Renin-Angiotensin System Polymorphisms: A Risk Factor for Progression to End-Stage Renal Disease in Vesicoureteral Reflux Patients

Abstract

Aim. Renin-angiotensin system (RAS) gene mutations have been implicated as a risk factor for the presence and progression of renal disease in vesicoureteral reflux (VUR). However, the results are contradictory, and the effects of RAS polymorphisms in VUR patients with end-stage renal disease (ESRD) have not been defined yet. This study was designed to evaluate the angiotensin-converting enzyme insertion/deletion (ACE-I/D), angiotensinogen (AGT) M235T, and angiotensin II receptor type 1 (ATR1) A1166C and type 2 (ATR2) C3123A gene polymorphisms as risk factors for progression to ESRD in patients with VUR. Methods. ACE-I/D, AGT-M235T, ATR1-A1166C, and ATR2-C3123A were identified in 161 ESRD patients (52 female, 109 male; 77 renal transplant, 84 dialysis; age: 34.4 ± 11.2 years). VUR was the ESRD etiology in 40 patients. Genetic polymorphisms of the ACE gene I/D, AGT gene M235T, ATR1 gene A1166C, and ATR2 gene C3123A were identified in all of the patients. Results. We detected no linkage between genetic polymorphisms of ATR1-, ATR2-, AGT-, and VUR-related ESRD. When ACE gene was considered, VUR(+) patients had 63.6% DD, 36.4% ID, and no II alleles, whereas VUR(−) patients had 48.6% DD, 43.2% ID, and 8.1% II alleles. Conclusion. A striking feature of VUR-related ESRD patients was the absence of II alleles, so the DD genotype may be accepted as a genetic susceptibility factor for progression to ESRD in VUR patients.

Keywords:

• angiotensin-converting enzyme
• renin angiotensin system
• polymorphism
• vesicoureteral reflux
• chronic renal failure

INTRODUCTION

Vesico-ureteric reflux (VUR) is a common lower urinary tract malformation defined as the incompleteness of the junction between the ureter and bladder. Therefore, urine flows in a retrograde fashion from the bladder into the ureter, pelvis, and medullary collecting ducts of the kidney, and may lead to recurrent urinary tract infections, tubulointerstitial renal disease, and progressive renal scarring.[1] Several polymorphisms of the genes encoding the renin-angiotensin system (RAS) have been studied in the pathogenesis of this malformation, especially the AT2 polymorphism.[1],[2] ATR1 A1166C and ATR2 C3123A have been found to be related with primary VUR; in addition, ATR2 C3123A and AGT M235T polymorphisms have been strongly related with increased risk for the development of chronic renal failure in the general population.[3–5] A deletion (D) or insertion (I) of a 287-base pair (bp) fragment at intron 16 of the ACE gene has been shown to be involved in the modulation of circulating and tissue ACE activity.[6] The DD homozygotes are reported as having four-fold higher circulating and tissue ACE levels than DI heterozygotes or II homozygotes.[3]

Several studies about the ACE I/D gene polymorphisms in VUR patients have revealed that the D allele might be a risk factor for renal parenchymal damage in children.[7–9] Also, the DD genotype has been reported to be associated with reduced renal function in patients with chronic renal diseases like Ig A nephropathy,[10–12] focal segmental glomerulosclerosis,[13],[14] diabetic nephropathy,[15],[16] polycystic kidney disease,[17] and tubulointerstitial nephritis.[18] Because tubulointerstitial damage is also common in VUR, the ACE polymorphism is of interest in this patient group, as it may give clues about the progression of the renal scarring. However, the results of current studies are contradictory.[3],[4],[19],[20] Also, the risk of progression to ESRD in the case of the ACE polymorphism has not been defined in adult VUR patients.

This study was designed to evaluate the ACE gene I/D, AGT gene M235T, ATR1 gene A1166C, and ATR2 gene C3123A polymorphisms as possible risk factors for progression to ESRD in adult VUR patients.

METHODS

We included 161 ESRD patients (52 female, 109 male; 77 renal transplants, 84 dialysis patients; mean age, 34.4 ± 11.2 years) in this study. Age, gender, and end stage renal failure etiology were retrieved from the records. Forty patients had a diagnosis of VUR according to the examination of their voiding cystourethrograms. Type (unilateral, bilateral) and degree (grade 1–4) of VUR was determined in each patient's voiding cystourethrogram. Genetic polymorphisms of the ACE gene I/D, AGT gene M235T, ATR1 gene A1166C, and ATR2 gene C3123A were identified in all of the patients.

Determination of the RAS Gene Polymorphisms

Genotyping was performed for the ACE gene I/D, AGT gene M235T, ATR1 gene A1166C, and ATR2 gene C3123A polymorphisms. Each patient or patient's family filled out the consent forms, and then venous blood samples anticoagulated with ethylenediaminetetraacetic acid were collected. Genomic DNA was prepared from leukocyte pellets by sodium dodecyl sulphate lysis, ammonium acetate extraction, and ethanol precipitation. The DNA was used as a template for gene polymorphism analysis. All amplifications were performed using polymerase chain reaction (PCR) sequence-specific primers and appropriate restriction enzymes that have been described elsewhere.[21] The RAS genotyping primers and PCR cycling conditions are given in Table 1.

