Salidroside protects retinal endothelial cells against hydrogen peroxide-induced injury via modulating oxidative status and apoptosis

Abstract

Oxidative stress can cause injury in retinal endothelial cells. Salidroside is a strong antioxidative and cytoprotective supplement in Chinese traditional medicine. In this study, we investigated the effects of salidroside on H₂O₂-induced primary retinal endothelial cells injury. Salidroside decreased H₂O₂-induced cell death, and efficiently suppressed cellular ROS production, malondialdehyde generation, and cell apoptosis induced by H₂O₂ treatment. Salidroside induced the intracellular mRNA expression, protein expression, and enzymatic activities of catalase and Mn-SOD and increased the ratio of Bcl2/Bax. Our results demonstrated that salidroside protected retinal endothelial cells against oxidative injury through increasing the Bcl2/Bax signaling pathway and activation of endogenous antioxidant enzymes. This finding presents salidroside as an attractive agent with potential to attenuate retinopathic diseases.

Salidroside protected primary-cultured retinal endothelial cells against H₂O₂-induced apoptosis and oxidation.

Key words:

• salidroside
• hydrogen peroxide
• retinal endothelial cells
• apoptosis
• oxidative stress

Introduction

The generation of molecular oxygen in the form of ROS is a natural part of aerobic life that is responsible for the manifestation of cellular functions ranging from signal transduction pathways, defense against invading microorganisms, and gene expression to the promotion of growth or death.¹⁾ Nevertheless, an excessive amount of ROS is highly toxic to cells. Cells contain numerous antioxidant defenses to minimize fluctuations in ROS; however, ROS generation often exceeds the cell’s defense capacity, resulting in a condition termed oxidative stress.²⁾ Oxidative stress affects the major cellular components: proteins, lipids, and DNA. The importance of oxidative stress is commonly emphasized in the pathogenesis of various degenerative diseases, such as diabetes, cancer, cardiovascular disorders, or neurodegenerative diseases.³⁾ Therefore, the development of an effective antioxidant strategy to reduce oxidative stress, which has attracted considerable interest from investigators, may provide insights into delaying or preventing cell necrosis and apoptosis-induced oxidative stress.⁴⁾

Salidroside is a phenylpropanoid glycoside (Fig. 1), which is extracted from Rhodiola rosea L, a popular medicinal plant that grows in regions of high altitude such as Tibet.⁵⁾ Salidroside is known as an medicinal supplement, which could possibly help the body adapt to stress, treat altitude sickness, fatigue, and depression.⁶⁾ In addition, salidroside has been shown to protect against tissues damage and dysfunction induced by excess oxidative stress.^6–9)

Fig. 1. Chemical structure of salidroside.

ROS can cause damages to the RECs.¹⁰⁾ It is generally believed that oxidative stress directly activates a cascade of biochemical and molecular events, including polyol flow and the hexosamine pathway, advanced glycation end products and their receptor, pro-inflammatory factors, and protein kinase C signaling, which lead to retinal vascular endothelial cell injury.¹¹⁾ Despite being not a free radical by itself, hydrogen peroxide (H₂O₂), a main source of ROS, can alter the intracellular redox state of cells, inducing oxidative damage by its conversion into a highly reactive hydroxyl radical, . H₂O₂ stimulation has been extensively used to furnish a cell culture model of oxidative stress for studying the biological and pathological processes. In addition, the level of H₂O₂ and in mitochondria is elevated during the pathogenesis of diabetic retinopathy.^12–14) However, the mechanism of action of salidroside on H₂O₂-induced RECs injury remains unclear. In this study, the primary-cultured RECs were challenged by H₂O₂ to study the potential mechanisms of salidroside-mediated actions in blunting redox injury. Our results indicated salidroside significantly inhibits H₂O₂-induced apoptosis and ROS production in RECs.

