in southern Manitoba (11) and Saskatchewan (75) between August 13th and September 4th. Each crop field was surveyed by walking approximately 100 m in an “M” pattern at 20 m away from the field edge. Stand establishment and maturity were recorded on a scale of 1 to 5, where 1 was very poor/early and 5 was excellent/mature. Diseases were identified by visual characteristics. The prevalence of pasmo disease (Septoria linicola (Speg.) Garass.) was defined as the percentage of crops in which symptoms of pasmo were observed out of all fields surveyed. In each field, 100 flax plants were examined and disease incidence was defined as the percentage of flax plants affected by pasmo and disease severity as the average percentage of the stem area of diseased plants covered with pasmo symptoms. Other diseases, alternaria blight (Alternaria spp.), fusarium wilt (Fusarium oxysporum f. sp. lini (Bolley) Snyder & Hansen), flax rust (Melampsora lini (Ehrenb.) Lév.), aster yellows (AY phytoplasma) and powdery mildew (Oidium lini Bondartsev), were recorded as present or absent.
RESULTS AND COMMENTS: Of all flax crops surveyed, 66% of them (54% in Manitoba, 68% in Saskatchewan) were at yellow to brown, or brown boll stages at the time of survey. A small number of flax crops were late maturing with green bolls (3% in total, 3% in Manitoba, 3% in Saskatchewan), while the rest were in the process of maturation. Fifty-one percent of flax crops (100% in Manitoba and 44% in Saskatchewan) had excellent stand and 37% had good stand. Lodging was not widespread and was observed only in 9% of all flax crops (27% in Manitoba, 7% in Saskatchewan); lodging incidence was minimal to mild (less than 5% of the field) except for one field with hail damage.
Pasmo was the most prevalent disease; it was found in 59% of flax crops (91% in Manitoba, 54% in Saskatchewan). In crops affected by pasmo, 28% had trace to 10% incidence (). Pasmo incidence ranged from 11 to 30% in 11% of the flax crops, 31 to 60% in 6% of crops, and 14% of crops had >60% pasmo incidence. The severity of pasmo ranged from trace to 5% in 34% of the flax crops, from 6 to 25% in 18% of the crops, and from 25 to 75% in 4% of the crops. Only 4% of all flax crops had a pasmo severity higher than 75%. The prevalence of pasmo in 2020 was higher than 2019 (50%); the increase was mostly attributed to more crops with low incidence in 2020 than in 2019. There were more flax crops with lower pasmo severity in 2020 than in 2019 (Islam et al. Citation2020). Both pasmo incidence and severity levels were lower in 2020 than in the previous five years (Rashid et al. Citation2016, Citation2017, Citation2018, Citation2019).
Table 1. Pasmo incidence and severity in 75 flax crops in Saskatchewan, 11 crops in Manitoba and 86 crops combined in 2020
Fusarium wilt of flax was found at trace level in 7% of all flax crops (18% in Manitoba, 6% in Saskatchewan). The prevalence was only slightly higher (by 1%) in 2020 than it was in 2018 and 2019, and lower than 2015, 2016 and 2017 (Rashid et al. Citation2016, Citation2017, Citation2018, Citation2019; Islam et al. Citation2020). The low prevalence of pasmo and fusarium wilt could be attributed the hot, dry weather in 2020. Alternaria blight was the second most prevalent disease after pasmo and was found on 26% of all flax crops (64% in Manitoba, 20% in Saskatchewan), which was the same as in 2019. There was a low prevalence of aster yellows, which was found in 9% of all flax crops (27% in Manitoba, 8% in Saskatchewan), and was slightly higher in 2020 than in 2019 (6%).
No flax crops with powdery mildew or flax rust were observed during the disease survey. An incidence of mild powdery mildew was observed in mid-September in the pasmo disease nursery at the Kernen Research Farm in Saskatoon.
REFERENCES
- Islam T, Kutcher HR, Lee S, Beaith M, Peru C, Ziesman B, Jacob C, Hicks L, Noble A. 2020. Diseases of flax in Saskatchewan in 2019. Can Plant Dis Surv. 100:136. In, Can J Plant Pathol. 42:sup 1.
- Rashid KY, Kutcher HR, Islam T, Stephens DT, Dokken-Bouchard F, Pradhan MP, Duguid S. 2016. Diseases of flax in Manitoba and Saskatchewan in 2015. Can Plant Dis Surv. 96:180–181.
- Rashid KY, Ziesman B, Jacob C, Hicks L, Kindrachuk K, Peru C, Kutcher HR, Islam T, Cholango Martinez LP, Cabernel T, et al. 2019. Diseases of flax in Manitoba and Saskatchewan in 2018. Can Plant Dis Surv. 99:180–181. In, Can J Plant Pathol. 41:sup 1.
- Rashid KY, Ziesman B, Jacob C, Kutcher HR, Islam T, Cholango-Martinez P, Cabernel T, Penner M, Pradhan MP. 2018. Diseases of flax in Manitoba and Saskatchewan in 2017. Can Plant Dis Surv. 98:192–193.
- Rashid KY, Ziesman B, Jacob C, Kutcher HR, Islam T, Pradhan MP. 2017. Diseases of flax in Manitoba and Saskatchewan in 2016. Can Plant Dis Surv. 97:203–205.
FIELD PEA DISEASES IN MANITOBA IN 2020
CROP: Field pea
LOCATION: Manitoba
NAMES AND AGENCIES:
D.L. MCLAREN1, Y.M. KIM1, T.L. HENDERSON1, N.J. VACHON1, S.F. HWANG2, K.F. CHANG3, S. CHATTERTON4, C. TKACHUK5, L. SCHMIDT5, N. CLOUSON6, D. LANGE7 & A. FAROOQ8
1Agriculture and Agri-Food Canada (AAFC), Brandon Research and Development Centre, 2701 Grand Valley Road, Brandon, MB R7A 5Y3Telephone: (204) 578-6561; Facsimile: (204) 578-6524; E-mail: [email protected]
2Department of Agricultural, Food and Nutritional Science, University of Alberta, 410 Agriculture/Forestry Centre, Edmonton, AB T6G 2P5
3Alberta Agriculture and Forestry, Crop Diversification Centre North, 17507 Fort Road NW, Edmonton, AB T5Y 6H3
4AAFC, Lethbridge Research and Development Centre, P. O. Box 3000, Lethbridge, AB T1J 4B1
5Manitoba Pulse and Soybean Growers, P.O. Box 1760, Carman, MB R0G 0J0
6Manitoba Agriculture and Resource Development (MARD), P.O. Box 370, Swan River, MB R0L 1Z0
7MARD, Altona, MB R0G 0B0
8MARD, Hamiota, MB R0M 0T0
ABSTRACT: A total of 46 and 14 pea crops were surveyed in Manitoba for root and foliar diseases, respectively. Fusarium root rot was the most prevalent root disease and mycosphaerella blight the most widespread foliar disease throughout the province. Diseases that were less frequently observed included downy mildew, bacterial blight and white mould. Rust, powdery mildew and anthracnose were not observed in any of the crops surveyed in 2020. Root samples collected from a total of 142 pea fields in 2016 (30), 2017 (30), 2018 (40) and 2019 (42) indicated that Aphanomyces euteiches was present in 77%, 47%, 56% and 83% of these fields, respectively. The 2020 PCR results for A. euteiches from 46 crops were not available at the time of this report.
METHODS: Field pea crops were surveyed for root and foliar diseases at 46 and 14 different locations, respectively, in Manitoba. The crops surveyed were randomly chosen from regions in south-central and southwest Manitoba, where field pea is commonly grown. For the root disease survey, three of the 46 crops were from the Swan River area where the area seeded to field pea increased from 2,925 ha in 2016 to 4,840 ha in 2018. In Manitoba, field pea acreage has increased in recent years from approximately 22,000 and 26,000 ha in 2014 and 2015, respectively (Manitoba Pulse and Soybean Growers Citation2015). In 2016, the area sown to field pea more than doubled to 66,000 ha based on an increased demand for peas (Manitoba Agriculture and Agrifood Statistics Citation2017). However, in 2017, the seeded area dropped to 26,200 ha mainly as a result of wet, unfavourable growing conditions for peas during the 2016 field season, which deterred many growers from seeding peas in the following year (Manitoba Agriculture Citation2017). The area seeded to field pea in Manitoba increased to 34,000 ha and 45,620 ha in 2018 and 2019, respectively (Manitoba Agricultural Services Corporation (MASC) Citation2018, MASC Citation2019) with 63,076 ha seeded in 2020 (Manitoba Agriculture and Resource Development (MARD) 2020a).
The survey of root diseases was conducted during late June to mid-July when most plants were at the late vegetative to mid-reproductive stage. At least 10 plants were sampled from each of three random sites in each crop surveyed. Root diseases were rated on a scale of 0 (no disease) to 9 (death of plant) (Xue Citation2000). To confirm the visual disease identification, 15 symptomatic roots were collected from each crop for fungal isolation and identification. Identification of Fusarium species involved visual assessment, microscopic examination and morphological characterization using the criteria of Leslie and Summerell (2006). Fifteen roots from each of the 46 pea crops were frozen for future PCR analysis of the root rot pathogens. Soil samples from each of 46 fields were dug up in late June of 2020 during the root rot survey and will be assessed for Aphanomyces euteiches using PCR assays (Gangneux et al. Citation2014).
Foliar diseases were assessed from mid- to late July when most plants were at the intermediate to round pod stage. A minimum of 30 plants (10 plants from each of three sites) was assessed in each of the 46 fields. Foliar diseases were identified based on their symptoms. The severity of mycosphaerella blight, sclerotinia stem rot and anthracnose was estimated using a scale of 0 (no disease) to 9 (whole plant severely diseased). Powdery mildew, downy mildew, rust and bacterial blight were rated as the percentage of foliar area diseased.
RESULTS AND COMMENTS: In early May, completing harvest of the 2019 crops remained a priority, with a piecemeal approach to seeding in all regions based on fields being dry enough to support equipment. In many areas, soils remained wet to saturated inhibiting movement of farm machinery and restricting seeding operations. Field peas were one of the first crops to be seeded across all regions in Manitoba (MARD Citation2020b) with seeding completed in the central and northwest regions and 90% complete in the southwest region by late May (MARD Citation2020c). By the week of August 18th, some pea crops were harvested in areas of lighter soil zones (MARD Citation2020d). Ninety-nine percent of harvest was completed by September 8th with yields ranging from 60 to 90 bu/ac with good to excellent quality (MARD Citation2020e).
