The effect of high nutrient on the growth performance, adipose deposition and gene expression of lipid metabolism in the neonatal intrauterine growth-retarded piglets

ABSTRACT

Twelve pairs of intrauterine growth retardation (IUGR,1.84 ± 0.09 kg) and normal birth weight (NBW, 2.80 ± 0.16 kg) of Duroc × Landrace × Yorkshire piglets (7-day old) were randomly assigned to four treatments (six replicates per treatment) in a 2 × 2 factorial design. IUGR and NBW piglets were fed diets of either normal nutritional level (NN, 880 kcal/L, 50 g of protein/L) or high nutritional level (HN, 1320 kcal/L, 75 g protein/L)for 21 days. IUGR decreased the average daily dry matter intake (ADMI), the average daily growth (ADG) and leaf fat relative weight. Regardless of body weight, HN could increase the ADMI, ADG and intramuscular fat content, and enhance serum insulin, IGF-I and leptin concentrations, but decreased serum adiponectin concentrations in IUGR piglets. Furthermore, HN could increase the PGC-1α of liver and C/EBPα of longissimus expression in IUGR piglets. These results suggested that the IUGR piglets had lower growth performance and adipose deposition than NBW piglets. However, HN in diets could make up the defect of IUGR piglets in the uterus, and regulated the expression of lipid metabolism genes in some tissues of IUGR piglets.

KEYWORDS:

• Intrauterine growth-retarded piglets
• nutrient level
• adipose deposition
• gene expression
• lipid metabolism

1. Introduction

Intrauterine growth retardation (IUGR) is usually defined as impaired growth and development of the embryo and/or its organs during gestation (Wu et al. 2004). In sow, due to the limitation of the content in uterus, IUGR occurred in 9–11% of newborn piglets (Wu et al. 2006). Recent Studies have shown that IUGR reduced neonatal survival, the efficiency of nutrient utilization, organ development (i.e. small intestine, liver and muscle), postnatal growth and impaired long-term health (D'Inca et al. 2010; Wu et al. 2012). Evidence has shown that the nutrient density could increase IUGR development or growth (Nissen & Oksbjerg 2011; Sarr et al. 2012). For example, High nutrient intake increased the growth and impaired the immune function of neonatal piglets with IUGR, but it is little known about the nutrient level (NL) in regulating lipid metabolism during the suckling period (Han et al. 2013).

The risk of adult metabolic syndrome has increased in IUGR newborns, which is associated with lipid abnormalities, obesity or insulin resistance (Roberts et al. 1999). Evidence in human has shown that the IUGR newborns had higher adiponectin concentrations, but the leptin concentrations was lower than normal birth weight (NBW) newborns (Kotani et al. 2004). Although it has been widely reported that IUGR decreased the animal growth, impaired intestinal development and function, the role of early high nutrient in regulating hormone metabolism is still vague. Meanwhile, the early time of the lipid metabolism is important to the intramuscular and intermuscular fat syntheses, the meat quality at the slaughter time and so on.

Overnutrition associated with weight gain can also lead to obesity and insulin resistance (Ferrannini et al. 1997). The postnatal nutrition level is related to later development of overweight and other metabolic disorders. Studying the lipid metabolism response of IUGR piglets to NL may provide useful information on IUGR piglets fed a nutrient formula. Therefore, this study was undertaken to investigate the effects of NL in growth, hormone level and lipid-related gene in liver, muscle and abdominal fat of IUGR piglets during the newborn period.

2. Materials and methods

2.1. Animals and experimental design

The animal use and care protocol was approved by the Animal Care and Use Committee of Sichuan Agricultural University. The NBW piglets defined as the birth weight near mean litter birth weight (SD ± 0.5), the IUGR piglets defined as at least 1.5 SD lower birth weight. Twelve pairs of IUGR and NBW piglets (Duroc × (Landrace × Yorkshire)) at 7-day-old from 12 sows were allotted to normal nutrition (NN) and high nutrition (HN) groups. The normal formula milk powder (Table 1) was formulated according to previous studies (Dourmad et al. 1998; Chatelais et al. 2011). The normal NL was similar to sow milk composition, mixing 1 kg of formula powder (dry matter (DM) 87.5%) with 4 L of water to a milk solution. The high nutrient-level nutrient contents were about 1.5-fold those of the former, mixing 1.73 kg of formula powder with 4 L of water to the milk solution.

