Nitric Oxide Synthase Gene Polymorphisms in Children with Primary Nocturnal Enuresis: A Preliminary Study

Abstract

Aims. Recent studies demonstrated some differences in urinary electrolytes of enuretic children. Intrarenal nitric oxide (NO) serves as a major regulator of renal sodium and water excretion like an endogenous diuretic. This study aimed to investigate endothelial (eNOS), and neuronal (nNOS) NO synthase gene polymorphisms in children with primary nocturnal enuresis (PNE). Materials and Methods. The eNOS gene polymorphism was investigated in 171 Turkish children (57 PNE cases and 114 healthy, non-enuretic controls), and nNOS gene polymorphism was determined in 158 Turkish children (83 PNE cases and 75 healthy, non-enuretic controls). The glu298asp (G/T) polymorphism of the eNOS and C276T (C/T) polymorphism of nNOS genes were genotyped using PCR. Results. The distribution of GG, TG, and TT genotypes for eNOS gene was 48%, 33%, and 19% in PNE, compared with 61%, 26%, and 13% in the controls (p > 0.05). The distribution of CC, TC, TT and genotypes for nNOS gene was 31%, 29%, and 40% in PNE compared with 10%, 43%, and 47% in the controls. CC genotype was found higher in enuretic children (p = 0.002). The eNOS and nNOS gene polymorphisms were not associated with positive family history, frequency of enuresis, and clinical response to desmopressin. Conclusions. This study is the first to search the NOS gene polymorphisms in children with PNE. It was determined that eNOS gene polymorphism may not be associated with PNE, while nNOS gene polymorphism, a predominantly CC genotype, may be associated with PNE in Turkish children. Further studies with larger samples together with the detection of enuresis gene may help determine the exact role of nNOS gene polymorphism in enuresis.

Keywords:

• endothelial NOS
• neuronal NOS
• nitric oxide synthase gene
• primary nocturnal enuresis
• polymorphism

INTRODUCTION

Primary nocturnal enuresis (PNE) is defined as enuresis characterized by night-time symptoms only, and is probably the most common developmental disorder in children.[1],[2] Despite many reports concerning the epidemiology, pathophysiology, and management of PNE, the etiology remains unclear. Recent studies indicate that enuresis is due to physiological reasons rather than to psychiatric factors.[3] They demonstrated some differences in urinary electrolytes of enuretic children and stressed the possible existence of a renal tubular maturation defect (a benign hereditary and/or postural renal tubular handling disorder of Na⁺ and K⁺ in these children[4–6]). For example, the diurnal pattern of urinary sodium and potassium in normal children has not been found in enuretics, who have polyuria, natriuresis, and kaliuresis, despite normal levels of plasma atrial natriuretic peptide.[4] The other two studies showed that fractional sodium (FE_Na) and potassium (FE_K) excretions were higher in enuretic children than non-enuretics,[5] and there was a significant increase in FE_Na and FE_K in enuretics during the day and at night.[6]

Nitric oxide (NO) is synthesized from L-arginine by the enzyme nitric oxide synthase (NOS), and it serves many functions within the kidney. It participates in the mediation of arterial pressure-related changes in urine flow and Na⁺ excretion and may also influence tubular reabsorption.[7] The synthesis of NO is catalyzed by three NO synthases (i.e., endothelial, neuronal, and inducible[8]) and encoded by separate genes. Each isoform has a distinct pattern of expression in tissues.[9]

In endothelial cells, endothelial NOS (eNOS) is expressed constitutively.[8] Under certain circumstances, the basal level of NO release may be regulated by changes in the expression of eNOS.[10] Endothelial NOS is abundantly expressed in the endothelial lining of the renal arterial tree and capillaries as well as in collecting duct epithelial cells.[11] Nitric oxide, derived from neuronal NOS (nNOS) in the macula densa, is a modulator of tubuloglomerular feedback.[12],[13] The locus for nNOS is on the chromosome 12 (12q24),[9] a region recently found to be linked with enuresis.[14] Moreover, it has been suggested that a defect in the NO pathway may lead to resetting the pressure-natriuresis relation in the kidney, sodium retention, and compensatory nocturnal natriuresis.[15] Interestingly, it was recently documented that plasma total nitrite levels, a stable product of NO, were significantly lower in enuretic children.[16]

Considering the diuretic and natriuretic effects of NO and the presence of nNOS and enuresis genes in the same gene locus, it would be interesting to examine whether any of the known polymorphisms in eNOS and nNOS were associated with any clinical or laboratory findings of enuresis.

