Molecular detection, virulence, and mycelial compatibility of Macrophomina phaseolina isolates associated with chickpea wilt in Sinaloa and Sonora, Mexico

Abstract

Three Macrophomina species (M. phaseolina, M. pseudophaseolina, and M. euphorbiicola) associated with various crops worldwide have been distinguished to date by DNA sequence analysis; however, no studies have been conducted to identify Macrophomina species occurring on chickpea in Mexico. The aims of this study were to identify Macrophomina isolates associated with chickpea wilt through the use of species-specific primers, as well as to determine their virulence and mycelial compatibility. During the 2019 growing season, 58 Macrophomina isolates were obtained from symptomatic plants collected from 19 chickpea crops distributed in the states of Sinaloa and Sonora, Mexico. The identity of all 58 isolates was determined by PCR using three sets of primers specific to three Macrophomina species (M. phaseolina, M. pseudophaseolina, and M. euphorbiicola). Virulence was determined by inoculating chickpea seedling roots with a mycelial suspension and disease severity was assessed 30 days after inoculation. Molecular detection with species-specific primers indicated that all isolates belong to M. phaseolina, with significant differences found in their virulence. Mycelial compatibility testing showed that there are at least six mycelial compatibility groups of M. phaseolina distributed in chickpea fields in Sinaloa and Sonora. This information will serve as a basis for future studies on the epidemiology and management of the disease caused by M. phaseolina on chickpea in Mexico.

Résumé: Trois espèces de Macrophomina (M. phaseolina, M. pseudophaseolina et M. euphorbiicola), associées à diverses cultures dans le monde, ont été différenciées à ce jour par l’analyse des séquences de l’ADN. Toutefois, aucune étude n’a été menée pour identifier l’espèce de Macrophomina qui vit sur les pois chiches au Mexique. Les buts de cette étude étaient d’identifier les isolats de Macrophomina associés à la flétrissure du pois chiche grâce à l’utilisation d’amorces spécifiques des espèces, de même que de déterminer leur virulence et leur compatibilité mycélienne. Durant la saison de croissance de 2019, 58 isolats de Macrophomina ont été obtenus de plants symptomatiques collectés dans 19 cultures de pois chiches des États du Sinaloa et du Sonora, au Mexique. L’identité des 58 isolats a été déterminée par PCR en utilisant trois jeux d’amorces spécifiques de trois espèces de Macrophomina (M. phaseolina, M. pseudophaseolina et M. euphorbiicola). La virulence a été établie en inoculant des racines de plantules de pois chiches avec une suspension de mycélium, puis la gravité de la maladie a été évaluée 30 jours après l’inoculation. La détection moléculaire avec les amorces spécifiques des espèces a indiqué que tous les isolats appartenaient à M. phaseolina, mais que leur degré de virulence variait significativement. Les essais sur la compatibilité mycélienne ont démontré qu’il y a au moins six groupes de compatibilité mycélienne de M. phaseolina répartis dans les champs de pois chiches du Sinaloa et du Sonora. Cette information servira de référence aux prochaines études sur l’épidémiologie et la gestion de la maladie causée par M. phaseolina chez les pois chiches au Mexique.

Keywords:

• Cicer arietinum
• Macrophomina phaseolina
• mycelial compatibility
• pathogenicity
• species-specific primers

Mots clés:

• Cicer arietinum
• Macrophomina phaseolina
• pathogénicité
• compatibilité mycélienne
• amorces spécifiques des espèces

Introduction

Chickpea (Cicer arietinum L.), the only cultivated species of the genus Cicer, is native to eastern Turkey. It is also the third most important legume worldwide, with 96% of production in developing countries. Mexico ranks 8^th in the world with a production of202846tons; the main producing states include Sinaloa, Sonora, Michoacán, Guanajuato, and Baja California Sur, with the first two contributing the highest percentage (79%) of production (SIAP 2020). Chickpea is valued for the high protein content in its seed and is used increasingly as a substitute for animal protein (Shinde and Hunje 2019). There are two different types of chickpeas: desi and kabuli (white); the latter is considered economically more important and receives a higher price in the market compared with the desi type (Jendoubi et al. 2017).