Two diseases were identified based on laboratory assessment of the roots collected from 46 pea crops (). Fusarium root rot was the most prevalent as in previous years (McLaren et al. 2020, 2019) with a number of Fusarium spp. including F. acuminatum, F. avenaceum, F. solani and F. redolens isolated from symptomatic root tissue in 2020. Of all crops surveyed, root rot severity ratings ranged from 1.2 to 7.2 with a mean of 3.7. Rhizoctonia root rot (Rhizoctonia solani) was not detected in any of the crops sampled. Nineteen (41%) pea crops had average root rot severity ratings > 4 (i.e., symptoms were present on 50% of the root system) and this would have had a detrimental effect on crop yield. Fusarium oxysporum, an efficient root colonizer known to cause wilt of pea, was detected in 10 of the 46 crops sampled for fungal isolation and identification. Assessment of frozen samples for root pathogens using PCR is planned for the near future.
Table 1. Prevalence and severity of root diseases in 46 crops of field pea in Manitoba in 2020
Aphanomyces euteiches was detected in root samples collected from 77% (23/30), 47% (14/30) and 56% (25/40) of pea fields in 2016, 2017 and 2018, respectively (Gangneux et al. Citation2014). Aphanomyces root rot is favoured by wet, poorly drained soils and is most severe under flooded soil conditions. Seasonal precipitation in many of the pea growing regions of Manitoba in 2016 was above normal, which would have contributed to the increased incidence of aphanomyces root rot. Drier conditions prevailed in 2017 and 2018. In 2019, A. euteiches was confirmed in 83% (35/42) of pea fields. Assessment of the 2020 samples for A. euteiches is ongoing and results are pending at this time.
Three foliar diseases were observed (). Mycosphaerella blight (Mycosphaerella pinodes was the most prevalent, as in previous years (McLaren et al. 2019, 2020), and was present in all the crops surveyed. Disease severity ranged from 1.6 to 6.6 with a mean of 3.4. Downy mildew (Peronospora viciae) was detected in 57% (8/14) of the crops surveyed and the percentage of leaf area infected ranged from <0.1% to 3%. Bacterial blight (Pseudomonas syringae pv. pisi) was observed in 71% of the crops (10/14) surveyed with the percentage of foliar area infected ranging from <0.1% to 6%. White mould (Sclerotinia sclerotiorum) was confirmed in 14% (2/14) of the crops in the survey with disease severities of 1 and 4 in the two infested crops. Powdery mildew (Erysiphe pisi) was not observed in any of the surveyed crops. All newly registered pea cultivars are required to have resistance to powdery mildew, so the absence of this disease could be mainly attributed to the use of new cultivars by growers or that the early seeded crops escaped infection. Symptoms of rust (Uromyces spp.) and anthracnose (Colletotrichum pisi) were not observed in any of the crops surveyed in 2020.
Table 2. Prevalence and severity of foliar diseases in 14 crops of field pea in Manitoba in 2020.
REFERENCES
- Gangneux C, Cannesan M-A, Bressan M, Castel L, Moussart A, Vicré-Gibouin M, Driouich A, Trinsoutrot-Gattin I, Laval K. 2014. A sensitive assay for rapid detection and quantification of Aphanomyces euteiches in soil. Phytopathology 104(10):1138–1147. doi:https://doi.org/10.1094/PHYTO-09-13-0265-R
- Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Ames (IA): Blackwell.
- Manitoba Agriculture and Resource Development (MARD). 2020a October 20. Crop Report Summary. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- MARD. 2020b May 5. Crop Report #1. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- MARD. 2020c May 26. Crop Report #4. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- MARD. 2020d August 18. Crop Report #16. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- MARD. 2020e September 8. Crop Report #19. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- Manitoba Agriculture. 2017 October 16. Crop Report #25. www.gov.mb.ca/agriculture/crops/seasonal-reports/crop-report-archive/index.html [accessed 2021 Jan 27]
- Manitoba Agriculture and Agrifood Statistics. 2017. Farm – Crop – Livestock – Food. www.gov.mb.ca/agriculture/markets-and-statistics/pubs/mb-agriculture-statistics-factsheet-2019.pdf [accessed 2021 Mar 19]
- Manitoba Agricultural Services Corporation (MASC). 2018. Seeded Acreage Report (2018). www.masc.mb.ca/masc.nsf/mmpp_index.html [accessed 2021 Jan 27]
- MASC. 2019. Seeded Acreage Report (2019). www.masc.mb.ca/masc.nsf/mmpp_index.html [accessed 2021 Jan 27]
- Manitoba Pulse and Soybean Growers. 2015. Pulses and Soybeans in Manitoba. https://www.manitobapulse.ca/pulses-in-manitoba/ [accessed 2021 Jan 27]
- McLaren DL, Kim YM, Henderson TL, Vachon NJ, Kerley TJ, Hwang SF, Chang KF, Chatterton S, Tkachuk C, Klippenstein S, et al. 2020. Field pea diseases in Manitoba in 2019. Can Plant Dis Surv. 100: 155–157. In, Can J Plant Pathol. 42:sup1.
- McLaren DL, Kim YM, Henderson TL, Thompson MJ, Chang KF, Chatterton S, Kerley TJ, Stevenson L, Tkachuk C, Brown-Livingston K. 2019. Field pea diseases in Manitoba in 2018. Can Plant Dis Surv. 99:172–174. In, Can J Plant Pathol. 41:sup1.
- Xue AG. 2000. Effect of seed-borne Mycosphaerella pinodes and seed treatments on emergence, foot rot severity, and yield of field pea. Can J Plant Pathol. 22(3):248–253. doi:https://doi.org/10.1080/07060660009500471
VEGETABLES/LÉGUMES
A SURVEY OF ONION AND GARLIC DISEASES IN ALBERTA IN 2019 AND 2020
CROP: Onion, garlic
LOCATION: Alberta
NAMES AND AGENCIES:
M.W. HARDING1, T. FORGE2, J. FENG3, G.C. DANIELS1, R. NEESER-CARAZO1, Q. ZHOU3, P. MUNRO2 & R.C.J. SPENCER4
1Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticulture Station Road E., Brooks, AB T1R 1E6Telephone: (403) 362-1338; Facsimile: (403) 362-1326; E-mail: [email protected]
2Agriculture and Agri-Food Canada, Agassiz Research and Development Centre, 6947 Highway 7, Agassiz, BC V0M 1A0
3Alberta Agriculture and Forestry, Crop Diversification Centre North, 17507 Fort Road NW, Edmonton, AB T5Y 6H3
4Spencer Horticultural Solutions, 6008 50A Ave, Stettler, AB T0C 2L2
ABSTRACT: A survey of eight onion and 23 garlic crops was performed at 21 locations in 2019-2020. Plant and soil samples revealed the prevalence of diseases caused by 12 fungi and protists (Alternaria alternata, A. embellesia, Botrytis porri, Cladosporium sp., Fusarium avenaceum, F. acuminatum, F. equiseti, F. proliferatum; F. solani, F. oxysporum, Pythium ultimum, Rhizoctonia solani), one bacterium (Pseudomonas syringae), the aster yellows phytoplasma and various nematodes. Fusarium spp. and the aster yellows phytoplasma were the most commonly isolated pathogens. Paratylenchus nematodes were the most prevalent in garlic and Pratylenchus were the most prevalent in onion. The stem and bulb nematode, Ditylenchus dipsaci, was confirmed in Alberta for the first time in 2020. It was found on garlic at three locations in southern Alberta.
INTRODUCTION AND METHODS: Alberta onion and garlic production is comprised of mostly small, <1 ha, market gardens that supply local fresh market consumption. A few larger commercial production/packaging operations also exist under irrigation in southern Alberta. Production of onion and garlic represents significant income to producers, regardless of the size of the operation. Diseases such as aster yellows (Candidatus Phytoplasma asteris Lee, Gundersen-Rindal, Davis, Bottner, Marcone & Seemüller), fusarium basal plate rot (Fusarium oxysporum Schlechtendal, F. avenaceum (Corda) Saccardo), white rot (Sclerotium cepivorum Berk.), skin blotch (Alternaria alternata (Fries) Keissler, and A. embellesia Woudenb. & Crous), neck rot (Botrytis porri (van Beyma) Whetzel), and Rhizoctonia solani (Kühn) rot have been observed on onion and garlic in Alberta plantings in previous years (Harding et al. Citation2014, Citation2015, Citation2016).
Fields were visited between June 13 and August 14 (2019), and between July 24 and August 11 (2020). Plants with visible above ground symptoms of wilting, yellowing, stunting, curling/twisting, etc. were collected, where possible. Six to 10 symptomatic whole plants were collected, along with a composite soil sample consisting of a mixture of 10 to 20 soil cores near the crowns of collected plants. Soil cores were ~150 mm deep. Plants from each location were split into two subsamples. All soil samples, and one plant subsample, were used for extraction and identification of plant pathogenic nematodes. The second plant subsample was used for isolation and/or identification of fungal, bacterial and phytoplasma pathogens.
DNA was extracted from symptomatic leaf and bulb tissues using a DNeasy Plant Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions. PCR amplification was conducted using specific primer sets for phytoplasma (P1/Tint, Smart et al. 1996) and P. syringae (Cyoll-Fs/Rs, Xu and Tambong Citation2011). For fungal culture isolation, pieces of symptomatic plant tissues were surface sterilized in 1% NaOCl for 30 s, followed by a tap water rinse and blotting dry with sterilized paper towel, then plated on potato dextrose agar and water agar, and incubated for 1 wk at room temperature. For bacterial culture isolation, symptomatic plant tissues were soaked in sterile water for 1 h. The resulting suspension was streaked on LB plates and incubated in an incubator at 37°C. The identification of fungi and bacteria was based on DNA barcoding. Fungal mycelia growing on agar plates were harvested for extracting DNA using the DNeasy Plant Mini kit (Qiagen), and the genomic DNA was used as a template in PCR reactions with EF1 and or ITS primers (Stielow et al. 2015; White et al. 1990). Purified bacterial culture was applied as a template in a direct PCR amplification with cpn60 primers (H729/H730, Hill et al. Citation2006). The PCR amplicons were sequenced at the University of Alberta.
Nematodes were extracted from a 100 cm3 subsample of soil from each field using the centrifugal-floatation technique (Forge and Kimpinski Citation2007). After collecting the nematodes over a 25 μm sieve, nematode samples were transferred in water into glass scintillation vials and stored at 4°C prior to counting. Plant-parasitic nematodes in each sample were identified to genus level and counted in a gridded counting dish on an inverted microscope.