Table 1 Primers of RAS genotyping and PCR cycling conditions

Genetic variant	Sequences	PCR cycling conditions
ACE I/D
Sense	5′CTGGAGACCACTCCCATCCTTTCT3′	30 × (94°C 60 sec, 62°C 45 sec, 72°C 60 sec)
Anti-sense	5′GATGTGGCCATCACATTCGTCAGAT3′
AGT M235T
Sense	5′CCGTTTGTGCAGGGCCTGGCTCTCT3′	30 × (94°C 30 sec, 68°C 60 sec, 72°C 30 sec)
Anti-sense	5′CAGGGTGCTGTCCACACTGGACCCC3′
ATR1 A1166C
Sense	5′AGAAGCCTGCACCATGTTTTGAG3′	30 × (94°C 60 sec, 57°C 30 sec, 72°C 30 sec)
Anti-sense	5′CCTGTTGCTCCTCTAACGATTTA3′
ATR2 C3123A
Sense	5′GGATTCAGATTTCTCTTTGAA3′	30 × (94°C 45 sec, 53°C 60 sec, 72°C 60 sec)
Anti-sense	5′GCATAGGAGTATGATTTAATC3′

Briefly, for genotyping of ACE I/D, the PCR products after amplification were separated by electrophoresis on a 2% agarose gel and identified by ethidium bromide staining. The products were 190 base pair (bp) and 490 bp for I and D alleles, respectively. Thus, each DNA sample revealed one of the three possible patterns at the end of electrophoresis as a 190 bp band (genotype DD), a 490 bp band (genotype 2), or both 190 and 490 bp bands (genotype ID).[21] To analyze the AGT M235T polymorphism, the Tth111 digested PCR products were separated by electrophoresis on a 2.5% agarose gel. The ethidium-bromide-stained gel showed a nondigested band of 165 bp for the T allele. In the presence of the C allele, the PCR product (165 bp) was cut into two fragments of 141 bp and 24 bp.[21] For analysis of the ATR1 A1166C polymorphism, a 410 bp PCR product was digested with DdeI enzyme. The 1166A allele lacks of the DdeI site. However, the 1166C variant has two bands corresponding to both 292 bp and 118 bp. A 321 bp PCR product was cut with AluI for the ATR2 C3123A polymorphism. The uncut product (321 bp) shows the presence of the C allele. If the PCR product was cut into two fragments as 217 bp and 107 bp, it reveals the A allele.

Statistical Analysis

SPSS software (Statistical Package for the Social Sciences, version 10.0, SSPS Inc, Chicago, Illinois, USA) was used for all analyses. Differences in frequency distribution for each polymorphism between VUR-related ESRD patients and other ESRD patients were compared by the chi-square test. Descriptive statistics were used. Data are expressed as means ± SD or percentages of frequency. Values for p less than 0.05 were considered statistically significant.

RESULTS

Mean age of the VUR patients was 30.3 ± 10.2 years. The other patients' mean age was 30.9 ± 9.1 years. VUR was unilateral in 31% and bilateral in 69% of the patients. VUR degrees were as follows: 10% (grade 1), 22.5% (grade 2), 45% (grade 3), and 22.5% (grade 4).

Distribution of ESRD etiologies and renin-angiotensin genes in all of the ESRD patients are summarized in Tables 2 and 3. D allele frequency was 0.66 and I allele was 0.34 in our 161 ESRD patients.

Table 2 Distribution of ESRD etiologies in our patient group

ESRD etiology	n	%
Unknown	15	9.3
Glomerulonephritis	26	16.2
Alport syndrome	10	6.2
VUR	40	24.9
Hypertension	35	21.8
Amyloidosis	11	6.8
Nephrolithiasis	16	9.9
Diabetes mellitus	8	4.9
Total	161	100.0

Table 3 Distribution of ACE, AT1, AT2, and AGT genes in ESRD patients

Gene	%	Gene	%
AT1		AGT
AA	66.3	MM	1
AC	33.7	MT	60.2
CC	0	TT	38.8
AT2		ACE
AA	14.2	DD	51.5
AC	22.9	ID	41.2
CC	62.9	II	7.3

We observed no relationship between ACE, AT-I, AT-II, and AGT genes and VUR degree (p > 0.05). We also detected no linkage of genetic polymorphisms of ACE, AT-I, AT-II, and AGT with unilateral or bilateral involvement (p > 0.05). No specific allele preponderance in VUR (+) patients was found after the analysis of AT1, AT2, and AGT genes. However, analysis of the ACE gene revealed that VUR(+) patients had 63.6% DD, 36.4% ID, and no II alleles, whereas VUR(−) patients had 48.6% DD, 43.2% ID, and 8.1% II alleles (see Table 4). When the distribution of ACE genes was compared within ESRD etiologies, the DD percentage was the highest (65.2%) in VUR patients. Besides, ID allele presence was 34.8%, whereas no II allele was present in VUR patients.

