Rare occurrence of Mycoplasma pneumoniae infection among Jordanian adults with respiratory tract infections

Abstract

A prospective study using both polymerase chain reaction (PCR) and culture demonstrated the absence of Mycoplasma pneumoniae in the throats of 100 Jordanian adult patients with respiratory tract infections and 100 healthy controls over a period of 8 months (2003–2004). However, a retrospective study covering a period of 24 months (2003–2005) indicated that M. pneumoniae serological tests were only positive in 1/15 (7.1%) of adults and 4/29 (13.8%) of children among suspected infected patients. These results suggest that M. pneumoniae infection occurs rarely in Jordanian adults and may be attributed to the prevalence of dry weather for most of the year in Jordan.

• Mycoplasma pneumoniae
• polymerase chain reaction
• respiratory tract infections
• Jordan

Introduction

Mycoplasma pneumoniae is a common cause of both endemic and epidemic respiratory tract infections among children and young adults, but the actual incidence of M. pneumoniae respiratory infections in adults is still not well established and rarely reported in developing countries [1–3]. Also, M. pneumoniae respiratory infection varies among distinct geographical areas, and seasonal environmental variations may influence the incidence of this fastidious organism as cause of respiratory diseases [3–5].

Recently, the polymerase chain reaction (PCR) has been used in the diagnosis of M. pneumoniae, and it has proved to be a rapid, sensitive and highly specific method which is superior to other conventional serological and cultural methods in the detection of M. pneumoniae [6–10].

This study investigated the presence of M. pneumoniae in adult Jordanian patients suffering from respiratory tract infections and in healthy adult controls using PCR, culture methods and serological tests.

Patients and materials

Patients

Over the period November 2003 to June 2004, a total of 100 adult patients (mean age 43±4.7 years) with clinical features of respiratory tract infection and 100 healthy controls (mean age 37±5.3 years), without apparent signs of respiratory tract infections, were included in this study. One of the investigators (N.M.O.), a pulmonary consultant physician with his physician assistants at the Jordan University Hospital (JUH) examined the patients and the control persons who agreed to patricipate in the study. A questionaire was completed, including information on patient characteristics, time of illness onset, clinical signs and symptoms and antibiotic treatment, as well as the presence of asthma and chronic obstructive pulmonary disease (COPD). The clinical and epidemiological features of the patients are shown in Table I.

Table I.  Clinical and epidemiological features of the 100 patients with respiratory tract infections.

Parameter	Value
Age (years) mean±SD	43±4.7
Sex
Males	46
Females	54
Type of patient
Inpatient	30
Outpatient	70
Site of infection
Upper respiratory tract	65
Lower respiratory tract	35
Signs and symptoms
Cough	95
Fever (>37°C)	65
Non-productive sputum	75
Headache	55
Chest pain	65
Runny nose	30
Wheezing	28
Chills	33
Sore throat	42
Use of antibiotics
Yes	55
No	45
Associated respiratory diseases
Chronic obstructive pulmonary disease (COPD)	22
Asthma	32

Cotton- tipped throat swabs were collected from each patient and control and these were immediately placed in 2 ml of transport medium (tripticase soy broth, 10% yeast extract, 0.5% bovine serum albumin, 0.25% glucose, 1000 U/ml pencillin G and 4 µg/ml vancomycin). The throat swabs were then divided into two portions, 500 µl for PCR, and the remaining amount for culture. The specimens were processed immediately.

PCR investigation

The 500 µl of the throat swab aliquots were concentrated by centrifugation at 12 000 g for 15 min at room temperature. The supernatant was removed and then 80 µl of nuclease-free water (Promiga, USA) were added to the pellet. The samples were then vortexed, mixed and heated at 95°C for 15 min; 5 µl of this aliqout was used directly for PCR. PCR for the repetitive elements in the P1 gene of M. pneumoniae was performed according to Waring et al. [11] with slight modifications. Briefly, a total reaction volume of 25 µl was used for PCR with the following components: 1 µM each primer (MP F primer (5' CCCTCGACAAAGCCAACCTC 3'), MP R primer (5' TGCGCGTTGTTCTTGTTGGTG 3') Alpha DNA, USA), each dNTP at a final concentration of 200 µM (Promiga), 2 µM MgCl₂ (Promiga) and 2.5 U of Taq DNA polymerase in appropriate buffer (Promiga). Thermocycling conditions consisted of an initial incubation at 95°C for 9 min followed by 40 cycles of 94°C for 30 s, 62°C for 30 s and 72°C for 30 s. An additional incubation at 72°C for 7 min was added to complete the elongation. Reference M. pneumoniae DNA (Max von Pettenkofer Institute, University of Munich, Germany) was used as a positive control. Negative controls comprised all of the ingredients with distilled water instead of the templates. The amplified products were then detected using 2% agarose gel electrophoresis and visualized by UVP system (USA) for the presence of 309–345 bp DNA segments. All the reagents and conditions were optimized for the PCR assay.