Nematodes were extracted from a subsample of onion and garlic tissues collected from each field using the Baermann pan technique (Forge and Kimpinski Citation2007). A 10-cm segment of stem was cut from directly above each of three bulbs from each sampling location to form a composite sub-sample. The segments were washed free of adhering soil and finely chopped into 1-cm pieces which were placed on a Baermann funnel for extraction. After a 7-day incubation, nematodes were collected over a 25 μm sieve and transferred in water into glass scintillation vials and stored at 4°C prior to counting as described for soil nematode extracts.
For each of two soil samples and two plant samples where Ditylenchus spp. were found at high population densities and were morphologically consistent with D. dipsaci, five individual nematodes were hand-picked from the sample and subjected to PCR-sequencing of the D3 expansion region of the 26S ribosomal RNA gene using D3A and D3B primers (Al-Banna et al. Citation1997). DNA was extracted using the method described by Kumari and Subbotin (Citation2012). Briefly, individual nematodes were placed in a 0.5-ml sterile centrifuge tube containing 10x PCR buffer (New England Biolabs, MA, USA), 2 μl of Proteinase K (600 ug ml−1), and 6 μl of sterile double-distilled molecular grade water. Tubes were kept at −20°C for at least 30 min, then incubated at 65°C for 1 h followed by 95°C for 15 min. The DNA suspension was stored at −20oC until PCR.
PCR reactions contained 2 μl of nematode lysate solution in a final volume of 25 μl. The PCR mixture included 11 μl sterile distilled DNase free molecular grade water, 10 μl HotMasterMix (2.5x) (5 PRIME), and 1.0 μl of each 10 μM primer. Optimised thermal conditions for PCR amplification after an initial denaturation step (94°C for 2 min) were as follows: 35 cycles at 94°C for 45 s, 65°C for 90 s; final extension step at 65°C for 10 min. PCR products, 5 μl, were analysed on 1% agarose gels with 1×GelRed in 1×TBE.
Of the five Ditylenchus nematodes from each sample that were amplified, three amplicons from each were directly sequenced in both directions using the ABI BigDye Terminator v3.1 kit in an ABI DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Forward and reverse DNA sequence data were assembled using BioEdit 7.0. Assembled sequences for each isolate were aligned with GenBank accessions using the ClustalW algorithm to verify that expected amplicons were obtained.
RESULTS AND COMMENTS: Fusarium spp., Candidatus Phytoplasma asteris and Alternaria embellesia (syn. Embellesia allii) continue to be the most commonly occurring disease agents on onion and garlic in Alberta (; Harding et al. Citation2014, Citation2015, Citation2016). Fusarium spp. were present in 69% of fields in both 2019 and 2020. Fusarium diseases are not new to onion and garlic producers in Alberta and management of basal plate rot has been ongoing for many years. Aster yellows and embellesia skin blotch took many new producers by surprise in 2013 and 2014. For example, in 2013, the prevalence of embellesia skin blotch was 100% versus 37% in 2014 (Harding et al. Citation2014, Citation2015). The aster yellows pathogen was also 100% prevalent in 2013 (Harding et al. Citation2014), but dropped to under 20% in 2014 (Harding et al. Citation2015). Its occurrence fluctuates considerably, as it was present in 81% of fields in 2019, but only 54% in 2020. Anecdotal information suggests that aster yellows levels increase when phytoplasma infections are carried over in scapes or bulbs used for propagation in a subsequent season (M. Harding unpublished). Alternaria embellesia is commonly found each year, but not at the high levels seen in 2013. It was found in 31% of fields in 2019 and 23% in 2020. Rhizoctonia solani was the only fungal pathogen that increased in 2020, going from 6% in 2019 to 23% in 2020.
Table 1. Prevalence of nine pathogens and four other microbes isolated or detected on onion/garlic from 12 locations in Alberta in 2019
Table 2. Prevalence of 14 pathogens and 11 other microbes isolated or detected on onion/garlic from nine locations in Alberta in 2020
Of the five groups of root-parasitic nematodes that were found, root-lesion nematodes (Pratylenchus spp.) were the most widespread, present in approximately 50% of all samples analyzed (). The overall average population density was 16 Pratylenchus/100 cm3 soil, and the average population density for positive sites was 25 Pratylenchus/100 cm3. These values for frequency of occurrence and population densities are considerably greater than those recovered in an earlier survey of a wide range of other horticultural crops in Alberta (Forge et al. 2019). Globally, the species of Pratylenchus most widely reported and studied as a parasite of onion and garlic is P. penetrans (Pang et al. 2009; Potter and Olthoff 1993). As these analyzes were conducted at the genus level of resolution, the presence of P. penetrans in Alberta onion and garlic production remains unknown. Earlier research demonstrated the presence of P. neglectus in Alberta potato fields (Forge et al. Citation2015), and we hypothesize that P. neglectus is the dominant species in onion and garlic fields as well. In contrast to P. penetrans, little is known of the pathogenicity or damage potential of P. neglectus to onion or garlic. As production of vegetable crops in Alberta is growing, future research should be directed at clarifying the species of Pratylenchus found in vegetable production fields, and assessing the potential impacts of P. neglectus, particularly on onion and garlic.
Table 3. Percentage of positive samples and maximum and mean population densities (nematodes/100 cm3 soil), for six genera of plant-parasitic nematodes found in the survey of onion and garlic fields. Data from 2019 and 2020 are pooled
Other groups of root-parasitic nematodes found in the samples included dagger (Xiphinema spp.), pin (Paratylenchus spp.), spiral (Helicotylenchus spp.) and stunt (Belonolaimidae, Tylencholaiminae) nematodes. All of these groups of nematodes are ectoparasites and none have been associated with economically important damage to onion or garlic.
Nematodes in the genus Ditylenchus were found in 56 and 25% of garlic and onion soil samples, respectively, and in 38% of garlic and 25% of onion tissue samples analyzed (). It was not possible to distinguish the stem and bulb nematode, D. dipsaci, from other species of Ditylenchus, such as the ubiquitous saprophytic-mycophagous species D. myceliophagous, in the initial counts. However, two soil and three tissue samples from the garlic fields had very large population densities (e.g., >100 specimens per sample), with many robust juveniles that were morphologically consistent with the characteristic fourth juvenile stage of D. dipsaci that is adapted for survival and dissemination. PCR-sequencing analyses of three specimens from both soil and plant tissue from each of two sites confirmed the presence of D. dipsaci at those sites (NCBI Genbank accession numbers: MT603145, MT603146, MT603147, MW266996, MW266997, MW266998, MW266999, MW267000, MW267001, MW267002, MW267003, MW267004). It is of interest to note that one site had confirmed D. dipsaci in soil but not plant tissue in 2019, and in plant tissue but not soil in 2020.
This is the first confirmed report of Ditylenchus dipsaci affecting garlic in Alberta. The species has become a significant pest of garlic and, to a lesser extent, onion in Ontario and Quebec in the past decade (Poirier et al. Citation2019), and it was recently reported from garlic in Manitoba (Hajihassani and Tenuta Citation2015). There is considerable intraspecific variation within D. dipsaci, with up to 30 host races described (Janssen Citation1994). Onion and garlic are both attacked primarily by the same race. The alfalfa race of D. dipsaci was reported from irrigated alfalfa fields in Alberta and British Columbia nearly four and five decades ago, respectively (Hawn 1973; Vrain and Lalik 1983). While the alfalfa race appears to be among the most specific and well-defined races of D. dipsaci (Janssen Citation1994), isolates from alfalfa have been observed to be pathogenic to onion (Griffin Citation1975; Janssen Citation1994). It is not unusual for alfalfa to be grown in rotation with vegetable crops such as onion and garlic in irrigated valleys of Alberta and British Columbia. The lack of morphological distinction between races of D. dipsaci and reports of crossover pathogenicity between the alfalfa race and the onion and garlic race will complicate monitoring and management of D. dipsaci in onion and garlic fields in the region. Additional research to compare the host ranges of regional isolates from alfalfa to those from onion or garlic would shed light on the origin of D. dipsaci now appearing in onion and garlic fields in the region, and provide a firm basis for recommending crop rotations for management.
ACKNOWLEDGEMENTS: We gratefully express our appreciation for the landowners and producers that allowed access to their fields.
REFERENCES
- Al-Banna L, Williamson V, Gardner SL. 1997. Phylogenetic analysis of nematodes of the genus Pratylenchus using nuclear 26S rDNA. Mol Phylogenet Evol. 7(1):94–102. doi:https://doi.org/10.1006/mpev.1996.0381
- Forge TA, Kimpinski J. 2007. Nematodes. In: Gregorich EG, Carter MR, editors. Soil sampling and methods of analysis, 2nd ed. Boca Raton (FL): CRC Press; p. 415–425.
- Forge T, Broatch J, Harding MW, Reid P, Daniels GC, Reid L, Chan A, Cutts M. 2019. Survey of plant-parasitic nematodes in horticultural crops in Alberta, 2014 and 2015. Can Plant Dis Surv. 99:13–16. In, Can J Plant Pathol. 41:sup1.
- Forge TA, Larney FJ, Kawchuk LM, Pearson DC, Koch C, Blackshaw RE. 2015. Crop rotation effects on Pratylenchus neglectus populations in the root zone of irrigated potatoes in southern Alberta. Can J Plant Pathol. 37(3):363–368. doi:https://doi.org/10.1080/07060661.2015.1066864
- Griffin GD. 1975. Parasitism of nonhost cultivars by Ditylenchus dipsaci. J Nematol. 7(3):236–238.
- Hahn EJ. 1973. Plant parasitic nematodes in irrigated soils of Alberta. Can Plant Dis Surv. 53:29–30.
- Hajihassani A, Tenuta M. 2015. The occurrence of stem and bulb nematode on garlic in southern Manitoba, Canada in 2015. Can Plant Dis Surv. 97:229–232.
- Harding MW, Spencer RCJ, Lange RM, Yang J, Howard RJ. 2014. Diseases of garlic in Alberta in 2013. Can Plant Dis Surv. 94:214–216.
- Harding MW, Spencer RCJ, Lange RM, Yang J, Broatch J, Lisowski SLI, Howard RJ. 2015. Diseases of onion and garlic in Alberta in 2014. Can Plant Dis Surv. 95:188–190.
