SNPs in minimal promoter of myostatin (GDF-8) gene and its association with body weight in broiler chicken

Abstract

Myostatin (MSTN), a transforming growth factors β (TGF-β) family member, is an important regulator of muscle mass. While polymorphism in the coding region of MSTN is extensively studied, the genetic causes of transcriptional regulation are poorly understood. This study is targeted to identify variations in the promoter region of MSTN. This study revealed that the promoter region of the growth differentiation factor 8 (GDF-8) is highly polymorphic and the identified nucleotide variations were attributed to transition mutations in sequence. Out of three genotypes observed, the frequency of AA was significantly higher (0.63) followed by the frequencies of AB (0.28) and BB (0.09). Genotype BB had a significant effect on body weight at hatching implicating the role of the identified single nucleotide polymorphisms (SNPs) in the chicks muscle development.

Keywords:

• myostatin
• polymorphism
• body weight
• mutation
• promoter
• poultry

1. Introduction

A quest for unraveling the genetic mechanism controlling the growth of the muscle has resulted in the development of several factors regulating the muscle growth. One of the most important muscle-growth-limiting factors is myostatin (MSTN). MSTN is also called as the growth differentiation factor 8 (GDF-8). MSTN protein belongs to the transforming growth factors β (TGF-β) superfamily (McPherron et al. 1997). MSTN is secreted as the latent protein of 38 kD that comprises 376 amino acids. Biologically active, processed and matured MSTN protein is 15 kDa (Lee & McPherron 2001; Tries et al. 2001; Wolfman et al. 2003). MSTN gene consists of three exons and two introns (Bellinge et al. 2005). MSTN is mainly expressed in skeletal muscles which control the growth of the muscles by suppressing proliferation and differentiation of myoblast cells in mammals (Rios et al. 2004).

Intracellular signaling pathways for MSTN gene are Smad-mediated and non-Smad-mediated (Huang et al. 2011). MSTN-associated inhibition of skeletal muscle growth is attributed to the upregulation of the cyclin-dependent kinase (CDK) inhibitor p21, the downregulation of CDK2 and decreased phosphorylation of the retinoblastoma (Rb) (Thomas et al. 2000; Joulia et al. 2003; Philip et al. 2005; Huang et al. 2007). It also causes enhanced degradation of the CD1 protein leading to cell cycle arrest of myoblast cells at G1 phase (McPherron & Lee 1997). MSTN is also thought to downregulate the expression of the myoblast differentiation-associated genes like Myod5, Myogenin, and Myf5 (Langley et al. 2002; Rios et al. 2002; Yang et al. 2006).

Loss of function of the MSTN gene through natural mutation in the coding regions and using several molecular techniques like gene knock down, gene silencing, and antibody blockade of the MSTN receptors have resulted in the phenomenal increase in the muscular mass in several animal species including humans (Grobet et al. 1997; Kambadur et al. 1997; McPherron et al. 1997; Zhu et al. 2000; Schuelke et al. 2004; Mosher et al. 2007; Mendias et al. 2008; Tripathi et al. 2012).

In 1997, it was revealed that the unique muscular growth in mice and some of the breeds of cattle was the result of the mutation in the coding region of the MSTN gene. Since then, most of the works have focused on understanding the functional mechanisms of the MSTN gene. The role of MSTN in embryo as well as adult muscle development in various organisms has been studied. The role of this protein in embryo muscle development in chicken had been reported earlier (Manceau et al. 2008), and yet the variations in the transcriptional regulation the MSTN genes in chicken are not well studied. Therefore, this study was undertaken to study the polymorphism in the promoter region of the MSTN gene to delineate the single nucleotide polymorphisms (SNPs) and to find out the association of SNPs with the body weights at different growth stages of broiler.

2. Materials and methods

2.1. Experimental birds

This study was conducted on randomly bred broilers called control broiler (CB) maintained at the Project Directorate on Poultry (PDP), Hyderabad. All birds belonged to same hatch, strain and were raised under an intensive system of management with provision of ad-libitum feeding and drinking water. Chicks body weight at hatch, second, four, five, and six weeks were recorded. The birds were reared following strict guidelines of the institute's animal ethics committee.