Materials and methods

Reagents

Salidroside (purity ≥ 98%) was from Yuanye Biotech CO. LTD (Shanghai, China); Cell proliferation reagents including WST-1 and TUNEL were from Roche (Roche Applied Science, Indianapolis, IN, USA); TRIzol^® Reagent and DNaseI were from Invitrogen (Carlsbad, CA, USA); dNTP was from Takara Bio Inc (Shiga, Japan); iQ^TM SYBR^® Green Supermix from Bio-Rad Laboratories, Inc. (Hercules, CA, USA); Oligo (dT) 15 primer and SuperScript^TM II reverse transcriptase were from Promega; Kits for MDA content detection, activity assays of catalase and Mn-SOD were from Nanjing Jiancheng Bioengineering Institute (Nanjing, China); Caspase-3, Bcl-2, Bax, Mn-SOD, catalase, and β-actin antibodies (species cross-reactivity: Human, Mouse and Rat) were from Cell Signaling Technologies (Beverly, MA, USA); PECAM-1 and vWF antibodies were from Santa Cruz Biotechnology, Inc. (USA); Dynabeads coated with IgG (5 × 10⁸ beads/ml) was from Miltenyi Biotec (Bergisch Gladbach, Germany); All pairs of real-time PCR primers were synthesized by Shenggong Biotechnology (Shanghai, China). This study was approved by the Ethics Review Committee of Sichuan University and was in adherence to the tenets of the Declaration of Helsinki.

Isolation and treatment of primary-cultured retinal endothelial cells

Three-week-old male Sprague–Dawley (SD) rats were obtained from the Institute of Laboratory Animal Sciences, West China School of Medicine of Sichuan University. Primary RECs were isolated from SD rats and cultured as previously described.^15,16) Briefly, eyes were enucleated and hemisected, and the retinas were removed under a dissecting microscope, placed in HBSS containing penicillin/streptomycin (Sigma, St. Louis, MO) and rinsed. Twelve retinas were digested with 0.5% collagenase type I (Worthington, Lakewood, NJ) in serum-free DMEM, for 40–45 min at 37 °C. Then, endothelial cell medium containing 1% ECM (ScienCell Research Laboratories, San Diego, CA), which contained 5% fetal bovine serum, 100 mg/mL streptomycin, and 100 U/mL penicillin, was added. After filtering through 70 and 40-μm nylon mesh (Becton, Dickinson and Company, USA), the collected retinal cells were resuspended in ECM and incubated with goat anti-mouse magnetic beads pre-coated with mouse anti-rat PECAM-1. Then, the beads bound cells were washed with HBSS for at least 6 times. After the addition of ECM, the cell suspension was seeded on 6-well plates pre-coated with human fibronectin (Prospecbio, Israel). The identity of REC was confirmed by a positive immunofluorescence staining of vWF antibody. The cells were refreshed every 2 days, and passage 2–4 of RECs was used for all experiments. Cells were treated with either 300 μmol/L H₂O₂ (dissolved in normal saline) for 4 h, with or without pre-incubation of 200 μmol/L salidroside (dissolved in normal saline) for 12 h. The concentrations of H₂O₂ and salidroside were determined in the pilot studies, the incubation periods were decided according to the previously reported method.

Measurement of cell viability

The WST assay was used to detect cell viability as described previously.¹⁷⁾ In brief, RECs were incubated with 10 μL of reconstituted WST-1 mixture for 1 h at 37 °C, and the values of absorption were measured at 440 nm (background at 630 nm was subtracted) by use of a synergy^TM Multi-mode Microplate reader (Biotek, VT, USA). All experiments were performed in triplicates. Cell viabilities were presented as percentage of the controls.

Measurement of intracellular ROS

The level of intracellular ROS was quantified using a ROS assay kit. DCFH-DA, a fluorescent probe, is oxidized by ROS in viable cells to 2′,7′-dichlorofluorescein (DCF). Following treatment with H₂O₂ alone or H₂O₂ and salidroside, RECs were incubated with 10 μM H₂DCFDA (Invitrogen) for 30 min at 37 °C. The intracellular fluorescence intensity was immediately recorded on a synergy^TM Multi-mode Microplate reader (Biotek).