- Harding MW, Daniels GC, Spencer RCJ, Morton D, Feng J, Broatch J, Lisowski SLI, Howard RJ. 2016. Diseases of garlic and onion in Alberta in 2015. Can Plant Dis Surv. 96:203–206.
- Hill JE, Paccagnella A, Law K, Melito PL, Woodward DL, Price L, Leung AH, Ng L-K, Hemmingsen SM, Goh SH. 2006. Identification of Campylobacter spp. and discrimination from Helicobacter and Arcobacter spp. by direct sequencing of PCR-amplified cpn60 sequences and comparison to cpnDB, a chaperonin reference sequence database. J Med Microbiol. 55(4):393–399. doi:https://doi.org/10.1099/jmm.0.46282-0
- Janssen GJW. 1994. The relevance of races in Ditylenchus dipsaci (Kühn) Filipjev, the stem nematode. Fundam Appl Nematol. 17:469–473.
- Kumari S, Subbotin SA. 2012. Molecular characterization and diagnostics of stubby root and virus vector nematodes of the family Trichodoridae (Nematoda: Triplonchida) using ribosomal RNA genes. Plant Pathol. 61(6):1031–2021. doi:https://doi.org/10.1111/j.1365-3059.2012.02598.x
- Potter JW, Olthof THA. 1993. Nematode pests of vegetable crops. In: Evans K, Trudgill DL, Webster JM, editors. Plant parasitic nematodes in temperate agriculture. Wallingford (UK): CAB International; p. 171–207.
- Poirier S, Dauphinais N, Van Der Heyden H, Véronneau P-Y, Bélair G, Gravel V, Mimee B 2019. Host range and genetic characterization of Ditylenchus dipsaci populations from Eastern Canada. Plant Dis. 103(3):456–460. 2019. doi:https://doi.org/10.1094/PDIS-07-18-1201-RE
- Smart CD, Schneider B, Blomquist CL, Guerra LJ, Harrison NA, Ahrens U, Lorenz KH, Seemüller E, Kirkpatrick BC 1996. Phytoplasma-specific PCR primers based on sequences of the 16S–23S rRNA spacer region. Appl Environ Microbiol. 62(8):2988–2993.
- Stielow JB, Lévesque CA, Seifert KA, Meyer W, Iriny L, Smits D, Renfurm R, Verkley GJ, Groenewald M, Chaduli D, et al. 2015. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes. Persoonia 35(1):242–263. doi:https://doi.org/10.3767/003158515X689135
- Vrain TC. 1983. Distribution and pathogenicity of the alfalfa stem nematode, Ditylenchus dipsaci, in British Columbia. Plant Dis. 67(3):300–302. doi:https://doi.org/10.1094/PD-67-300
- White TJ, Bruns TD, Lee SB, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols: a guide to methods and applications. New York (NY): Academic Press; p. 315–322.
- Xu R, Tambong JT. 2011. A TaqMan real-time PCR assay targeting the cytochrome o ubiquinol oxidase subunit II gene for detection of several pathovars of Pseudomonas syringae. Can J Plant Pathol. 33(3):318–331. doi:https://doi.org/10.1080/07060661.2011.600335.
A SURVEY OF HELICOTYLENCHUS, PARATYLENCHUS, PRATYLENCHUS AND TYLENCHORHYNCHUS NEMATODES IN POTATO FIELDS IN ALBERTA, 2018 AND 2019
CROP: Potato
LOCATION: Alberta
NAMES AND AGENCIES:
C.J. ROBERTSON1, D.P. YEVTUSHENKO2, E. SNOWDON3 & M.W. HARDING4
1Cavendish Farms, 4620 43rd Street N., Lethbridge, AB T1H 6P3
2University of Lethbridge, Department of Biological Sciences, 4401 University Dr. W., Lethbridge, AB T1K 3M4
3Quattro Farms, 111043 Crowsnest Hwy, Bow Island, AB T0K 0G0
4Alberta Agriculture and Forestry, Crop Diversification Centre South, 301 Horticulture Station Road E., Brooks, AB T1R 1E6Telephone: (403) 362-1338; Facsimile: (403) 362-1326; E-mail: [email protected]
ABSTRACT: The prevalence of Helicotylenchus, Paratylenchus, Pratylenchus and Tylenchorhynchus genera of nematodes is not well understood across the prairie provinces of Canada. These nematodes can cause economic damage by feeding on the host crop directly or serve as vectors of plant diseases. While conducting a larger project, nematode populations were quantified in the soil of three commercial potato fields planted with cultivar ‘Russet Burbank’; one in 2018 and two in 2019. The nematodes were extracted from soil samples, identified morphologically, and then quantified as numbers per kg of fresh soil. All four genera were detected in all fields, but the population sizes varied between fields and across time within fields.
INTRODUCTION AND METHODS: Plant-pathogenic nematodes are of economic concern in potato crops in many growing regions. Helicotylenchus, Paratylenchus, Pratylenchus and Tylenchorhynchus nematodes have all been identified as pathogens presently affecting potato production in Turkey (Akyazi et al. Citation2012). The same genera have also been identified to be an issue in potato production in the state of Maine (Huettel et al. Citation1991). All four genera have been identified in agricultural fields of North Dakota, with a positive correlation between soil temperature, soil pH, and different genera (Chowdhury et al. 2019). Prevalence of soil-borne nematodes across the Canadian prairie provinces is not well understood. There has been one nematological survey in recent years in Alberta (Forge et al. 2019). In conjunction with a project focusing on the control of soil-borne pathogens of potatoes, the aforementioned genera of nematodes were quantified spatially and temporally from soil samples collected at three different times of each year, in each of three potato fields. The resulting knowledge adds to our understanding of the dynamics of nematode populations in Alberta potato fields.
Commercial potato production fields predicted to have early dying disease based on field history were selected in consultation with cooperating growers and local agronomists. Each field was in the Municipal District of Taber (). The potato early dying complex, commonly caused by the root lesion nematode, Pratylenchus penetrans, in conjunction with the vascular wilt pathogen, Verticillium dahliae, was the focus of the investigation. To characterize the presence of Pratylenchus spp. in the three potato fields, soil samples were collected at three time points: 1) October, prior to the potato crop, 2) May, shortly after planting, and 3) September, prior to commercial harvest of the potato crop. The potato fields were part of a larger project involving soil fungicides and fumigants. Here we report results from soil samples taken from non-treated areas of the fields. The number of non-treated strips varied from field to field, and the location of soil sampling varied with sample collection timing. For example, the soil sample collected prior to the potato crop was a composite sample of forty soil cores collected from across the whole field in a repeating W-pattern. The second and third soil samples, which were collected in May and September, respectively, were only taken from non-treated control strips in the field. The second and third soil samples were composite samples of twenty soil cores collected in a repeating W-pattern. All soil was sampled to a depth of 30 cm with a Dutch auger. At each soil sampling time point, samples were bagged and placed into chilled storage (~ 4°C) until shipment in an insulated cooler with a frozen pack to the University of Guelph Agriculture and Food Laboratory for analysis.
At the University of Guelph, the Baermann pan method was used to extract nematodes from 50 g of fresh, undried soil per sample (Townshend Citation1963; Forge and Kimpinksi Citation2007). Soil was placed on 3-ply paper tissue, which was placed on a non-metallic mesh screen and subsequently placed in a pan filled with water. The pan held enough water to saturate the soil without fully immersing it. Pans were stacked for efficient use of space, then covered by plastic to limit evaporation. Incubation proceeded at room temperature for 3 to 14 days with water added to the edges of the screens to maintain a consistent water level (Barker Citation1985). Screens were removed from pans and were rinsed into the respective pan. Contents of pans were collected into large test tubes and left undisturbed for 1 h minimum to allow nematodes to settle to the bottom. Supernatant was siphoned off to leave between 5 and 10 mL remaining. The remaining contents were placed in a counting dish. Visual identification was conducted via a stereoscope at 10 to 70x magnification after the extracted nematodes settled in the dish for a few minutes. Nematode identification was performed to the genus level using a dichotomous key and counts expressed per kilogram of fresh soil (Tarjan et al. Citation1977).
RESULTS AND COMMENTS: Helicotylenchus, Paratylenchus, Pratylenchus and Tylenchorhynchus nematodes were found in all three potato fields (). Field 1 showed an increase in numbers of all genera over time. An increase in the population level of one genus (Helicotylenchus) and a decrease of others (Paratylenchus, Pratylenchus and Tylenchorhynchus) was observed in Field 2 across time. Field 3 exhibited variable levels of all genera across time. Helicotylenchus and Paratylenchus populations increased then decreased, while populations of Tylenchorhynchus increased and populations of Pratylenchus decreased.
Table 1. Nematode counts (nematodes per kilogram of soil) for four genera from three field locations. The October sample shows results from a single composite sample of 40 soil cores. The May and September samples represent the mean of three composite samples of ≥20 soil cores each
In comparison, results from a previous nematode survey (Forge et al. 2019) also established the presence of the four genera of focus here, in addition to others. However, Forge et al. (2019) observed that the Paratylenchus genus was in greatest abundance, which was not the case in the potato fields reported herein. One possible explanation for this difference is that Forge et al. (2019) sampled at a single time point from non-potato crops, such as berries, vegetables and apples, while our study had multiple time points and a singular focus on potatoes. Changes in counts across time show that seasonal variation may affect the quantity of nematodes captured in any given soil sample. This is likely correlated with the life cycle of the nematode. In addition to shifts in nematode populations throughout the growing season, the results also demonstrate the field-to-field variability with respect to nematode presence and abundance.
ACKNOWLEDGEMENTS: The authors acknowledge support from the Potato Growers of Alberta, Cavendish Farms, Lamb Weston, McCain Foods Canada, and the University of Lethbridge in funding the sample collection and quantification. The authors acknowledge the diagnostic lab lead by Dr. Shannon Shan at the University of Guelph for identifying and quantifying the nematodes. The authors express appreciation to the producers for allowing access to their fields.
REFERENCES
- Akyazi F, Yildiz S, Dede O, Felek AF. 2012. Biodiversity of nematodes in potato growing areas of Ordu, Turkey. J Anim Vet Adv. 11(15):2660–2664. doi:https://doi.org/10.3923/javaa.2012.2660.2664.
- Barker KR. 1985. Nematode extraction and bioassay. In: Barker KR, Carter CC, Sasser JN, editors. An advanced treatise on Meloidogyne (Vol. II: Methodology). Raleigh: USAID, North Carolina State University Graphics; p. 19–35.