Among the main limiting factors in chickpea production are root rot and wilt caused by a complex of soilborne fungi such as Fusarium spp., Macrophomina phaseolina (Tassi) Goid., Sclerotium rolfsii Sacc., and Rhizoctonia solani Kühn (Fierros-Leyva et al. 2019). This complex of fungi can cause yield losses of up to 80% in Mexico (Padilla-Valenzuela et al. 2008).

Macrophomina phaseolina is a seed- and soilborne fungus with great morphological, physiological, pathogenic, and genetic variability, which increases its adaptability to various environmental conditions (Beas-Fernández et al. 2006; Reyes-Franco et al. 2006; Marquez et al. 2021). This fungus belongs to the family Botryosphaeriaceae and attacks more than 500 plant species (Kaur et al. 2012; Sarr et al. 2014), including economically important hosts such as soybean (Glycine max (L.) Merr.), common bean (Phaseolus vulgaris L.), potato (Solanum tuberosum L.), maize (Zea mays L.), sorghum (Sorghum bicolor (L.) Mönch.), peanut (Arachis hypogaea L.), chilli (Capsicum annuum L.), chickpea, cotton (Gossypium hirsutum L.), and canola (Brassica napus L.) (Leyva-Mir et al. 2015). Disease symptoms caused by M. phaseolina include poor growth, yellowing, and wilting (Dhingra and Sinclair 1978; Manjunatha and Saifulla 2018); these occur because the pathogen affects the roots and invades the xylem vessels, thereby blocking the water flow in the plant (Muñoz-Cabañas et al. 2005). In addition, phytotoxic metabolites produced by M. phaseolina have been described, including phaseolinon, botryodiplodin, and patulin, which are believed to play a role in the initial stages of infection, causing wilting of seedlings and formation of necrotic lesions on leaves and roots (Abbas et al. 2020; Salvatore et al. 2020; Marquez et al. 2021).

Several studies have associated M. phaseolina as the only Macrophomina species causing root rot and wilt symptoms in chickpea (Díaz-Franco and Montes-García 2008; Ávila-Miramontes et al. 2015; Khan et al. 2017; Lakhran et al. 2018; Živanov et al. 2019). In India, this pathogen can cause yield losses of 10% to 25% in the crop (Manjunatha et al. 2013). However, three cryptic species of Macrophomina (M. phaseolina, M. pseudophaseolina Crous, Sarr & Ndiaye, and M. euphorbiicola Machado, Soares & Pereira) have been recently recognized worldwide. These species can only be distinguished by using species-specific primers (Santos et al. 2020) or by multilocus phylogenetic analysis with combined sequence data from the internal transcribed spacer (ITS) region, as well as fragments of genes such as actin (ACT), β-tubulin (βT), calmodulin (CAL), and translation elongation factor 1-alpha (TEF-1α) (Sarr et al. 2014; Machado et al. 2019).

Mycelial compatibility has been used to assess genetic diversity among M. phaseolina isolates in various countries (Barzegar and Banihashemi 2019; Csöndes 2011; Csüllög and Tarcali 2020). In Mexico, there are no studies on the mycelial compatibility of Macrophomina isolates, and the identity of the different species has not been verified with species-specific primers for each of the three species described worldwide. The objectives of this research were to identify Macrophomina isolates associated with root rot and wilt symptoms on chickpea plants in fields in Sinaloa and Sonora, Mexico, by using species-specific primers of the TEF1-α gene, in addition to estimating virulence and determining the mycelial compatibility of fungal isolates.

Materials and methods

Sample collection

During the 2019 growing season, chickpea plants (cv. Blanco Sinaloa ´92) with chlorosis, root rot, and wilt symptoms (Fig. 1) were collected from 18 commercial fields distributed in the municipalities of Guasave, Mocorito, Salvador Alvarado, Angostura, and Culiacán in the state of Sinaloa, Mexico. In addition, diseased plants were collected from a site located in the municipality of Hermosillo, Sonora, Mexico. Samples were collected from each field at three phenological stages (leaf growth, flowering, and pod fill).

Fig. 1 Chickpea wilt caused by Macrophomina phaseolina. (a–b) Chickpea fields with high disease incidence. (c) Chickpea plants showing chlorosis and wilt. (d) Early symptoms of stem and root rot. (e) Advanced symptoms of stem and root rot.