MDA and SOD analysis

RECs were lyzed with the help of an ultrasonic device. The protein concentration of the lysate was measured by a BCA protein assay kit (Shanghai Generay Biotech Co., Ltd). The MDA content, activities of catalase, and Mn-SOD were detected following the reagent manufacturers’ instructions. Both Mn-SOD and catalase activities were expressed as units per milligram protein, and MDA content was expressed as nmol per milligram protein, respectively.

Evaluation of cell apoptosis by TUNEL staining

Apoptosis of RECs fixed by acetone was determined by the TUNEL method (Roche Applied Scientific, IN, USA) following reagent manufacturers’ instructions. High-power fields (12–20 at ×400 magnification) were obtained to measure the number of TUNEL-positive nuclei, respectively. Only nuclei that were clearly purplish red were scored. The percentage of TUNEL-positive cells was calculated as the ratio between TUNEL-positive and DAPI (Roche, Germany)-stained nuclei × 100.

Evaluation of cell apoptosis and necrosis by AV-FITC and PI staining

Apoptosis and necrosis were further detected by use of an annexin-V (AV)–fluorescein isothiocyanate (FITC)/propidium iodide (PI) stain detection kit (KeyGen Biotech, Nanjing, China). In brief, RECs incubated in 96-well plates were incubated with AV-FITC and PI for 10 min at room temperature in the dark. Cells were photographed under both phase-contrast and fluorescence microscopy, and total cells were counted. Apoptotic cells were identified as AV-FITC positive and PI negative (FITC+PI−, green-stained cells), and necrotic cells as positive for PI (PI+, red-stained cells). About 200–300 randomly selected cells in each group were counted by an independent investigator who did not know the treatment. Each experiment was conducted in triplicate, and data were averaged.

Quantitative real-time PCR assay

Total RNA was extracted from retinal endothelial cells using Trizol reagent (Invitrogen). We performed real-time quantitative PCR analysis as previously described¹⁸⁾ (primers in Table 1). The expressions of GAPDH were used as endogenous reference in normalizing the relative expression of other genes.

Table 1. Sequences of the primers used for real-time PCR amplification.

Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)	Size (bp)
Catalase	TTGACAGAGAGCGGATTCCT	GGCATCCCTGATGAAGAAAA	174
Mn-SOD	CACTGTGGCTGAGCTGTTGT	TCCAAGCAATTCAAGCCTCT	284
GAPDH	TGCCACTCAGAAGACTGTGG	GTCCTCAGTGTAGCCAGGA	233

Western blot analysis

Western blot was performed following the method we previously used.¹⁷⁾ RECs were lyzed with RIPA buffer at 4 °C. The supernatant was collected, and the protein concentration was determined using a BCA protein assay kit (Shanghai Generay Biotech Co., Ltd). Equal amounts of protein were loaded onto 12% sodium dodecyl sulfate-polyacrylamide gels for electrophoresis (SDS-PAGE) and transferred onto 0.22-μm PVDF membrane. The membranes were probed with antibodies against caspase-3, catalase, Mn-SOD, Bcl-2, Bax, and β-actin, respectively. Following washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody. Proteins were detected using an enhanced chemiluminescence (ECL) system (EMD Millipore, MA, USA). All experiments were repeated three times.

Statistical analysis

Results were shown as mean ± SD. Statistical analyses between groups of two were done by unpaired t-test. Groups of three or more were analyzed by use of one-way ANOVA, followed by the Newman–Keuls multiple comparison test. A p-value <0.05 was considered statistically significant.

Results

Salidroside alleviated H₂O₂-induced primary-cultured RECs damage

The WST cell viability assay has been shown to be a sensitive and accurate method for cytotoxicity.¹⁹⁾ WST assay revealed the dose-dependent cytotoxicity of H₂O₂ (0–700 μmol/L) on primary-cultured RECs (Fig. 2(A)). Compared to the controls, stimulation with 300 μmol/L H₂O₂ for 4 h resulted in 25% loss of cell viability (p < 0.01); therefore, exposure to 300 μmol/L H₂O₂ for 4 h was used in the subsequent experiments to induce cell insults.