- Chowdhury IA, Yan GP, Friskop A. 2019. Occurrence of vermiform plant-parasitic nematodes in North Dakota corn fields and impact of environmental and soil factors. Can J Plant Pathol. 42(3):429–444. doi:https://doi.org/10.1080/07060661.2019.1674384.
- Forge T, Broatch J, Harding MW, Reid P, Daniels GC, Reid L, Chan A, Cutts M. 2019. Survey of plant-parasitic nematodes in horticultural crops in Alberta, 2014 and 2015. Can J Plant Pathol. 41:13–16.
- Forge TA, Kimpinksi J. 2007. Nematodes. In: Gregorich EG, Carter MR, editors. Soil sampling and methods of analysis. Boca Raton (FL): CRC Press; p. 415–425.
- Huettel RN, Francl LJ, Reise RW, Meyer SLF, Herrn RA. 1991. Plant-parasitic nematodes in the potato growing areas of Maine. Am Potato J. 68(6):345–354. doi:https://doi.org/10.1007/BF02853615.
- Tarjan AC, Esser RP, Chang SL. 1977. An illustrated key to nematodes found in fresh water. J Water Pollut Control Fed. 49:2318–2337.
- Townshend J. 1963. A modification and evaluation of the apparatus for the oostenbrink direct cottonwool filter extraction method. Nematologica 9(1):106–110. doi:https://doi.org/10.1163/187529263X00205.
Fig. 1 Approximate locations of Alberta potato nematode field survey in 2018 and 2019
INCIDENCE OF VERTICILLIUM WILT (V. DAHLIAE) ON POTATO IN MANITOBA, 2020 CROP
CROP: Potato
LOCATION: Manitoba
NAMES AND AGENCY:
V. BISHT1, M. TENUTA2 & S. GRAHAM3
1Manitoba Agriculture & Resource Development, 65 – 3rd Avenue NE, Carman, MB R0G 0J0Telephone: (204) 745-0260; Facsimile: (204) 745-5690; E-mail: [email protected]
2 Department of Soil Science, University of Manitoba, 13 Freedman Crescent, Winnipeg, MB R3T 2N2
3J.R. Simplot Co., Highway #1 and Simplot Road, Portage la Prairie, MB R1N 3A4
ABSTRACT: The occurrence of potato early dying in relation to verticillium wilt (Verticillium dahliae) was assessed in 12 potato fields by selecting plants and rating the disease in the cross-section of stems one inch from the soil line. There was wide variability in the incidence of verticillium wilt in the Manitoba fields, ranging from 14 to 92% incidence and 2.8 to 43.8 on the Verticillium Severity Index. Generally, the fields with high V. dahliae counts in soil also had a high number of verticillium-affected plants.
INTRODUCTION AND METHODS: Twelve potato fields were selected for the survey in western, central and south-eastern potato growing areas of Manitoba, based on field history and growers’ understanding of the high or low incidence of disease in their fields. Of the 12 fields, eight were selected based on fall soil Verticillium dahliae propagule counts before the 2020 potato crop; four fields were selected with high counts and four with low counts. Plants were randomly selected for rating at ten locations within a field, based on soil EC profile or topography. Ten to 20 plants were assessed for verticillium discoloration/browning in a cross-section of the main stem cut at 1” above ground level. A 0-5 rating scale was used for disease severity assessment, where 0 = no discoloration in cross-section or no disease, 1 = trace to ≤ 9% discoloration, 2 = 10 to 24%, 3 = 25 to 49%, 4 = 50 to 74% and 5 ≥ 75% discoloration, dark brown and plant is dead (, Alkher et al. Citation2009).
A 100 g subsample of each soil sample was air-dried for seven days at room temperature and 5 g were suspended in 100 mL sterilized 1% agar-water and agitated for 2 min on an orbital shaker at 60 rpm. One milliliter of the suspension was spread onto plates of Sorensen’s NP-10 medium (Sorensen et al. Citation1991) containing chloramphenicol, streptomycin sulphate and chlortetracycline HCl. Each soil sample was plated ten times. Plates were incubated for 15 days in the dark at 22°C. They were then rinsed with tap water to remove soil particles from the medium surface. The number of germinated V. dahliae microsclerotia was counted using a stereomicroscope and expressed as the number of colony-forming units (CFU) per gram of soil.
A Verticillium Severity Index (VSI) was calculated as the sum of the product of % incidence and severity ratings within each category, expressed as a percentage of the maximum, following the formula
VSI = (((n0*0) + (n1*1) + (n2*2) + (n3*3) + (n4*4) + (n5*5))/(N*5)) *100, where n is the number of plants within each rating category 0 to 5, and N is the total number of plants rated.
RESULTS AND COMMENTS: Plants with verticillium wilt were found in all fields surveyed. There was a wide range of disease incidence observed in fields based on the rating of discoloration of the stems’ cross-section. The incidence of wilt in fields ranged from 16% to 90%, while the Verticillium Severity Index (VSI) ranged from a low of 2.8 to a high of 43.8 ().
Table 1. Number of Verticillium propagules (germinating microsclerotia) in soil test, % disease incidence and Verticillium Severity Index in Manitoba potato fields in 2020
Data from fields with high or low verticillium propagule (microsclerotia) counts were analyzed as a group, and verticillium wilt incidence and severity were significantly higher in fields with high propagule counts (). However, there was one field with a high propagule count (H-11-11-Carb3), where the disease was not as high as expected, and one field in the low propagule count group (L-9-10-Mel), where the disease was higher than expected (). Data on the incidence and severity of wilt in the fields were analysed using the EXCEL® statistical package, in a one-tailed Z-test.
Table 2. Mean incidence and severity of verticillium wilt disease in fields with a high or low V. dahliae propagule count (CFU/g) in soil
The survey and analysis of data suggest wide variability in verticillium wilt incidence and severity in Manitoba fields. Soil microsclerotia count is a good indicator of potential verticillium disease level in a field and could be used in disease management options. However, other factors including soil characteristics may confound the verticillium propagule count and disease expression in some fields.
ACKNOWLEDGEMENTS: Field help from various agronomists, working with the farms, is greatly appreciated for this survey.
REFERENCES
- Alkher H, El Hadrami A, Rashid KY, Adam LR, Daayf F. 2009. Cross-pathogenicity of Verticillium dahliae between potato and sunflower. Eur J Plant Pathol. 124(3):505–519. doi:https://doi.org/10.1007/s10658-009-9437-z.
- Sorensen LH, Schneider AT, Davis JR. 1991. Influence of sodium polygalacturonate sources and improved recovery of Verticillium species from soil. (Abstr.). Phytopathology 81:1347.
Fig. 1 Visual grading scale (0-5) of Verticillium wilt severity in potato stems (Alkher et al. Citation2009)
FOREST TREES/ARBRES FORESTIERS
PHYTOPHTHORA ROOT ROT IN WESTERN WHITE PINE SEED ORCHARDS IN BRITISH COLUMBIA
CROP: Western white pine
LOCATION: British Columbia
NAMES AND AGENCIES:
N. FEAU1, B. VAN DER MEER1, W. VAN DER LINDEN1, P. HERATH1, G. BRADLEY2, N. UKRAINETZ2, H. KOPE3 & R. HAMELIN1, 4
1Department of Forest and Conservation Sciences, University of British Columbia, Vancouver, BC V6T 1Z4. Telephone: 604-822-3108; E-mail: [email protected]
2British Columbia Ministry of Forests, Lands and Natural Resource Operations and Rural Development, Vernon, BC V1B 2C7
3British Columbia Ministry of Forests, Lands and Natural Resource Operations and Rural Development, Victoria, BC V8W 9C2
4Faculté de Foresterie et Géomatique, Institut de Biologie Intégrative et des Systèmes (IBIS), Université Laval, Québec, QC G1V 0A6
ABSTRACT: Death of mature and young trees of seed orchard western white pine (Pinus monticola Douglas ex D. Don) has been recognized and investigated as early as 2011 in British Columbia. At four geographically separated seed orchards in BC (coastal and interior), the symptoms on mature (12+ years-old) and young (2- and a 5-year-old) white pine included rapid tree death, red-coloured and bent needles, and roots that are easily stripped of their epidermal and cortical tissues leaving the vascular bundle of the phloem and xylem intact. These symptomatic trees were investigated for disease causing organisms. Three Phytophthora species that are known to cause problems in tree nurseries and Christmas tree plantations were identified: Phytophthora cinnamomi, P. cryptogea and P. cactorum. Koch’s postulates were tested and successfully validated on P. monticola seedlings with P. cryptogea and P. cactorum, indicating that these pathogens could be the cause of the mortality observed in western white pine seed orchards.
INTRODUCTION: British Columbia (BC) is a world leader in breeding trees that are well suited for the current and future ecological conditions. For example, western white pines have been selected for local adaptation to the environment and for tolerance to the white pine blister rust (WPBR) caused by Cronartium ribicola (Hunt Citation2004). Over several years, sudden mortality has been observed in seed orchards of western white pine tolerant to WPBR located on Vancouver Island and in the Okanagan valley of south-central BC. Trees in the early stage of the disease had foliage turning a light green to yellowish colour and needles characteristically bent 90° at the proximal end of needle attachment to the branch (). Needles on dead trees were completely brown and desiccated. The observation of some root rot and necrotic root tips () suggested that the origin of this mortality was not abiotic. Several ‘water mould’ species of the oomycete genera Phytophthora and Pythium have been reported causing similar root rot, foot rot and collar rot mortality in conifer nurseries, usually on saplings less than five years old (Sinclair et al. Citation2006). As the disease symptoms and signs observed in BC western white pine seed orchards were very similar to what has been reported in conifer nurseries infested with phytophthora pathogens, we hypothesized that the same causal agent(s) could be involved.