METHODS

Children were recruited for the study from among patients attending the Pediatric Nephrology and General Pediatric Outpatient Clinics of Gaziantep University. PNE was considered as the involuntary voiding of urine on at least two nights per month, beyond the age at which bladder control was normally attained in the absence of congenital or acquired defects of the urinary tract.[17] All patients and controls had a complete physical examination and tested negative for urinary protein, blood, and nitrate by dipstick and urine culture. None of the enuretics had ever been reliably dry, and none had any daytime incontinence or symptoms suggesting bladder instability. All subjects had normal blood urea nitrogen (BUN), creatinine level, and ultrasonographic findings, and were normotensive at the time of study. The presence of positive family history, frequency of enuresis per week, and clinical response to desmopressin within three months (total dryness or involuntary voiding once per month) in follow-up were noted.

Blood Samples

After informed consent had been obtained, venous blood samples were collected for biochemical analysis (BUN, creatinine, Na, K, P ) and DNA extraction.

DNA Isolation and Genotyping

Genomic DNA was extracted from whole peripheral blood samples with the salting-out method and stored at −20°C.[18] Analysis of the polymorphism of the eNOS gene was performed as described previously.[19],[20] The Glu298Asp mutation in the eNOS gene was analyzed with a polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP). Oligonucleotide primers of PCR were designed as follows: sense, 5′-AAGGCAGGAGACAGTGGATGGA-3′; antisense, 5′-CCCAGTCAATCCCTTTGGTGCTCA-3′. PCR reaction was performed in a total volume of 50 μL containing 100 ng of genomic DNA, 2.5 μL of thermophilic DNA polymerase buffer, 1.5 mM MgCl₂, 250 μM dNTPs, 0.4 μM primer, and 2.5 U of Taq polymerase (Fermentas).PCR condition was as follows: after denaturation at 94°C for 5 min, 40 cycles were performed (94°C for 1 min, 61°C annealing temperature for 1 min, 72°C for 1 min), followed by extension at 72°C for 5 min to amplify the target DNA. The amplified product was digested with 5 U restriction enzyme BanII.[19],[20] The 248 bp PCR product is cleaved into 163 bp and 85 bp fragments in the presence of the G allele at position 894, but not in the presence of the T allele. In the case of the heterozygous mutant, digestion with BanII resulted in three fragments of 248, 163, and 85 bp in size. DNA fragments were separated by electrophoresis on 3% agarose gel and visualized with ethidium bromide.

Genotyping of nNOS 3′-UTRC276T polymorphism was performed according to recent reports.[21] The region of interest, as detailed below, was amplified by the PCR in a total volume of 20 μL solution containing 100 ng genomic DNA, 100 mM Tris-HCL, 500 mM KCL, 15 mM MgCl₂, 200μM dNTPs, 20μM of each primer, and 1 U of Taq DNA polymerase for 40 cycles (94°C for 1 min, 50.5°C for 1 min, and 72°C for 1 min 30s). The primers used were: 5′ ACTCCTTGAGTTTTCCTGCTGCGA 3′ and 5′ CCATGTTCCAGTGGTTTCATGCACAC 3′. The PCR products (128 bp) were digested with Eco72I at 37°C and then electrophoresed on 3% agarose gels stained with ethidium bromide. The C allele was determined by the presence of 100 bp and 28 bp fragments, while the T allele remained uncut and presented as a 128-bp band.

Statistical Methods

Results are provided as percentages. Differences between controls and enuretics were compared by chi-square and Kruskal Wallis tests. A level of p < 0.05 was considered to be statistically significant. Statistical analysis was performed with Statistical Package for the Social Sciences for Windows (SPSS, version 10.0).

RESULTS

The eNOS gene polymorphism was determined in 171 Turkish children (57 PNE cases and 114 healthy, non-enuretic controls; eNOS genotypes could not be obtained in the other 26 PNE cases), and nNOS gene polymorphism was determined in 158 Turkish children (83 PNE cases and 75 healthy, non-enuretic controls; nNOS genotypes could not be obtained in the other 39 controls). The demographic characteristics of children are shown in Table 1. The distribution of GG, TG, and TT genotypes of eNOS gene was 48%, 33%, and 19% in PNE cases compared with 61%, 26%, and 13% in the controls. No statistically significant differences were found between groups in allele frequency and genotype distribution (see Table 2).