Fig. 2. Salidroside protected primary-cultured RECs against H₂O₂-induced apoptosis.

Notes: (A) After incubation with H₂O₂ (0–700 μmol/L) for 4 h, REC viability was measured by WST-1 assay. (B) Effects of salidroside on cell viability measured by WST-1 assay (n = 5/group). (C) Intracellular apoptotic nuclei detected by TUNEL assay. Yellow arrows indicate the purplish red-stained TUNEL-positive nuclei. Scale bars = 50 μm, Original magnifications ×400 (n = 5/group). (D) Quantitative analysis of RECs apoptosis. (E) Pro- and cleaved caspase 3 proteins detected by Western blotting. RECs were treated by salidroside alone for 12 h, or H₂O₂ alone for 4 h, or salidroside pre-incubation for 12 h and then co-incubation with H₂O₂ for another 4 h. (F) Densitometric analysis of cleaved caspase-3 (n = 5/group). *p < 0.05, **p < 0.01.

As shown in Fig. 2(B), salidroside (200 μmol/L) treatment alone had no significant effect on the viability of REC compared with the control (p > 0.05). However, REC cells were pre-treated with various concentrations of salidroside (2, 20, 200 or 1000 μmol/L) for 12 h before treatment with H₂O₂ for 4 h, cell viability increased in a dose-dependent manner. Pre-treatment with 200 μmol/L salidroside significantly raised the cell viability up to 86.1% of the levels observed in control cells (p < 0.01). Therefore, the 200 μmol/L salidroside was used in the subsequent experiments.

Salidroside protected REC against H₂O₂-induced apoptosis

The REC apoptosis was evaluated by TUNEL staining. As shown in Fig. 2(C) and (D), compared with the control, salidroside (200 μmol/L) treatment alone had no significant effect on REC apoptosis (p > 0.05), whereas 4-h stimulation of H₂O₂-induced apoptosis, with 8.7-fold more apoptotic cells than that of the control (p < 0.01). Pre-incubation with salidroside for 12 h, and then together with H₂O₂ for another 4 h, significantly attenuated the apoptosis induced by H₂O₂, with 40.2% less apoptotic cells compared to the cells treated with H₂O₂ alone (p < 0.01). In addition, we examined the RECs apoptosis and necrosis using AV-FITC and PI staining. As illustrated in supplementary Fig. 1, compared to the control group, stimulation of H₂O₂ for 4 h dramatically elevated the ratios of necrotic (PI+) and apoptotic (FITC+PI−) cells by 5.0-fold and 4.0-fold, respectively (both p < 0.01). Pre-treatment with 200 μmol/L salidroside for 12 h significantly decreased the ratios of PI+ (34.4%) and FITC+PI− (32.8%) cells than the treatment with H₂O₂ alone (p < 0.01).

Caspase-3 is the one of the major proteases in apoptotic pathways.²⁰⁾ We detected the expression of cleaved caspase-3 by Western blotting. As shown in Fig. 2(E) and (F), compared with the control, 200 μmol/L salidroside treatment alone had no effect on cleaved caspase-3 (p > 0.05), whereas 4 h H₂O₂ stimulation induced a 4.2-fold increase in cleaved caspase-3 (p < 0.01). Pre-incubation with salidroside for 12 h followed by co-incubation with H₂O₂ for 4 h caused a significant reduction in cleaved caspase-3, with a 54.3% decrease as compared to stimulation with H₂O₂ alone (p < 0.01), suggesting the suppressive effect of salidroside on H₂O₂-induced cell death.