METHODS: Sampling occurred over two seasons in white pine seed orchards. In October 2017, sampling was done on six trees in a western white pine orchard located at the Saanich seed orchard on Vancouver Island, BC (48.580386N, 123.390734W). In the spring and summer of 2018, sampling was carried out in the same orchard (22 trees, 2-3 and 10-12 years-old (yo)) and in three additional orchards in the Okanagan valley of the south-central interior of BC: Bailey Road seed orchard (50.189809N, 119.345645W; 12 trees, 10-12 yo) and Kalamalka Research Station seed orchard (50.240631N, 119.277484W; 4 trees, 2-3 yo) and Skimikin seed orchard (50.784889N, 119.418361W; 22 trees, 10-12 yo). For each tree, two soil samples containing western white pine roots were collected within one meter of the stem of the affected tree. At the laboratory, soil and roots were flooded with 500 mL of sterile, distilled water in clean plastic trays and baited with rhododendron leaves and a Bartlett pear. Control consisted of the same baits incubated in sterile-distilled water. After four days incubation at room temperature, necrotic lesions were excised and plated on to PARP(H)-CMA selective medium (Ivors Citation2015). A second check for necrotic lesions was done after nine days incubation. Clean cultures were transferred onto 1.5% corn-meal agar media (CMA) prior to DNA-barcoding identification. PCR amplifications and DNA barcoding were carried out on mycelium harvested from the CMA Petri dish with the primer ITS6 (GAAGGTGAAGTCGTAACAAGG) used in combination with ITS4 (TCCTCCGCTTATTGATATGC). PCR products ≥ 700bp were sequenced on both strands at the CHUL Research Center Sequencing and Genotyping Platform in Québec. Sequence chromatographs were inspected for mismatches before being assembled with BioEdit (ver. 7.0.4; http://www.mbio.ncsu.edu/BioEdit/bioedit.html) in one consensus sequence. The sequences were then identified by searching the NCBI nucleotide collection (nt) database for closest homologs using BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Koch’s postulates were completed by inoculating 1-2-year-old seedlings of P. monticola (five seedlings per isolate) with two isolates of each species, P. cryptogea and P. cactorum, with the potting-mix inoculation protocol described in Robin and Desprez-Loustau (Citation1998). To test the susceptibility of other pine species, additional inoculations were performed with the same protocol on 1-2-year-old seedlings of P. albicaulis, P. contorta and P. ponderosa (four to five seedlings per isolate).
RESULTS AND COMMENTS: Results of oomycete isolations and DNA barcoding identifications are presented in . A total of 98 oomycete cultures were obtained, among which three Phytophthora species were found. Of the 66 trees sampled, 37 western white pine trees were associated with at least one Phytophthora or Pythium culture. Phytophthora cinnamomi, P. cryptogea and P. cactorum are soil-borne Phytophthoras present in deciduous forests in Europe (Hansen and Delatour Citation1999; Vettraino et al. Citation2005) and in North American forest soils (Pratt et al. 1976; Leonberger et al. Citation2013). P. cinnamomi is a highly aggressive agricultural, horticultural and forest pathogen infecting roots and stems of 700 different plants and trees (Hardham and Blackman Citation2018). This pathogen is one of the main species that has been associated with Fraser fir root rot in eastern North-America, causing significant limitations to the Christmas tree market (Pettersson et al. Citation2017). So far, this species has been detected on eastern white pine (Pinus strobus) in tree nurseries but has not been reported on western white pine (P. monticola). P. cryptogea and P. cactorum are often found inhabiting forest soils and causing death to tree seedlings in forest nurseries (Pratt et al. 1976; Hamm and Hansen Citation1982; Hansen and Delatour Citation1999; Vettraino et al. Citation2005; Schwingle et al. Citation2007).
Table 1. Phytophthora and Pythium species found in four western white pine seed orchards in British Columbia
Koch’s postulates were completed with P. cryptogea and P. cactorum on western white pine, indicating that both pathogens are likely the origin of the mortality observed in western white pine planted in BC seed orchards. First symptoms (i.e., yellowish and bent down needles) were observed as early as seven weeks post-inoculation (wpi) on two seedlings inoculated with P. cryptogea. P. cactorum induced mortality of a first seedling at 12 wpi. About 80% of the seedlings inoculated with either P. cryptogea or P. cactorum had root rot at the end of the experiment (24 wpi). Additional inoculations on other conifer species indicated a high susceptibility of white-bark pine (Pinus albicaulis Engelm.) to P. cryptogea (mortality observed on 50% of the seedlings at 6 wpi; all seedlings dead at 10 wpi).
Distribution of the Phytophthora species found in this study indicated an absence of connection between seed orchards. P. cryptogea and P. cinnamomi were only found at the Saanich seed orchard and were not detected in the Okanagan Valley orchards (), suggesting that these species were probably not spread from one orchard to another. P. cactorum was found at Saanich seed orchard and Kalamalka Research Station orchards in samples collected under 2-3-year-old trees (). However, intraspecific variability (i.e., single nucleotide polymorphisms) found in the ITS sequence indicate that the P. cactorum cultures isolated in the two orchards were likely unrelated (), suggesting no direct relationship between these two orchards located 500km apart. However, the absence of Phytophthora isolates in one particular orchard needs to be understood with caution. It is generally accepted that failure to detect Phytophthora’s with a baiting approach does not necessarily indicate that they are absent in the sample (Erwin and Ribeiro Citation1996). Phytophthora species can be out-competed by fast-growing species, such as those of the sister genus Pythium. For instance, the absence of Phytophthora in the Bailey Road orchard and in particular at Skimikin may be explained by the presence of Pythium spp. The Skimikin orchard has a long history of problems related to the presence of Pythium spp., explaining the high frequency of detection of Pythium isolates in soil samples from this orchard.
ACKNOWLEDGEMENTS: This work was supported by the Britsh Columbia Forest Genetics Councils with the Government of British Columbia’s Land Base Investment Strategy (LBIS) and Genome Canada’s Large‐Scale Applied Research Program (LSARP project#10106) with additional funding from Genome B.C., Genome Quebec, Canadian Food Inspection Agency, Natural Resources Canada and FP Innovations.
REFERENCES
- Erwin D, Ribeiro O. 1996. Phytophthora diseases worldwide. St. Paul (MN): APS Press.
- Hamm PB, Hansen EM. 1982. Pathogenicity of Phytophthora species to Pacific Northwest conifers. Eur J Forest Pathol. 12(3):167–174. doi:https://doi.org/10.1111/j.1439-0329.1982.tb01390.x.
- Hansen E, Delatour C. 1999. Phytophthora species in oak forests of north-east France. Ann For Sci. 56(7):539–547. doi:https://doi.org/10.1051/forest:19990702.
- Hardham AR, Blackman LM. 2018. Phytophthora cinnamomi. Mol Plant Pathol. 19(2):260–285. doi:https://doi.org/10.1111/mpp.12568.
- Hunt RS. 2004. Blister-rust resistant western white pines for British Columbia, Information Report BC-X–397. Victoria (BC): Natural Resources Canada, Canadian Forest Service.
- Ivors KL. 2015. PROTOCOL 07–03.1: PARP(H)-CMA. In: Ivors KL, editor. Laboratory protocols for Phytophthora species. St. Paul (MN): APS Press.
- Leonberger AJ, Speers C, Ruhl G, Creswell T, Beckerman JL. 2013. A survey of Phytophthora spp. in midwest nurseries, greenhouses, and landscapes. Plant Dis. 97(5):635–640. doi:https://doi.org/10.1094/PDIS-07-12-0689-RE.
- Pettersson M, Frampton J, Rönnberg J, Shew HD, Benson DM, Kohlway WH, Escanferla ME, Cubeta MA. 2017. Increased diversity of Phytophthora species in Fraser fir Christmas tree plantations in the Southern Appalachians. Scand J For Res. 32(5):412–420. doi:https://doi.org/10.1080/02827581.2016.1265144.
- Pratt R. 1976. Identity and pathogenicity of species of Phytophthora causing root rot of douglas-fir in the Pacific Northwest. Phytopathology 66(6):710–714. doi:https://doi.org/10.1094/Phyto-66-710.
- Robin C, Desprez-Loustau M-L. 1998. Testing variability in pathogenicity of Phytophthora cinnamomi. Eur J Plant Pathol. 104(5):465–475. doi:https://doi.org/10.1023/A:1008649806620.
- Schwingle BW, Smith JA, Blanchette RA. 2007. Phytophthora species associated with diseased woody ornamentals in Minnesota nurseries. Plant Dis. 91(1):97–102. doi:https://doi.org/10.1094/PD-91-0097.
- Sinclair W, Lyons H, Johnson W. 2006. Diseases of trees and shrubs, 2nd ed. Ithaca (NY): Cornell University Press.
- Vettraino AM, Morel O, Perlerou C, Robin C, Diamandis S, Vannini A. 2005. Occurrence and distribution of Phytophthora species in European chestnut stands, and their association with ink disease and crown decline. Eur J Plant Pathol. 111(2):169. doi:https://doi.org/10.1007/s10658-004-1882-0.
Fig. 1 Western white pine mortality in BC seed orchards. A, early disease stage; B, bent needle symptom; C, roots and necrotic root tips on a dead tree; D, Agdia ImmunoStrip® test positive for Phytophthora spp. (2 red bands) on a soil sample collected at the Saanich Seed Orchard
Fig. 2 Phytophthora cactorum isolates obtained from western white pine at the Saanich Seed Orchard and Kalamalka Research Station have different origins. The tree is a maximum-likelihood phylogenetic tree including P. cactorum isolates from the Saanich Seed Orchard and Kalamalka Research Station orchard (in red) and reference sequences for closest homologs retrieved in the NCBI database (in black, with Genbank accession number). Numbers above nodes are statistical support values obtained from 100 bootstrap samples; poor statistical support under 50% is not represented. Grey boxes indicate the alignment position of intraspecific polymorphisms in P. cactorum.
FIRST REPORT OF DOTHISTROMA SEPTOSPORUM ON PINUS FLEXILIS IN CANADA
CROP: Limber Pine (Pinus flexilis)
LOCATION: Alberta
NAMES AND AGENCIES:
J. KRAKOWSKI1, R. HEINZELMANN2, T. RAMSFIELD3, A. BENOWICZ4, R. HAMELIN2 & C. MYRHOLM3
1Jodie Krakowski Consulting Services, Box 95035, Whyte P.O., Edmonton, AB T6E 0E5Tel.: (778) 266-0408; E-mail: [email protected]
2Department of Forest and Conservation Sciences, University of British Columbia, 3041-2424 Main Mall, Vancouver, BC V6T 1Z4
3Canadian Forest Service – Northern Forestry Centre, Natural Resources Canada, 5320-122nd Street, Edmonton, AB T6H 3S5
4Alberta Agriculture and Forestry, 7000-113th Street, Edmonton, AB T6H 5T6
ABSTRACT: Field assessments, laboratory assays, and ITS region sequencing confirmed that Pinus flexilis trees growing in a germplasm conservation and provenance-family field test in Smoky Lake, Alberta, were a susceptible host of Dothistroma septosporum (syn. Mycosphaerella pini). This observation was made well outside of the native range of P. flexilis.