2.2. Isolation of genomic DNA and amplification of MSTN promoter

One milliliter of blood from each of the 206 birds was collected from the wing vein aseptically into a vacutainer tube containing 50 µl of 0.5 M EDTA. Genomic DNA was extracted from the blood cells using the phenol–chloroform method (Sambrook & Russell 2001). Quality and quantity of the DNA were checked on 0.7% agarose gel electrophoresis and spectrophotometer, respectively. Good-quality DNA having no smear and OD (260/280) value of 1.8 was used for gene amplifications. A pair of primers – MSTNPF2F (5′–3′): CCTGGAACACACGAGCAC and MSTNPF2R (5′–3′): ACCATGATGTCAGTTTATCAC – was designed from the chicken MSTN gene (GenBank accession NoHQ171974) using DNASTAR software (Lasegene Inc., Madison, WI, USA) to amplify 362-bp partial promoter region of MSTN (from 371 to 732 base in accession number HQ171974). The polymerase chain reaction (PCR) of 25 µl was set up by mixing 100 ng of DNA template, 10 pmol of each primer, 1.5 mM of MgCl₂, 100 µM of each dNTP, 1X assay buffer, and 0.3 U of Taq DNA polymerase (MBI Fermentas, St Leon-Rot, Germany). The amplification condition was 94°C for 5 min, followed by 30 cycles of 94°C for 45 s, 54.7°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 10 min. The PCR products were characterized by 0.8% agarose gel electrophoresis.

2.3. Nucleotide variability study

2.3.1. Single-stranded conformation polymorphism

Single-stranded conformation polymorphism (SSCP) is a molecular technique for mutation detection in DNA fragment. This is one of the effective and cheap techniques to screen a larger population for nucleotide even at the single nucleotide level with high accuracy (Hayashi 1992; Suomalainen et al. 1992). This technique is very sensitive to the size of the fragment length (Val et al. 1993). However, a small fragment increases the precision of SNP detection. In the present work, a 362-bp fragment was characterized by SSCP to explore SNPs. For SSCP analysis, a 12% native PAGE (50:1, acrylamide and bis-acrylamide) with 5% glycerol was prepared for electrophoresis. Furthermore, 3 µl of the PCR product mixed with 9 µl formamide dye (95% formamide, 0.025% xylene cyanol, 0.025% bromophenol blue, and 0.5 M ethylene diamine tetra-acetic acid) was denatured at 95°C for 5 min, followed by snap cooling on ice for 15 min. For better snap cooling and maintenance of single-strand DNA, cooling was carried on −20°C. Then, the product was loaded in the gel and electrophoresis was performed at 4°C for 12 h at 150 V. After electrophoresis was completed, the gel was stained with silver nitrate to visualize banding patterns of the fragment under the gel doc system (Bio-Rad, Hercules, USA).

Genotyping of the birds was done by visual inspection of the gel under the gel doc system (Bio-Rad). The genotype and allele frequencies were calculated using the gene counting method (Falconer & Mackay 1996). The PCR products of different alleles were sequenced by the automated dye-terminator cycle sequencing method in Applied Biosystem, 3730xl DNA Analyzer (Foster City, USA). Sequences were aligned with the ClustalW2 program (http://www.ebi.ac.uk/Tools/clustalw2/index.html) and BLASTN (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The chicken MSTN promoter sequence was analyzed in silico for the presence of putative transcription factor binding sites at SNPs, relevant to the MSTN gene transcriptional regulation using trial version of MatInspector (http://www.genomatix.de/) bioinformatics tool.

2.4. Statistical analysis

The association of genotype with body weight at different age was analyzed using the least squares linear fixed model, where genotypes and sex were taken as fixed factors. All the birds belonged to the same hatch and strain, and most of the environmental determinants of variation were common to all the birds. Data were analyzed using SAS 9.3 version. The fixed model used for analysis was:

where, µ is the overall mean, H_i the genotype effect, G_j is sex effect, and e_ij was the random error.

3. Results and discussion

3.1. Analysis of SSCP pattern reveals a higher frequency of AA genotype in the broiler

An amplicon of 362 bp was amplified by PCR using costumed primers of partial MSTN promoters. Genetic variability in the partial promoter region of MSTN was studied through SSCP. MSTN promoter was found to be highly polymorphic having three genotypes: AA, AB, and BB. Earlier reports of MSTN promoter genetic variability reported several alleles in MSTN promoter regions (Gan et al. 2008; Nadjar-Boger & Funkenstein 2011; Bhattacharya & Chatterjee 2013). Three genotypes AA, AB, and BB were observed (Figure 1). The frequency of AA was significantly higher (0.63) followed by the frequencies of AB (0.28) and BB (0.09) (Table 1). The allelic frequency of A (0.76) was predominantly high in CB (Table 1). Skewing of the population toward allele ‘A’ and genotype ‘AA’ may be attributed to the continuous selection of birds for more than 20 generations for higher body weight, without the introduction of new germplasms from outside.

Figure 1. SSCP gel of different genotypes in control broiler.

Table 1. Genotype and allele frequency in CB.