Salidroside ameliorated H₂O₂-induced oxidative stress

MDA is widely used as an indicator of lipid peroxidation.²¹⁾ As shown in Fig. 3(A), compared with the control, 200 μmol/L salidroside treatment alone did not affect MDA levels, whereas exposure to H₂O₂ for 4 h induced a 3.0-fold increase in MDA levels (p < 0.01). Salidroside pre-treatment for 12 h caused an apparently significant decrease in MDA levels (p < 0.01), with 27.6% lower than that in cells treated with H₂O₂ alone for 4 h.

Fig. 3. Effects of salidroside on oxidative stress markers, MDA, and ROS in primary-cultured RECs.

Notes: (A) MDA contents in retinal endothelial cells (n = 5/group). (B) Intracellular ROS was measured using H₂DCFDA and normalized to the protein contents in cell lysate (n = 6/group). **p < 0.01.

The ROS levels in RECs were further measured directly using of DCFH-DA staining. As shown in Fig. 3(B), compared to the control cells, salidroside treatment alone had no effect on intracellular ROS levels, whereas H₂O₂ exposure for 4 h induced a significantly elevated intracellular ROS production, with 58.2% higher than that in the control cells (p < 0.01). However, the ROS elevation was effectively reduced by 26.4% (p < 0.05) with salidroside pretreatment for 12 h followed by co-incubation with H₂O₂ for 4 h.

Salidroside enhanced the expressions and activities of catalase and Mn-SOD

Catalase and Mn-SOD are the endogenous antioxidative enzymes, which protect against the damage induced by ROS.²²⁾ As shown in Fig. 4(A), compared with the controls, RECs were treated with 200 μmol/L salidroside alone for 12 h, intracellular mRNA expressions of catalase and Mn-SOD elevated by 77.5% (p < 0.01) and 37.8% (p < 0.05), respectively; 300 μmol/L H₂O₂ treatment alone for 4 h could induce intracellular mRNA expressions of catalase and Mn-SOD increase by 113.1% (p < 0.01) and 79.7% (p < 0.01), respectively. RECs were pre-treated with salidroside for 12 h and then co-incubated with H₂O₂ for another 4 h, intracellular mRNA expressions of catalase and Mn-SOD increased by 36.8% (p < 0.01) and 38.8% (p < 0.01), respectively, compared with H₂O₂ treatment alone. The expressions of catalase and Mn-SOD were further confirmed by Western blotting. As shown in Fig. 4(B) and (C), compared to the control groups, treatment with salidroside alone for 12 h could enhance intracellular catalase and Mn-SOD proteins by 63.7% (p < 0.01) and 59.7% (p < 0.05), respectively; H₂O₂ alone treatment for 4 h could elevate intracellular catalase and Mn-SOD proteins 107.8% (p < 0.01) and 142.5% (p < 0.01), respectively. Compared with H₂O₂ treatment alone, salidroside pre-treatment for 12 h and then co-incubation with H₂O₂ for 4 h could increase intracellular catalase and Mn-SOD proteins by 47.6% (p < 0.01) and 29.5% (p < 0.01), respectively.

Fig. 4. Activities and expression of catalase and Mn-SOD in primary-cultured RECs.

Notes: mRNA expression (A), protein levels (B and C), and activities (D) of catalase and Mn-SOD in RECs treated by either salidroside alone or H₂O₂ with or without salidroside (n = 4/group). (*p < 0.05, **p < 0.01).

As shown in Fig. 4(D), compared with the control groups, salidroside alone treatment for 12 h enhanced intracellular catalase and Mn-SOD activities by 36.3% (p < 0.05) and 27.0% (p < 0.05), respectively; H₂O₂ alone treatment for 4 h increased intracellular catalase and Mn-SOD activities by 54.7% (p < 0.01) and 44.8% (p < 0.01), respectively. When RECs were pre-treated with salidroside for 12 h and then co-incubated with H₂O₂ for another 4 h, intracellular catalase and Mn-SOD activities increased by 22.7% (p < 0.01) and 35.6% (p < 0.01), respectively, compared with H₂O₂ alone treatment groups.