Isolation, purification, and preservation of fungi

Macrophomina isolates were obtained using the procedures described by Crous et al. (2009). For isolation, 5-mm long pieces of diseased root tissue were cut, surface disinfested by immersion in 2% sodium hypochlorite (NaClO) for 2 min, rinsed twice in sterile distilled water for 1 min, and dried with sterile absorbent paper. Subsequently, the disinfested pieces were placed in Petri dishes with potato dextrose agar (PDA) culture medium (Difco®, USA). The Petri dishes were incubated at 25°C in the dark for 72 h and then mycelial plugs (5 mm in diameter) from the edge of actively growing Macrophomina-like colonies were transferred to Petri dishes with fresh PDA and incubated at 25°C for seven days. To verify the identity of the isolates, morphology of mycelia and microsclerotia of all isolates was examined using light microscopy. Pure cultures were obtained using the hyphal-tip technique on water agar (WA) culture medium and transferred to plates with PDA medium. The Macrophomina isolates used in this study were deposited in the Culture Collection of Phytopathogenic Fungi at the Centro de Investigación en Alimentación y Desarollo (Culiacán, Sinaloa, Mexico) under the accession nos. CCLF20 to CCLF77. Mycelial plugs of the fungal isolates were maintained in sterile distilled water at 4°C and in 10% glycerol at −80°C.

DNA extraction and PCR amplification

Genomic DNA was extracted according to the CTAB method (Doyle and Doyle 1990). Aerial mycelium from 7-day-old Macrophomina colonies cultured on PDA medium was scraped with a sterile spatula, macerated in a sterile mortar using liquid nitrogen, and transferred to a 1.5 mL microcentrifuge tube containing 500 µL of buffer solution (100 mM Tris, pH 8; 20 mM of EDTA, pH 8; 1.4 M NaCl; 3% CTAB; 0.2 mg mL⁻¹ of proteinase K), vortexed for 10s and incubated for 60 min at 65°C. Then, 700 µL of chloroform-isoamyl alcohol (24:1 v/v) was added, vortexed for 10s and placed in a 5810 R centrifuge (Eppendorf®, USA) at13000g for 10 min. The supernatant was transferred to a 1.5 mL microcentrifuge tube and 700 µL of isopropanol was added. The tubes were mixed by inversion four to five times and stored at −20°C for 10 min, then centrifuged at13 000 g for 10 min and the supernatant was discarded. Subsequently, 500 µL of 70% ethanol was added to each tube, centrifuged at13 000 g for 5 min, and the supernatant was again discarded. The tubes were placed on blotting paper until the ethanol evaporated, and when the pellet was dry, 100 µL of DNasa/RNasa-free distilled water was added. DNA quality and concentration were quantified with a Q‒3000 UV spectrophotometer (Quawell®, USA). The DNA was stored at −20°C for later use.

For the PCR analysis, we used species-specific primers targeting the translation elongation factor 1-α (TEF1-α) gene of M. phaseolina (MpTefF‒AAACACACTTTTCGCACTCCTGC, MpTefR‒ TATGCTCGCAGAGAAGAACACGA), M. pseudophaseolina (MsTefF‒GCACACTTTTCGCGCTTCTGTA, MsTefR‒TGTGCTCGCTGGGAAGAACATGA), and M. euphorbiicola (MeTefF‒AAGCATACTTTTCGTGCTCCTGC, MeTefR‒ AAAGGAACATGAGTGGCCAAAAA), which were designed and reported by Santos et al. (2020). The reaction mixture was prepared with a final volume of 25 µL, 1x PCR buffer, 2.5 mM MgCl₂, 0.2 mM dNTP, 0.4 µM of each primer, 0.04 U DNA polymerase (Promega®, USA) and 4 ng of DNA. PCR was carried out in a C-1000 thermal cycler (Bio-Rad®, USA) under the following conditions: an initial denaturation step at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30s, annealing for 30s at 67, 69, or 65°C for the primers MpTefF/MpTefR, MsTefF/MsTefR, and MeTefF/MeTefR, respectively; extension at 72°C for 1 min and a final extension step at 72°C for 10 min. The amplified products were verified by 1% agarose gel electrophoresis with 1X TAE buffer and stained with ethidium bromide. To run electrophoresis at 90 volts, 7 µL of the PCR product and 3 µL of loading buffer were used. The gel was analysed on a Gel Doc XR + Gel Documentation System transilluminator (Bio-Rad®, USA). Positive controls of DNA for M. phaseolina, M. pseudophaseolina, and M. euphorbiicola were kindly provided by Dr. Sami Jorge Michereff (Universidade Federal do Cariri, Brazil).