Genotype frequency	AA	AB	BB
	0.63	0.28	0.09
Allele frequency	A	B
	0.76	0.24

3.2. Higher body weight at hatching is associated with B allele having an SNP at A241T

At day 0 (hatch day), the body weight of genotype BB (57.67 ± 5.45 g) was significantly (p ≤ 0.05) higher followed by the body weight of AA (39.57 ± 2.14 g) and AB (39.46 ± 3.22 g) genotypes (Table 2). Body weight at hatch reflects the effect of MSTN during fetal development. A similar pattern of the body growth was observed with minor deviation in two weeks old chicks, where the body weight of BB was 7% and 5% higher than AA and AB, respectively. Birds having genotype AA had higher body weights as compared to AB and BB at fourth, fifth, and sixth week of age. The percentage increase of body weight of AA from AB genotypes at week 4, week 5, and week 6 were 2.19, 4.81, and 4.60, respectively. The percent difference between body weight of birds having AA and BB genotypes at week 4, week 5, and week 6 were 5.78, 3.87, and 3.73, respectively. Several workers have reported the association of SNPs and QTLs in different chicken breeds (Sewalem et al. 2002; Tsudzuki et al. 2007) Male birds had significantly higher body weights at all stages of the development.

Table 2. Least squares means of body weights at different age intervals.

SI no.	Body weight	AA	AB	BB	p values
1	Day 0	39.57 ± 2.14^a	39.46 ± 3.22^a	57.67 ± 5.45^b	0.008
2	Second week	116.70 ± 2.012^a	118.21 ± 3.02^a	124.08 ± 5.12^a	0.405
3	Fourth week	378.89 ± 6.871^a	370.63 ± 10.38^a	357.00 ± 17.42^a	0.461
4	Fifth week	587.87 ± 9.71^a	559.95 ± 14.60^a	565.99 ± 24.50^a	0.249
5	Sixth week	859.88 ± 13.67^a	820.27 ± 20.46^a	827.76 ± 34.31^a	0.238

^a Non-significant differences.

^b Significant differences.

3.3. Point mutation at the MSTN promoter overlaps with the transcription factor FAST-1

Sequence variability in the promoter region of MSTN was studied using SSCP technique and sequencing of different alleles was done. The DNA sequence of the partial promoter region was analyzed using DNA Star bioinformatics tools (Lasegene Inc., Madison, WI, USA). Two alleles along with the original sequence (sequence used for designing the primers) were aligned and compared using megalign option of the DNA Star software. Allele-specific nucleotide substitution mutations were observed at T23C, G150A, and A214T in allele A and at A241T in allele B. Mutation at T147C was common in both the alleles. Earlier studies also revealed that the differential level of expression of MSTN gene may be attributed to variability in sequence of the promoter region (Gu et al. 2004; Du et al. 2005). A similar type of substitution was also observed by Bhattacharya et al. 2012) in the promoter region of the Pit1 gene in poultry.

In order to study the effect of these mutations on MSTN gene regulation, MSTN promoter sequence was analyzed in silico for the presence of putative transcription factor binding sites at SNPs. Several putative transcription factor-binding sites were predicted but here we discuss transcription sites, relevant to the MSTN gene transcriptional regulation using the trial version of MatInspector (http://www.genomatix.de/). The most relevant one to the MSTN gene regulation was the presence of Forkhead activin signal transducer (FAST-1) binding motif which overlaps with the mutation A214T in allele A (Figure 2). Smad and FAST-1 play a critical role in the intracellular signal transduction of the MSTN gene resulting in the upregulation of the gene (Allen & Unterman 2007; Du et al. 2007). As the MSTN gene is the negative regulator of the skeletal muscles growth, the mutation in this region might have resulted in the downregulation of the MSTN gene which is evident by the higher body weights of the birds having A alleles at fourth, fifth, and sixth week of age (Table 2).

Figure 2. Alignment of the alleles with the original sequence nucleotide represented by bold small letters and underline depicts mutations while only small letters indicate the putative site for FAST-1.

4. Conclusion

MSTN gene in the partial promoter region is highly polymorphic and variability may be attributed to the transition mutation in the nucleotide sequence of different alleles. The genotype BB had a significant effect on body weight in day-old chicks. But at fourth, fifth, and sixth week, birds having AA genotypes had higher body weight. MSTN is a negative regulator of muscle growth and FAST-1 protein plays very critical role in activation of the MSTN promoter. Prediction model using MatInspector suggested that mutation at putative binding sequence of FAST-1 in allele ‘A’ might have resulted in the downregulation of the MSTN gene leading to higher body weight of the birds having allele ‘A’. This study provides clear evidence for the genetic variations causing variation in the body weight. However, repetition of a similar study over a large population and across different populations is required to validate this result. So that SSCP marker identified in this study would be helpful in selecting the breeding population for higher body weight at early age.

Acknowledgments

We acknowledge the help of the Director, Project Directorate on Poultry, Hyderabad, Director Instructions Post Graduate Studies, KVAFSU, Bidar and Dean Veterinary College, Hebbal, Bangalore for providing facilities to carry out this research work.