Salidroside increased Bcl2 expression and reduced Bax expression

Bcl2 could bind to and impair Bax and other proapoptotic proteins, while the ratio of Bcl2/Bax is an index to determine which cells undergo apoptosis.²⁰⁾ As shown in Fig. 5, compared with the controls, the Bcl2 protein concentration significantly decreased by 44.6%, whereas Bax expression dramatically increased by 1.3-fold (both p < 0.01), respectively. This resulted into the Bcl2/Bax ratio significantly decreased by 74.4% (p < 0.01). Pre-treatment with salidroside for 12 h followed by co-incubation with H₂O₂ for another 4 h resulted in increased levels of Bcl2 expression but decreased levels of Bax expression. In addition, Bax/β-actin ratios decreased by 46.8% (p < 0.01), and Bcl2/β-actin and Bcl2/Bax ratios increased by 41.8% (p < 0.05) and 1.67-fold (p < 0.01), respectively, compared with H₂O₂ alone. However, incubation with salidroside alone for 12 h significantly increased Bcl2/β-actin ratios and Bcl2/Bax by 76.0% (p < 0.01) and 75.6% (p < 0.01), compared with controls.

Fig. 5. Effects of salidroside on the expressions of Bcl2 and Bax in primary-cultured RECs.

Notes: (A) Intracellular Bcl2/Bax expressions detected by Western blot analysis. (B) The quantitative comparisons of Bcl2, Bax, and Bcl2/Bax (n = 4/group). *p < 0.05, **p < 0.01.

Discussion

Oxidative stress is induced by excessive ROS production, which can be ameliorated by endogenous antioxidative defense mechanisms.^2,22–24) ROS can cause damages to the retinal endothelial cells.¹⁰⁾ H₂O₂, which is known as a major factor to induce oxidative damage, is transformed from a superoxide and leaks from the mitochondria.^22,25) The level of H₂O₂ and in mitochondria is elevated during the pathogenesis of diabetic retinopathy.^12–14) A few extracts from R. rosea are protective against tissue damages induced by H₂O₂.^6–9) Salidroside has a special neuroprotective effect of alleviate H₂O₂-induced apoptosis in rat hippocampal neurons by suppressing nitric oxide synthase activities and caspase-3.²⁶⁾ In addition, Cai et al.²⁷⁾ found that salidroside deceased apoptosis caused by H₂O₂ in PC12 cells through regulation of Bcl-2/Bax ratios and cytochrome c release. Castilho et al.¹²⁾ reported that H₂O₂ could induce a highly apoptosis ratios in retinal endothelial cell. However, the effects and the potential mechanisms of salidroside on oxidative injury in RECs are unclear.

In the present study, primary RECs were challenged with H₂O₂ to induce oxidative stress, which mimics the pathogenesis of oxidative stress in diabetic retinopathy by increasing in H₂O₂ concentration, lipid peroxidation level, cell death, and apoptosis. The exposure to 300 μmol/L H₂O₂ decreased RECs viability by 25% (Fig. 2(A)) and induced RECs apoptosis about 50% (Fig. 2(D)). The WST assay examines the succinate-tetrazolium reductase existing in viable cells, allowing a direct colorimetric measurement of cell viability and proliferation. The succinate–tetrazolium reductase is still active in the early apoptotic cells, so the cells display high viability and relatively low apoptotic ratio. The TUNEL method identifies apoptotic cells in situ using terminal deoxynucleotidyl transferase (TdT) to transfer biotin-dUTP to the free 3′-OH of cleaved DNA. The DNA damage even in early apoptotic cells can be monitored by the TUNEL assay, thus the ratio of apoptotic cell is higher than that measured in the WST assay. Salidroside (200 μmol/L) treatment showed obvious inhibitory effects on ROS generation, MDA production, and apoptosis of retinal endothelial cells induced by H₂O₂ stimulation.