INTRODUCTION: While endangered limber pine (Pinus flexilis) is moderately susceptible to the fungal pathogens Dothistroma septosporum in Montana (Taylor and Walla 1999) and D. pini in North Dakota (Barnes et al. 2014), USA, there are no published reports of Dothistroma infection of P. flexilis in Canada. An endemic population of D. septosporum and strains from adjacent British Columbia were recently confirmed in Alberta, primarily associated with translocation of P. contorta var. latifolia test material (Capron et al. 2021). Increasing incidence and severity of forest health agents, including spread into novel susceptible hosts, are significant forest health concerns with implications for both phytosanitary controls and climate change impacts to forest ecosystems (Ramsfield et al. 2016; Sturrock et al. 2011).
Reports from Alberta’s provincial genetic resource management facility starting in 2012 suggested a severe Dothistroma infection was likely impacting the health and possibly the survival of numerous Pinus accessions growing together in provincial clone banks. Treatments with Bordeaux (copper sulphate) mixture were applied to infected installations (Hutchison 2013). We aimed to confirm the identity of the causal agent in order to develop a disease management plan.
METHODS: Surveys of the site were conducted to evaluate single-tree defoliation severity based on percentage of live crown length and healthy foliage (BCMOF Citation2005) in May 2013 and May 2014. In May 2013, foliar samples were collected from the Alberta government genetic archive (pine clone bank) at Smoky Lake, Alberta (). Samples included one P. flexilis genotype and numerous genotypes and ramets of lodgepole pine (P. contorta var. latifolia) and jack pine (P. banksiana) ().
Table 1. Dothistroma samples by species in pine clones and ramets at Smoky Lake, Alberta by observation year
Eight foliar samples were collected from four trees from a separate P. flexilis field test at the same location in July and September 2019. Fungi from conidia on needles were cultured following surface-sterilization on solid malt extract-agar (MEA) medium and in liquid V8 medium to compare morphological characteristics with a reference sample set under a dissecting microscope. The identity of the pathogen was confirmed by comparing ITS sequence data with Dothistroma sequence data in GenBank, including a reference archive of samples from British Columbia and Alberta samples from P. contorta, following Capron et al. (2021).
RESULTS AND DISCUSSION: Over 10% foliage loss was observed in nearly 70% of ramets, across species (). While P. flexilis was the most severely defoliated, this clone bank had only one sampled genotype (), so we could not determine if this level of susceptibility is typical for the species.
Fig. 1 Northern range of P. flexilis (orange) and sample location (blue star) at the genetic archive in the Alberta Tree Improvement and Seed Centre, Smoky Lake. Google Earth imagery, 2021
Fig. 2 Severity of Dothistroma infection by species and year at Smoky Lake, Alberta by observation year
Infection rates in 2014 may have been affected by interactions with other factors. Lophodermella damage interacting with Dothistroma infection could not be ruled out and may have exaggerated the apparent severity of the Dothistroma impact. In 2014, any such needles infected in 2013 likely abscised, and did not contribute to the healthy foliar value that year.
Fungal genomic ITS sequences confirmed D. septosporum on seven of eight sampled P. flexilis samples. Assessment of defoliation in 2013 and 2014 indicated that P. flexilis appears to be highly susceptible to D. septosporum.
The presence and severity of D. septosporum on P. contorta and P. flexilis may reflect enhanced vulnerability due to stress: the sample site is hundreds of kilometers outside their natural geographic range (; Cullingham et al. 2012) and also beyond their ecological niches. This area is within the range and habitat of P. banksiana (Cullingham et al. 2012). Documented relationships between Dothistroma prevalence and changes in environmental conditions (Welsh et al. 2014) or host susceptibility in a region (e.g., conversion to a more susceptible age class) have caused concern that forest management practices may contribute to disease prevalence and impacts (Woods et al. 2010). For example, Lophodermella concolor has infected P. flexilis stands from adjacent, heavily infected P. contorta stands in Alberta (Forest Health and Adaptation 2018; JK, pers. obs.). The introduced pathogen, Cronartium ribicola, is also prevalent throughout the range of the susceptible host P. flexilis; it usually causes fatal infections (Sturrock et al. 2011). The effects of multiple stressors are often synergistic and negative for the host (Cleaver et al. 2015).
In this study, we determined that P. flexilis growing outside of its native range was infected by D. septosporum. Forest health specialists should be aware of this and report any observations of infection by this pathogen observed in the native range of P. flexilis.
ACKNOWLEDGEMENTS: Funding for genome analyses was provided by Genome Canada’s Large Scale Applied Research Project CoAdapTree (241REF).
REFERENCES
- British Columbia Ministry of Forests (BCMOF). 2005. Defoliation free growing damage standard for determinate growth conifers – 2005 03 02. Silviculture Survey Reference, FS 660. Resource Practices Branch, Victoria, BC. https://www2.gov.bc.ca/assets/gov/farming-natural-resources-and-industry/forestry/silviculture/silviculture-surveys/defoliation_guidelines_for_determinate_species.pdf?bcgovtm=Cowichan%20Valley%20Newsletter [accessed 19 May 2021]
- Barnes I, Walla JA, Bergdahl A, Wingfield MJ. 2014. Four new host and three new state records of Dothistroma needle blight caused by Dothistroma pini in the United States. Plant Dis. 98:1443.
- Capron A, Feau N, Heinzelmann R, Barnes I, Benowicz A, Bradshaw RE, Dale A, Lewis KJ, Owen TJ, Reich R, Ramsfield TD. 2021. Signatures of post-glacial genetic isolation and human-driven migration in the Dothistroma needle blight pathogen in western Canada. Phytopathology. 111:116–127.
- Cleaver C, Jacobi W, Burns K, Means R. 2015. Limber pine in the central and southern Rocky Mountains: stand conditions and interactions with blister rust, mistletoe, and bark beetles. For Ecol Manage. 358:139–153.https://doi.org/10.1016/j.foreco.2015.09.010
- Cullingham CI, James PM, Cooke JE, Coltman DW. 2012. Characterizing the physical and genetic structure of the lodgepole pine × jack pine hybrid zone: mosaic structure and differential introgression. Evol Appl. 5:879–891. doi: https://doi.org/10.1111/j.1752-4571.2012.00266.x
- Forest Health and Adaptation. 2018. Annual report 2017. Alberta Agriculture and Forestry, Government of Alberta. https://open.alberta.ca/dataset/ddea0958-0cd4-49b1-9947-053065817202/resource/f05aa8a0-b3bf-4984-a799-65bc8b727a37/download/2017-forest-health-annual-report.pdf [accessed 19 May 2021]
- Hutchison T. 2013. Red band needle blight at ATISC. Bugs and Disease 24:1-2. https://open.alberta.ca/dataset/a798746f-6aaa-46c9-bfd1-8ae49994d4fb/resource/80ab3bf4-a3a9-44a4-b06e-1d97d05eb9b5/download/2728128-2013-04-bugs-diseases-newsletter-volume-24-number-1.pdf [accessed 19 May 2021]
- Ramsfield TD, Bentz B, Faccoli M, Jactel H, Brockerhoff E. 2016. Forest health in a changing world: effects of globalization and climate change on forest insect and pathogen impacts. Forestry 89:245–252. doi: https://doi.org/10.1093/forestry/cpw018.
- Sturrock RN, Frankel SJ, Brown AV, Hennon PE, Kliejunas JT, Lewis KJ, Worrall JJ, Woods AJ. 2011. Climate change and forest diseases. Plant Pathol. 60:133–149.
- Taylor JE, Walla JA. 1999. First report of Dothistroma septospora on native limber and whitebark pine in Montana. Plant Dis. 83:590–590.
- Welsh C, Lewis K, Woods A. 2014. Regional outbreak dynamics of dothistroma needle blight linked to weather patterns in British Columbia, Canada. Can J For Res. 44:212–219.
- Woods AJ, Heppner D, Kope HH, Burleigh J, Maclauchlan L. 2010. Forest health and climate change: a British Columbia perspective. For Chron. 86:412–422.
GENERAL CROP SURVEY/ENQUÊTE GÉNÉRALE SUR LES CULTURES
AN INAUGURAL SURVEY OF CEREAL, OILSEED AND VEGETABLE CROP DISEASES IN THE YUKON TERRITORY IN 2020CROPS: Cereals (Barley, Wheat), Oilseeds (Canola) and Vegetables (Beets, Broccoli, Cabbage, Carrots, Potatoes and Turnips)
LOCATION: Southern Yukon (Whitehorse area)
NAMES AND AGENCIES:
R.J. HOWARD1 & K. FERRIS2
1RJH Ag Research Solutions Ltd., Box 1456, Brooks, AB T1R 1C3Telephone: (403) 362-9564; Facsimile: (403) 501-5753; Email: [email protected]
2Agriculture Branch, Energy, Mines and Resources, P.O. Box 2703, Whitehorse, YK Y1A 2C6
ABSTRACT: Various kinds of field crops growing on two commercial farms in the Whitehorse area of the southern Yukon Territory were surveyed for diseases in summer 2020 by staff of the Agriculture Branch of the Government of Yukon. They included barley, wheat, canola, beets, broccoli, cabbage, carrots, potatoes and turnips. Fields were visited one or more times during July and August. The incidence and severity of diseases were visually assessed on a crop-by-crop basis and samples were collected for laboratory analysis of the pathogens present, if any. Both infectious and non-infectious diseases were present on most crops. The infectious diseases were caused by various species of plant pathogenic bacteria and fungi that were common on these crops growing in other areas of Canada.
INTRODUCTION AND METHODS: The 2020 field crop disease survey is believed to be the first organized study of its kind on agricultural crops in the Territory. In his book, “An Annotated Index of Plant Diseases in Canada … ”, I.L. Conners lists over 300 records of plant diseases on trees, shrubs, herbs and grasses in the Yukon that were published by individuals who were surveying forests and native vegetation mainly for federal government departments, universities and other agencies (Conners Citation1967). The objectives of the 2020 survey were: 1) to determine the kinds and levels of diseases on selected Yukon crops, 2) to identify the major pathogen species attacking Yukon crops, and 3) to use the results to plan future surveillance activities aimed at helping producers to improve their current disease management programs.