Table 4 Distribution of ACE, AT1, AT2, and AGT in VUR patients

	VUR (+) (%)	VUR (−) (%)
AT1
AA	70.8	66.3
AC	29.2	33.8
CC	0	0
AT2
AA	21.5	11.7
AC	21.4	23.4
CC	57.1	64.9
AGT
MM	0	1.3
MT	72	56.4
TT	28	42.3
ACE
DD	63.6	48.6
ID	36.4	43.2
II	0	8.1

DISCUSSION

Reflux nephropathy accounts 18.1% among the causes of renal failure among children in Turkey.[22] Its incidence was reported as 25% of children and young adults with chronic renal failure in the world.[23] Increased incidence of VUR with family history suggests a genetic basis for the disease.

The renin-angiotensin system is involved not only in embryologic development but also in the regulation of glomerular hemodynamic and sclerotic processes. Deterioration of renal function and development of ESRD have been found to be related to renin-angiotensin system polymorphisms in several studies independent of underlying renal disease.[5],[21],[25] Insertion/deletion polymorphism of the ACE gene occurs in chromosome 16, leading to three genotypes known as DD, DI, and II. DD homozygosity is associated with higher levels of plasma and tissue ACE activity that may facilitate extracellular matrix formation, glomerular sclerosis, and interstitial fibrosis leading to renal scarring.[4],[5],[21] Additionally, high levels of ACE causes AT2 formation, which is important in renal development and pathophysiology due to its hemodynamic, growth, and sclerotic effects.[24] AT2 expression should lead to the apoptosis of undifferentiated mesenchymal cells surrounding the ureter. Therefore, conditions related with AT2 expression abnormality prevent the interaction between the ureteric bud and metanephric blastema and impair the normal development of the nephron and ureter, which further leads to development of congenital anomalies of kidney and urinary tract including VUR.

One study analyzing 822 patients with a variety of renal diseases revealed that DD homozygote patients had a faster decline of renal function, whereas those with II homozygotes had better renal survival.[26] Another study emphasized the fact that mainly ACE and probably AGT were responsible for development of ESRD.[5] D allele has been reported to be related to faster progression to ESRD in the total population.[21] Analysis of our subjects produced results similar to previous studies when the ACE polymorphism was considered. The D allele was predominant in our ESRD patients (66%). This percentage seems to be higher than those reported in healthy Caucasian controls (DD: 24%)[8] and healthy Turkish controls (DD: 34%).[27] However, D allele frequency of our patients (66%) is in accord with the previous reports, giving the overall D (66.6%) and I (33.3%) allele frequencies in Turkish ESRD patients.[28]

Distribution of the renin-angiotensin system polymorphism in children with VUR is well-studied, and its effect on renal scarring is of interest.[2–4],[8],[20] However, reports about this subject are contradictory. Generally, the ACE polymorphism is the most commonly studied and accepted genetic effect in VUR. The D allele is blamed for progression of renal scarring in VUR patients in childhood. When our ESRD patients were evaluated, only the D allele of the ACE gene was found to be strongly associated with VUR positivity. When the ACE gene distribution was evaluated in light of ESRD etiologies, the percentage of DD predominance was the highest in VUR patients (63.6%). We thought D allele predominancy was a strong risk factor for VUR independent from ESRD presence. There was no class 2 homozygosity in our VUR-positive patients. Our results support the study by Hohenfeller et al., who demonstrated that in the patients with VUR, ACE polymorphism strongly predicts renal damage. They reported that VUR patients with II genotype has 0% risk of renal damage, ID has 32%, and in DD risk increases up to 68%.[8]

The contribution of other renin-angiotensin system genes (AT1, AT2, AGT) to VUR development and ESRD progression is not clear.[21] Generally, AT1 was not found to be related with a faster decline in renal function, and AT2 and AGT were linked to progression of specific underlying renal diseases like diabetes mellitus (21). In several studies, the C allele of the AT1 gene and predominance of the TT genotype in AGT were supposed to be associated with a faster decline of renal function.[5],[21],[26] We did not find any difference among the distribution of AT1, AT2, AGT genes between VUR (+) and VUR (−) ESRD patients.

We also did not find any effect of ACE, AT1, AT2, or AGT polymorphisms on VUR degree and unilateral/bilateral involvement. Our study confirms previous studies that failed to find a relationship between renin-angiotensin genes and VUR degree and unilateral/bilateral involvement.[3],[4]

To our knowledge, this is the first study evaluating the influence of genetic factors on VUR-related ESRD in adult patients. High DD and no II genotype frequencies of the ACE gene were striking features of our VUR-related ESRD patients. Therefore, susceptibility for ESRD and faster progression to ESRD in VUR may be linked with the presence of the D allele.

DECLARATION OF INTEREST

The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.