Pathogenicity and virulence test

The pathogenicity of Macrophomina isolates was verified by inoculating chickpea seedlings of a susceptible genotype (Blanco Sinaloa ´92) under greenhouse conditions according to the procedures described by Robles-Yerena et al. (2016) and Jarek et al. (2018), with some modifications. For inoculum preparation, each Macrophomina isolate was cultured in PDA medium at 25°C for 10 days. The mycelial growth was scraped with a slide, placed in sterile distilled water, and liquefied for 10s using a waring blender. The inoculum suspension was adjusted to a concentration of 1 × 10⁵ mycelial fragments mL⁻¹ and Tween 20® was added. Chickpea seeds were sown in 128-cavity polystyrene trays (60 mL per cavity) containing an autoclaved mixture of peat moss and sand (2:1). Seedlings were regularly watered to keep the growth substrate in a wet condition. Fifteen-day-old chickpea seedlings were carefully removed from their cavities.

The roots were washed with sterile distilled water and inoculated by immersion in the mycelial suspension for 30 min. Once the time had elapsed, the seedlings were placed again in trays with sterile substrate and kept in a greenhouse at a temperature of 25 to 35°C. Each isolate was inoculated on seven plants and the experiment was repeated twice. The roots of 10 control seedlings were immersed in sterile distilled water.

The observation of symptom progress was performed daily and the evaluation of disease severity was carried out 30 days after inoculation using a 5-category visual scale, where 0 = no visible symptoms, 1 = less than 25% foliage diseased, 2 = 25 to 50% foliage diseased, 3 = 50 to 75% foliage diseased, 4 = more than 75% foliage diseased. The scale values were transformed to percent values and virulence assay data were analysed. Normality and homogeneity of variances were first checked through Shapiro–Wilk test and Levene test, respectively. Variances of the two experiments were not statistically different for each test; therefore, the raw data for the two repeats of each experiment were combined for subsequent analysis. Then, data were subjected to analyses of variance (ANOVA) and means were compared by Fisher’s least significant difference (LSD) test, at 5% probability using PROC GLM in SAS (version 9.3; SAS Institute, Cary, NC). Isolates were treated as fixed effects. Uninoculated controls were excluded from statistical analysis.

Mycelial compatibility

Mycelial compatibility tests for the 58 Macrophomina isolates were carried out in Petri dishes (90 mm in diameter) containing PDA medium. A mycelial plug (6 mm in diameter) from five different isolates was individually placed on the periphery of a Petri dish and one different isolate was placed in the centre. The 58 Macrophomina isolates were tested in combinations with three replicates for each combination. Each isolate was paired with 57 other isolates and itself at least three times. Petri dishes were incubated at 25°C in constant darkness and the union of colonies was evaluated at 7, 10, and 14 days. The relationship was defined visually based on Csöndes (2011); it was considered compatible when the mycelia grew into each other and one continuous colony was created, whereas, the relationship was considered incompatible when a clearly defined barrier (blocking zone) was formed between the colonies and some of the hyphae were destroyed. Mycelial compatibility groups (MCGs) were identified based on data from compatible reactions among tested isolates. The entire experiment was performed twice. Isolates that had conflicting results between replications were paired with each other a fourth time.

Results

Fungal isolates

A total of 58 Macrophomina isolates were obtained from chickpea plants with chlorosis and wilt symptoms across 19 fields distributed in the municipalities of Salvador Alvarado (17 isolates), Mocorito (11 isolates), Guasave (6 isolates), Angostura (3 isolates), Culiacán (1 isolate) in Sinaloa, as well as in Hermosillo (20 isolates) in Sonora.