Culture investigation

Culture of M. pneumoniae was accomplished using Mycoplasma pneumoniae medium (Oxoid, UK) by adding 300 µl of the throat swab aliquots to 5 ml of M. pneumoniae selective broth composed of M. pneumoniae broth base + selective supplements comprising horse serum, yeast extract (25% w/v), 0.008 g thallium acetate, 0.3 g glucose, 0.0012 g phenol red, 0.0003 g methylene blue chloride and 12.000 U pencillin G (Oxoid). The specimens were then incubated at 37°C for up to 4 weeks and examined three times weekly for the presence of a colour change. Upon colour change, 50 µl of the broth was subcultured on M. pneumoniae selective agar (Oxoid). The agar plates were incubated at 37°C in 5% CO₂ for 1 week. The plates were examined twice weekly for the presence of typical M. pneumoniae ‘fried egg’ colonies on which culture-enhanced PCR would be performed for definitive identification of M. pneumoniae.

Mycoplasma serological tests

A retrospective analysis of all serological diagnoses of M. pneumoniae infections at the Immunology Laboratory/JUH was performed. A total of 44 patients sera was investigated over the period November 2003 to November 2005. Both cold agglutinins test and ELISA for specific anti-mycoplasma antibodies of IgM-IgG-IgA (Viro-Immun Labor-Diagnostiks GMbH, Germany) were used.

Results and discussion

The majority of the patients suffered from acute upper respiratory tract infections (65%), and their most common symptoms were cough (95%), non-productive sputum (75%), fever (65%) and chest pain (65%). PCR tests revealed that M. pneumoniae was not detected in any of the 200 throat swab specimens collected from the patients and controls. The same negative result was also obtained using M. pneumoniae selective culture. Also, a retrospective study investigated the results of serological tests among patients suspected to have M. pneumoniae infection at the JUH, over a period of 2 years (2003–2005), showed that only 1/12 (7.1%) of adults and 4/29 (13.8%) of children were positive for specific anti-mycoplasma antibodies as confirmed by ELISA test (Table II).

Table II.  Results of serological detection of Mycoplasma pneumoniae among Jordanian patients admitted to the Jordan University Hospital during the period November 2003–November 2005.

Age group	No. (%) of patients examined	No. (%) positive for M. pneumoniae	No. (%) negative for M. pneumoniae
Children	29 (66)	4 (13.8)	25 (86.2)
Adults	15 (34)	1 (7.1)	14 (92.9)
Total number (%)	44 (100)	5 (11.4)	39 (88.6)

The overall results predicted that M. pneumoniae was not common in either adult patients with respiratory tract infections or healthy controls in Jordan during the investigated period (2003–2005). This result is generally in agreement with other studies which have reported that the prevalence of M. pneumoniae is low (<2%) or absent, particularly during the inter-epidemic periods of M. pneumoniae infections [4], [5]. Failure to detect M. pneumoniae in Jordanian adults by PCR could be attributed to several factors such as geographical and seasonal variations and the prevalence of a dry climate for most of the year in Jordan, as M. pneumoniae infections were more commonly recognized in temperate zones and moist regions [3–5], [12]. Another reason may be attributed to the fact that M. pneumoniae infections usually tend to occur as outbreaks every 4–7 years [4], [5]. In addition, M. pneumoniae infection is more common in children than adults; the highest incidence is seen in children aged < 16 years and most of these infections are mild and non-pneumonic [3], [12–14].

In conclusion, both prospective and retrospective studies using PCR and serological tests showed that M. pneumoniae infection occurs rarely in Jordanian patients and controls, particularly among adults. Large-scale population studies over many years should be performed in the future to monitor the actual incidence and significance of M. pneumoniae infection in dry weather regions.

We thank Dr Soern Schubert, Max von Pettenkofer-Institute, Munich, Germany, for sending control DNA of M. pneumoniae. Also, we are thankful for our colleagues in the Immunology Laboratory/JUH and the financial support of the Faculty of Higher Education, University of Jordan, Amman, Jordan.