Oxidative stress levels in tissues and cells are regulated by the balance between ROS generation and the enzymatic activity and non-enzymatic antioxidant defenses.^22,28,29) Mn-SOD is known as one of the most crucial intracellular antioxidant enzymes, while catalase is also the most significant enzyme to degrade exogenous H₂O₂.²⁸⁾ In RECs, H₂O₂ stimulation increased mRNA expression, protein expression, and enzymatic activities of Mn-SOD and catalase, which was also reported similarly by Rohrdanz et al.²⁸⁾ Moreover, salidroside treatment alone also obviously upregulated the intracellular mRNA expression, protein expression, and enzymatic activities of Mn-SOD and catalase, these results were comparable with those reported by Huang et al.³⁰⁾ that treatment with R. rosea extracts upregulated the expression of MnSOD, Cu/Zn-SOD, and catalase in rat livers. Pre-treatment with salidroside, followed by co-incubation with H₂O₂, augmented the mRNA expression, protein expression, and enzymatic activities of MnSOD and catalase, in compared with those groups treated with H₂O₂ alone. Our results showed that salidroside was an adaptogen with antioxidative action. It strengthened the endogenous antioxidant defense system by decreasing the retinal endothelial oxidative stress through by increase of intracellular antioxidant enzymes.

To demonstrate further biochemical phenomenon sustaining the function of salidroside to protect RECs against H₂O₂-induced damage, we proved that salidroside was able to adjust intracellular Bcl2/Bax signaling pathway²⁰⁾, which was similarly found in retinal endothelial cells. We demonstrated that H₂O₂ exposure allowed the role to decease the protein expression level of Bcl2, while augmented the protein expression level of Bax in retinal endothelial cells compared with the control groups. Furthermore, the protein ratios of Bcl2 to Bax were obviously decreased, which was similarly to the increased apoptosis showed by TUNEL stain and of the expression of cleaved caspase-3. In RECs, salidroside co-incubation obviously decreased the H₂O₂-induced Bax expression and increased H₂O₂-suppressed Bcl2 and Bcl2/Bax ratios in the protein expression levels. These results were connected by a protection in apoptotic levels. The results indicated that salidroside significantly protected against damage induced by H₂O₂ in retinal endothelial cells, which showing an upregulation of Bcl2 and downregulation of Bax. Nevertheless, there is little evidence about the activation of salidroside on the Bcl2/Bax signaling pathway. It is crucial to identify the underlying mechanism of salidroside in the regulation of Bcl2 and Bax under the excessive oxidative stress.

In summary, our present study has shown that salidroside protects RECs against oxidative injury by suppressing the lipid peroxidation generation and cell apoptosis. The mechanisms could potentially involve the upregulation of the Bcl2/Bax signaling pathway and induction of endogenous antioxidant enzymes. This finding presents salidroside as an attractive agent with potential to attenuate retinopathic diseases.

Author contributions

Shi K, Zhang K, and Su Z conceived and designed the experiments. Shi K, Wang X, Zhu J, and Cao G performed the experiments. Shi K and Su Z analyzed the data. Shi K and Su Z wrote the paper.

Supplemental material

The supplemental material for this paper is available at http://dx.doi.org/10.1080/09168451.2015.1038212.

Additional information

Funding

This work was supported by the National High Technology Research and Development Program of China (863 project) [grant number 2014AA021604]; Sichuan Province Science and Technology Support Program [grant number 2015SZ0140].

Notes

Abbreviation: H₂O₂, hydrogen peroxide; ROS, reactive oxygen species; RECs, retinal endothelial cells; WST, water soluble tetrazolium; TUNEL, TdT-mediated dUTP nick end labeling; MDA, malondialdehyde; Mn-SOD, Mn-superoxide dismutases; PECAM-1, Platelet/endothelial cell adhesion molecule-1; vWF, von Willebrand’s Factor; ECM, endothelial cell growth supplement; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RIPA, radio-immune precipitation assay; PVDF, polyvinylidene fluoride; H₂DCFDA, 2′, 7′-dichlorofluorescein-diacetate.