Identification with species-specific primers

Identification of Macrophomina isolates associated with chickpea wilt in Sinaloa and Sonora, Mexico with species-specific TEF1-α gene primers indicated that all 58 isolates were M. phaseolina. This was because only the expected 217-bp PCR amplicon of the species-specific primers for M. phaseolina (MpTefF/MpTefR) was obtained (Santos et al. 2020), but there was no amplification when using the species-specific primers for M. pseudophaseolina (MsTefF/MsTefR) and M. euphorbiicola (MeTefF/MeTefR).

Pathogenicity and virulence

All inoculated chickpea plants showed chlorosis symptoms, wilting, and premature defoliation 30 days after inoculation (Fig. 2a), while control plants remained disease-free (Fig. 2b), confirming the pathogenicity of the 58 Macrophomina phaseolina isolates. Statistical analysis showed significant differences (P ≤ 0.05) between the virulence of fungal isolates (Fig. 3). The most virulent isolates (>70% severity) were recorded in chickpea fields in the municipalities of Salvador Alvarado, Mocorito, and Guasave, while the less virulent isolates (<60% severity) occurred at Salvador Alvarado, Mocorito, Guasave, and Angostura in the state of Sinaloa. Of the 20 isolates obtained from a chickpea field in the municipality of Hermosillo, in the state of Sonora, three showed a mean severity of greater than 70%, 14 isolates had a mean of 60 to 70%, and three isolates had a mean <60% (Fig. 3).

Fig. 2 Chickpea plants cv. Blanco Sinaloa 92 artificially inoculated with Macrophomina phaseolina. (a) Symptoms on chickpea plants, 30 days after inoculation. (b) Control plants.

Fig. 3 Disease severity caused by 58 Macrophomina phaseolina isolates associated with chickpea wilt in the Northwest region of Mexico (States of Sinaloa and Sonora), 30 days after inoculation onto roots of chickpea cv. Blanco Sinaloa. Error bars represent standard error. Columns with the same letter do not differ significantly, according to Fisher’s LSD test (P ≤ 0.05).

Mycelial compatibility

The compatibility tests among the 58 M. phaseolina isolates showed a total of six MCGs, which are shown in Table 1. Forty-two isolates (72.4%) were assigned to MCG-I, five isolates (8.62%) to MCG-II, four isolates (6.89%) to MCG-III, three isolates (5.17%) to MCG-IV, two isolates (3.44%) to MCG-V, and two isolates (3.44%) to MCG-VI.

Table 1. Origin, mycelial compatibility groups (MCGs) of Macrophomina phaseolina isolates collected from chickpea plants in Sinaloa and Sonora, Mexico.