Table 1 The Demographic Features of Enuretics and Controls

	Enuretics (n = 83)	Controls (n = 114)	P
Mean age (mean ± SD years)	8.8 ± 2.3	9.1 ± 2.1	>0.05
Sex
Female	28	46	>0.05
Male	55	68	>0.05
Enuretic relatives
Present	61	26	< 0.05
Absent	22	88
Frequency of bedwetting per week (mean ± SD)	5.9 ± 2.7	—
Response to desmopressin (%)	51.2	—

Table 2 Endothelial Nitric Oxide Synthase (NOS) Gene Polymorphism in Turkish Children with Primary Nocturnal Enuresis

	Endothelial NOS genotypes (%)
	GG	TG	TT
Enuretic children (n = 57)	48	33	19
Controls (n = 114)	61	26	13
p	>0.05	>0.05	>0.05

The distribution of CC, TC, and TT genotypes for nNOS gene was 31%, 29%, and 40% in PNE cases compared with 10%, 43%, and 47% in the controls (see Table 3). CC genotype was found higher in enuretic children (p = 0.002). No statistically significant differences were found between groups in other genotype distribution.

Table 3 Neuronal Nitric Oxide Synthase Gene Polymorphism (NOS) in Turkish Children with Primary Nocturnal Enuresis

	Neuronal NOS genotypes (%)
	CC	TC	TT
Enuretic children (n = 83)	31	29	40
Controls (n = 75)	10	43	47
p	0.002	>0.05	>0.05

The eNOS and nNOS gene polymorphisms were not associated with positive family history, frequency of enuresis per week, and clinical response to desmopressin (p > 0.05).

DISCUSSION

Recent studies indicated some differences in urinary electrolytes in enuretic children and stressed the possible existence of a renal tubular maturation defect (a benign hereditary and/or postural renal tubular handling disorder of Na⁺ and K⁺) in these children.[4–6]

In vitro studies suggested that renal NO production was derived from endothelial cells, as well as smooth muscle cells, mesangial cells, and tubular epithelial cells.[7] NO is an important mediator of renal blood flow, and regional microcirculation may be mediated by endogenously produced NO.[7] NO increases renal blood flow, urine flow, and Na⁺ excretion,[7] and might also exert a direct effect on collecting duct reabsorption.[22] Therefore, intrarenal NO serves as a major regulator of renal sodium and water excretion like an endogenous diuretic.[8],[23],[24]

It has been indicated that both nNOS and eNOS produce NO in the kidney. eNOS is the predominant isoform involved in the regulation of renal blood flow under basal conditions, and nNOS produces a significant amount of NO normally found in the renal interstitial space.[25] Macula densa cells express nNOS.[12],[13] These cells are special cells in the kidney that sense the chloride concentration in the tubular fluid. When luminal NaCl^- concentration increases in macula densa cells via the Na⁺/K⁺/2CL⁻ co-transporter, afferent arterioles constrict via adenosine, angiotensin II, or superoxide anion.[26]

Considering the diuretic and natriuretic effects of NO and the presence of nNOS and enuresis genes in the same gene locus, it would be interesting to examine whether any of the known polymorphisms in eNOS and nNOS were associated with any clinical or laboratory findings of enuresis.

However, in the current study, no associations between these polymorphisms and clinical-laboratory findings of enuresis were detected. The only positive finding was that the CC genotype was higher in enuretic children. In a previous study,[16] significantly lower plasma total nitrite levels in enuretic children were found. As the plasma total nitrite levels could not be determined and a relationship between the levels of those and the genotypes of these NOS isoforms investigated, it cannot be suggested that the children with CC genotype have lower total nitrite levels by this study.

Additionally, the other three limitations of the present study should be discussed. First, several studies have described eNOS genotype distributions that are different in healthy individuals with various ethnic backgrounds.[27],[28] Second, the total sample size involved in statistical testing is also important for detecting genotype-disease associations,[29] and third, there is no way of knowing how many of those children have the same enuresis gene (12q24) in the nNOS group .

Despite these limitations, this study is the first to search the eNOS and nNOS gene polymorphisms in children with PNE. It can be concluded that the eNOS gene polymorphism may not be associated with PNE in children, while the nNOS gene polymorphism, predominantly the CC genotype, may be associated with PNE in Turkish children. Further studies with larger samples together with the detection of enuresis gene may help determine the exact role of nNOS gene polymorphism in enuresis.