All of the fields included in the 2020 survey were situated on two commercial farms, which were designated as Farm #1 and #2, in the Whitehorse area in the southern Yukon (). The crops surveyed included cereals (barley and wheat), oilseeds (canola) and vegetables (beets, broccoli, cabbage, carrots, potatoes and turnips. Fields were visited one or more times in the mid- to late growing season (July/August) at a time when damage from diseases was most noticeable. Symptoms were visually assessed on a crop-by-crop basis by determining their incidence and severity. Incidence was represented by the percentage of plants, leaves, heads, kernels, etc., damaged in the target crop, while severity was estimated to be the proportion of the leaf, fruit, head, root/canopy area, etc., affected by a specific disease as follows: Proportion of the canopy affected based on a 0-4 rating scale, where: 0 = no disease symptoms, 1 = 1-10% of the crop canopy showing symptoms; 2 = 11-25% showing symptoms, 3 = 26-50% showing symptoms, and 4 = >50% showing symptoms. Photographs of affected plants were taken and sent to plant pathologists across Western Canada for their opinions on causation. Where possible, representative samples of plants with disease symptoms were packaged and sent to the Alberta Plant Health Lab (APHL) in Edmonton, AB for diagnostic analyses. Background information, such as the general cultural practices and cropping history, was obtained from the producers wherever possible. GPS coordinates were obtained for each field to enable future mapping
Cereals: Individual fields of barley (11 ha) and wheat (30 ha) located at Farm #1 were surveyed. The barley was a two-row forage cultivar ‘CDC Maverick’, while the wheat was an unspecified cultivar of Canada Prairie Spring (CPS) Wheat. Plant samples were taken along a W-shaped transect for a total of five sampling points for the barley field (<20 ha) and ten sampling points for the wheat field (>20 ha). The first visit, which occurred on July 30, involved visual inspection and destructive sampling wherein plants were collected and removed from the field for a detailed disease assessment at a lab space in Whitehorse. There, the roots were rinsed off and the plants were examined for disease symptoms. The second visit to these fields, which occurred on August 27, only involved visual examination of the standing crop.
Oilseeds: A single 40 ha field of Polish canola (cv. ‘Synergy’) was examined on July 27 on Farm #1. The south half of this field was surveyed following the same protocol as for cereals, although no destructive sampling took place. Five plant samples were taken from this field on two other dates and sent to the APHL; however, one of these shipments was lost in transit.
Vegetables: The vegetable plantings surveyed were situated on Farms #1 and #2. In each of the fields surveyed, the first stop in was made near the end of the row, and several subsequent stops were made down the length of the same row. The number of stops per field varied with the crop type and field size. For cabbage and broccoli, three heads were assessed per stop. All leaf surfaces, top and bottom, were examined for pest presence or disease symptoms. The assessment stops were a minimum of 50 paces apart. For carrots, beets and turnips, a 1 m length of row was examined at each of five stops. At Farm #1, five stops per field were made down the length of a single row, while at Farm #2, where the field sizes were smaller, three stops were made down the length of a single row. The upper and lower leaf surfaces were examined at each stop. For potatoes, about 1 m of row (4-5 plants) was examined at each stop. Ten leaf triplets (5 upper and 5 lower) were collected at each stop and the upper and lower leaf surfaces were examined for symptoms.
RESULTS AND COMMENTS: A summary of the diseases and potential causal agents observed during surveys on cereal, oilseed and vegetable crops in the Yukon Territory in 2020 is given in . All have previously been reported on their respective host crops in Western Canada.
Table 1. A summary of diseases observed during surveys on cereal, oilseed and vegetable crops in the Yukon Territory in 2020
Barley (Farm #1): Very low levels (mean = 0.2%) of loose smut (Ustilago nuda) were noted on the heads on the first field visit. The most prevalent diseases during the growing season were chlorotic and necrotic leaf spotting and crown and root rot. The leaf spotting was evident on both sampling dates. Initially, the spots appeared as chlorotic flecks across the leaf blades and later as necrotic lesions; however, it was unclear as to whether this represented a progression of symptoms or reflected two distinct problems. The mean incidence of chlorotic spotting on July 30 was 68% and for the necrotic spotting on August 27, it was 75%. Crown and root rot symptoms were widespread on July 30, but no incidence or severity ratings were done. Sample analysis at the APHL revealed that Fusarium avenaceum, Microdochium bolleyi and Trichocladium sp. were the main root pathogens present. By August 27, the leaf spots had developed into necrotic lesions and the average disease incidence and severity values were 75% and 1.6, respectively. Leaf samples submitted to the APHL tested positive for the leaf blotch pathogen Parastagonospora avenaria. This fungus is usually more common on wheat than barley in Canada. Other fungi isolated included Alternaria sp., Epicoccum sp., Cladosporium sp., Fusarium avenaceum and Microdochium nivale. Most of these were suspected to be either saprophytes or weak parasites.
Wheat (Farm #1): Leaf mottling and yellowing and deformed heads were the most common symptoms seen in this crop on both sampling dates. On July 30, the mean incidence of leaf mottling was 20% and for deformed heads it was 11%. No pathogens were isolated from the mottled leaves, so it appeared that this disorder was physiological in origin. The plants also exhibited typical symptoms of crown and root rot, and the pathogens Fusarium avenaceum, F. equiseti, F. culmorum, Microdochium bolleyi and Rhizoctonia sp. were isolated from a sample of affected plants sent to the APHL. An unidentified phytoplasma was detected in some of the plants displaying deformed heads. The aster yellows phytoplasma has been reported on wheat and other cereal crops in Canada, where it can produce small, sterile, distorted or twisted heads. In some parts of the field, the stand was thin and very little tillering was evident in the plants. This may have been due to factors such as low soil fertility, soil compaction or a lack of moisture.
Canola (Farm #1): A 40 ha field of the Polish canola cultivar ‘Synergy’ was surveyed once on July 27 when the crop was flowering and at the early pod set growth stage. No foliar fungicides had been applied prior to the date of the survey. No widespread presence of disease symptoms was noted on July 27. One plant was found with scattered black spots on the leaves and lab tests showed that this was black spot disease caused by an Alternaria sp. Fusarium avenaceum and Boeremia exigua were also isolated. Another plant had a leaf with symptoms that resembled downy mildew (Peronospora parasitica), and a third had a dark, water-soaked area on the stem that may have been a bacterial infection, but these diseases were not confirmed. In some parts of the field, the canola plants were stunted and chlorotic. These symptoms were characteristic of sulphur deficiency, a common disorder of canola in parts of the Prairie Provinces in which leaf yellowing and cupping tend to occur on new leaves first, then progress to other parts of the plant.
Beets (Farms #1 and #2): At Farm #1, alternaria leaf spot (Alternaria sp.) was not seen on the plants on July 27, but it began to show up by August 18, although the severity levels were very low (mean = 1%). A single root with common scab (Streptomyces scabies) was found. At Farm #2, a planting of red beets was surveyed on August 6 and 18. Levels of alternaria leaf spot were very low at this location, where the average disease incidence was 1% and the average disease severity was 0.4 on a scale of 0 to 5. Microdochium spp. were also isolated from of the affected leaves.
Broccoli (Farm #1): A small planting was surveyed only once on August 18 and no diseases were found.
Cabbage (Farm #1): A single cabbage planting was surveyed once on July 27. One cabbage leaf with a water-soaked patch was observed. The cause of this problem was undetermined.
Carrots (Farm #1): A single carrot planting was surveyed on July 27 and August 18. Both inspections revealed no diseases; however, a small amount of leaf yellowing was noted at two spots along the survey path on August 18, but no specific disease or physiological stress could be attributed to these symptoms. Low spots in the field showed some minor stunting of plant growth, which the grower reported as having been observed in most years.
Potatoes (Farm #2): A single planting was surveyed on July 30 and August 18. No significant diseases were noted. Minor leaf yellowing and cupping were noted at two sampling sites on August 18 and could not be attributed to an infectious disease. One leaf with a large early blight (Alternaria solani) lesion was found on a plant outside of the survey area. Some cull tubers with symptoms of black scurf and soft rot collected from an on-farm potato storage grading line on October 27 were submitted to the APHL for diagnosis. The lab confirmed black scurf (Rhizoctonia solani), soft rot (Pectobacterium carotovorum subsp. carotovorum), blackleg (Pectobacterium carotovorum subsp. atrosepticum) and sour rot (Geotrichum candidum) on the tubers.
Turnips (Farm #2): A turnip planting was surveyed on August 6 and 18. One root with a large lesion on the side and accompanying subsurface discoloration was seen, along with a leaf that had a purple-colored lesion. Samples were sent to the APHL but were unfortunately lost in transit. Based on the symptoms, it was suspected that these diseases were fungal infections.
It seems likely that many of these pathogens were introduced into the Territory on agricultural plants and plant products, such as seed, tubers and transplants, or on used farm equipment and machinery contaminated with infested soil and crop debris. Airborne spores dispersed on prevailing winds and storm fronts from southern areas, including the Peace Regions of British Columbia and Alberta, and from neighboring Alaska are also possible sources of inoculum. Most of the diseases encountered in the 2020 survey occurred at low levels and did not appear to be causing significant damage; however, assessing actual levels of yield and quality losses was beyond the scope of the survey. As cereal, oilseed and vegetable crop production intensifies in the Yukon, it is expected that disease and pest levels will increase over time and economic losses will occur.
ACKNOWLEDGEMENTS: The authors wish to thank the following individuals and organizations for their assistance with the 2020 crop disease survey: Mr. Randy Lamb, Mr. Brad Barton and Luka van Randen, Agriculture Branch, Energy Mines and Resources, Whitehorse, YT; Drs. Jie Feng, Qixing Zhao and Hafiz Ahmed and Messrs. Alain Starkes, Yingli Wang, Yalong Yang and Kher Zahr, Alberta Plant Health Laboratory, Alberta Agriculture and Forestry, Edmonton, AB; Mr. Clint Jurke, Agronomy Director, Canola Council of Canada, Lloydminster, SK; Dr. Kelly Turkington, Lacombe Research & Development Centre, Agriculture and Agri-Food Canada, Lacombe, AB; Dr. Mike Harding, Pest Surveillance Unit, Alberta Agriculture and Forestry, Brooks, AB; and the Prairie Crop Disease Monitoring Network (https://prairiecropdisease.blogspot.com).
REFERENCES
- Conners IL. 1967. An annotated index of plant diseases in Canada and fungi recorded on plants in Alaska, Canada and Greenland. Ottawa (ON): Canada Dept Agric Research Branch, Publ. 1251.
Fig. 1 A map of the Yukon Territory showing areas where crop production is concentrated. The 2020 crop disease survey was conducted in fields in the Whitehorse area