Isolate code	Site	Origin	Collection date	MCG
CCLF70	1	Mocorito, Sinaloa	January 2019	I
CCLF72	1	Mocorito, Sinaloa	January 2019	I
CCLF74	2	Mocorito, Sinaloa	February 2019	I
CCLF37	3	Mocorito, Sinaloa	February 2019	I
CCLF77	3	Mocorito, Sinaloa	February 2019	I
CCLF20	4	Mocorito, Sinaloa	January 2019	I
CCLF22	4	Mocorito, Sinaloa	January 2019	I
CCLF35	4	Mocorito, Sinaloa	January 2019	I
CCLF25	4	Mocorito, Sinaloa	January 2019	II
CCLF36	4	Mocorito, Sinaloa	January 2019	II
CCLF71	5	Mocorito, Sinaloa	January 2019	V
CCLF32	6	Culiacán, Sinaloa	January 2019	III
CCLF40	7	Salvador Alvarado, Sinaloa	January 2019	I
CCLF23	8	Salvador Alvarado, Sinaloa	January 2019	I
CCLF26	8	Salvador Alvarado, Sinaloa	January 2019	I
CCLF68	8	Salvador Alvarado, Sinaloa	January 2019	I
CCLF53	9	Salvador Alvarado, Sinaloa	January 2019	I
CCLF56	9	Salvador Alvarado, Sinaloa	January 2019	I
CCLF41	9	Salvador Alvarado, Sinaloa	January 2019	III
CCLF75	9	Salvador Alvarado, Sinaloa	January 2019	V
CCLF27	10	Salvador Alvarado, Sinaloa	February 2019	I
CCLF28	10	Salvador Alvarado, Sinaloa	February 2019	I
CCLF59	10	Salvador Alvarado, Sinaloa	February 2019	I
CCLF49	10	Salvador Alvarado, Sinaloa	February 2019	III
CCLF38	10	Salvador Alvarado, Sinaloa	February 2019	VI
CCLF24	11	Salvador Alvarado, Sinaloa	February 2019	I
CCLF21	11	Salvador Alvarado, Sinaloa	February 2019	I
CCLF39	11	Salvador Alvarado, Sinaloa	February 2019	I
CCLF45	12	Salvador Alvarado, Sinaloa	February 2019	I
CCLF63	13	Guasave, Sinaloa	February 2019	I
CCLF48	14	Guasave, Sinaloa	January 2019	I
CCLF60	14	Guasave, Sinaloa	January 2019	I
CCLF54	14	Guasave, Sinaloa	January 2019	I
CCLF55	14	Guasave, Sinaloa	January 2019	I
CCLF66	15	Guasave, Sinaloa	February 2019	IV
CCLF33	16	Angostura, Sinaloa	January 2019	I
CCLF46	17	Angostura, Sinaloa	January 2019	I
CCLF47	18	Angostura, Sinaloa	January 2019	II
CCLF31	19	Hermosillo, Sonora	June 2019	I
CCLF34	19	Hermosillo, Sonora	June 2019	I
CCLF42	19	Hermosillo, Sonora	June 2019	I
CCLF44	19	Hermosillo, Sonora	June 2019	I
CCLF51	19	Hermosillo, Sonora	June 2019	I
CCLF52	19	Hermosillo, Sonora	June 2019	I
CCLF57	19	Hermosillo, Sonora	June 2019	I
CCLF58	19	Hermosillo, Sonora	June 2019	I
CCLF61	19	Hermosillo, Sonora	June 2019	I
CCLF62	19	Hermosillo, Sonora	June 2019	I
CCLF64	19	Hermosillo, Sonora	June 2019	I
CCLF69	19	Hermosillo, Sonora	June 2019	I
CCLF73	19	Hermosillo, Sonora	June 2019	I
CCLF76	19	Hermosillo, Sonora	June 2019	I
CCLF30	19	Hermosillo, Sonora	June 2019	II
CCLF67	19	Hermosillo, Sonora	June 2019	II
CCLF65	19	Hermosillo, Sonora	June 2019	III
CCLF29	19	Hermosillo, Sonora	June 2019	IV
CCLF43	19	Hermosillo, Sonora	June 2019	IV
CCLF50	19	Hermosillo, Sonora	June 2019	VI

MCG-I had a wide geographical distribution and occurred in all municipalities except at Culiacán, Sinaloa. In contrast, the remaining five MCGs had a limited geographical distribution. MCG-II was found at Mocorito and Angostura municipalities from Sinaloa state, as well as at Hermosillo from Sonora state. MCG-III was recorded at Culiacán, Salvador Alvarado, and Hermosillo (Sonora). MCG-IV occurred only at Guasave, Sinaloa and Hermosillo, Sonora. MCG-V was found only at Mocorito and Salvador Alvarado in Sinaloa. MCG-VI was recorded at Salvador Alvarado, Sinaloa and Hermosillo, Sonora.

Regarding sampled states, all MCGs were identified in Sinaloa, whereas MCG-V was not present in Sonora; however, it was not possible to relate the mycelial compatibility grouping and geographic distribution of the isolates because of the small number of isolates analysed.

Discussion

This study determined, by using species-specific primers amplifying the TEF-1α gene, that M. phaseolina is the predominant Macrophomina species in chickpea fields in the states of Sinaloa and Sonora, Mexico. Previous studies identified three Macrophomina species (M. phaseolina, M. pseudophaseolina, and M. euphorbiicola) by multilocus phylogenetic analyses using combined ITS, ACT, βT, CAL, and TEF1-α sequence data (Sarr et al. 2014; Machado et al. 2019) as well as phylogenetic analyses using only sequences from the ITS region (Wagan et al. 2019; Pandy et al. 2020). However, Machado et al. (2019) and Santos et al. (2020) indicated that ITS sequences are not sufficient to distinguish between the three Macrophomina species. Species-specific primers that amplify a fragment of the TEF1-α gene are just as effective, but much cheaper, faster, and easier to use compared to multilocus phylogenetic analyses, which are laborious and expensive; they also require time and knowledge of phylogenetic identification for species distinction (Santos et al. 2020). Similarly, Negreiros et al. (2019) reported that the use of species-specific primers showed potential to be used as a tool to identify known species of Macrophomina and other Botryosphaeriaceae species.

All M. phaseolina isolates evaluated in this study were pathogenic to inoculated chickpea plants and the symptoms observed were root rot, chlorosis, and premature defoliation. Regarding virulence, M. phaseolina isolates showed significant differences and were grouped into three categories. These differences may be due to the fact that M. phaseolina is highly variable because of the large number of polykaryotic characteristics of the mycelium, mutation, hyphal fusion, and mitotic recombination; this pathogenic variability has been described in different hosts, including soybean and sunflower (Helianthus annuus L.) (Dhingra and Sinclair 1978; Jiménez et al. 1983). There are several studies similar to ours in which the pathogenicity M. phaseolina has been reported in other plant hosts with differences in virulence, which may vary depending on the region of origin of the isolates (Echávez and Perdomo 1991; Mayek-Pérez et al. 2001; Muñoz-Cabañas et al. 2005; Aghakhani et al. 2009; Manjunatha and Saifulla 2018; Negreiros et al. 2019; García et al. 2019).

In the present study, six MCGs were identified, indicating a high level of genetic variability amoung Mexican Macrophomina phaseolina isolates. Mayék-Pérez et al. (2001) and Muñoz-Cabañas et al. (2005) obtained high percentages of polymorphism by means of AFLP analysis in M. phaseolina isolates from Mexico, which revealed the existence of great genetic diversity, showing the polykaryotic nature or the possibility of genetic recombination in this plant pathogenic fungus. Similarly, Barzegar and Banihashemi (2019) reported a total of 33 different MCGs of M. phaseolina in Iran, showing the existence of high genetic diversity among the fungal isolates. In contrast, Csöndes (2011) registered high compatibility among 53 M. phaseolina isolates obtained from sunflower, maize, and soybean in Serbia, Hungary, and Spain. This result is significant since mycelial compatibility is a precondition for DNA exchange through anastomosis between two compatible isolates, which increases the possibility of parasexual recombination and therefore the maintenance of genetic diversity in M. phaseolina (Almeida et al. 2003; Krnjaja et al. 2013).

Our results showed that five of six MCGs occurred in Sonora, and MCG-V was only present in Sinaloa, indicating that the MCGs could be distributed at different geographical sites in the states of Sinaloa and Sonora; however, further studies examining a large number of isolates from several MCGs are required in order to resolve this uncertainty. The variability of a pathogen in a geographic area can be estimated through this type of study, in addition to other factors that can provide information on this variation, such as rapid growth, mycelial dispersion, and the abundant production of microsclerotia (Purkayastha et al. 2006). Other authors such as Mihail and Taylor (1995), Vandemark et al. (2000), Csöndes (2011) Csüllög and Tarcali (2020), stated that identical or similar fungal genotypes can spread over long distances via transport of infected seed and material with resistance structures (microsclerotia) of the fungus, which play a very important role in the dissemination and propagation.

In conclusion, molecular detection by amplification of a fragment of the TEF1-α gene using species-specific primers revealed that all 58 Macrophomina isolates from chickpea were M. phaseolina. Inoculation of the fungus onto chickpea roots indicated that all isolates were pathogenic and there is a difference in their virulence. In addition, the mycelial compatibility test showed that some isolates had the ability to fuse hyphae, giving a total of six MCGs among the 58 isolates of M. phaseolina obtained from chickpea fields in the states of Sinaloa and Sonora, Mexico. These findings have important implications and further studies on the impact, epidemiology, fungicide sensitivity, and disease resistance are needed for the development of suitable management strategies for the disease in Mexican chickpea fields.

Acknowledgements

We thank Rosalía López-Corrales, Edén Salenko Guerrero-Soto, and Alsino Villarreal-Wong for providing assistance during the pathogenicity tests. We also thank the anonymous reviewers for their critical comments and suggestions for improving the manuscript.

Disclosure statement

No potential conflict of interest was reported by the author(s).