Table 1. Composition and NL of basal diet (87.5% DM basis, %).

Ingredients	%
Whole milk powder (24% CP)	58.00
Whey protein concentrate (34% CP)	25.00
Casein	5.70
Coconut oil	10.00
CaH2PO4	0.10
Choline chloride (50%)	0.10
Vitamin premix^a	0.10
Mineral premix^b	0.50
L-Arg (98.5%)	0.06
DL-Met (98.5%)	0.06
L-Lys·HCl (78.5%)	0.30
L-Thr (98%)	0.03
L-Trp (98%)	0.05
Total	100.00
Nutrient content^c
Digestible energy (MJ/kg)	18.39
Crude protein (%)	25.30
Calcium (%)	1.02
Total phosphorus (%)	0.81
Available phosphorus (%)	0.67
Digestible Lys (%)	1.93
Digestible Met (%)	0.63
Digestible Arg (%)	0.86

^aVitamin premix provided per kg powder diet: vitamin A, 0.94 mg; vitamin D₃, 0.01 mg; vitamin E, 20 mg; vitamin K₃, 1 mg; vitamin B₁₂, 0.04 mg; riboflavin, 5 mg; niacin, 20 mg; pantothenic acid, 15 mg; folic acid, 1.5 mg; thiamin, 1.5 mg; pyridoxine, 2 mg; biotin, 0.1 mg.

^bMineral premix provided per kg powder diet: Zn 90 mg; Mn 4.0 mg; Fe 90 mg; Cu 6.0 mg; I 0.2 mg; Se 0.3 mg.

^cThe NLs of diet are calculated values.

The experimental design consisted of four treatments including two birth weights of piglets (IUGR and NBW) and two feeding groups (NN and HN). The different nutritional levels of formula milk were formed from normal nutritional level (NN, 880 kcal/L, 50 g of protein/L) and high nutritional level (HN, 1320 kcal/L, 75 g protein/L). The nutritional formula milk was made with the same formula milk powder (Table 1) but different amounts of water. Formula milk at 50 mL/kg body weight (BW) per meal was fed to the piglets with feeding bottles for 7 times a day at 3 h intervals between 6:00 and 24:00 hours. Piglets had free access to water. In the present study, the average birth weight and 7-day-old weight (IUGR or NBW) of piglets used were 0.87 or 1.68 and 1.52 or 2.78 kg, respectively. All the piglets were housed in metabolism cages, individually. The ambient temperature and humidity were controlled around 30°C and 50–60%, respectively. This experiment lasted for 21 days. The BW and the formula milk intake of piglets were recorded daily. The average daily DM intake (ADMI) was calculated by multiplying the average daily intake of formula milk by its corresponding DM content. Formula milk intake was calculated as the difference between the offered amounts and the refusals.

2.2. Slaughter surveys and sampling

Following overnight fasting, all piglets were anesthetized and slaughtered after the experiment. Blood samples of piglets were collected by jugular vein, and centrifuged at 3,500 × g for 10 min. Then, the serum was stored at −80°C until the hormone analysis. Leaf fat was removed from the carcass and weighed immediately. The longissimus dorsi muscle (LM) samples were immediately collected from the left side of carcass and stored at 4°C for determining meat quality. In addition, LM, liver and abdominal fat samples for RNA extraction were rapidly removed and frozen in liquid nitrogen, and then stored at −80°C until analysis. The serum hormone was detected by Nan Jing Jian Cheng Bioengineering Institute (Nanjing, China). The leaf fat was calculated to relative weight. The intramuscular fat (IMF) content of the LM was determined by chloroform–methanol extraction and expressed as the weight percentage of wet muscle tissue (Bligh & Dyer 1959).

2.3. RNA isolation and reverse transcription

Total RNA was extracted from liver, LM and leaf fat using the Trizol reagent (TaKaRa, Dalian, China) according to the manufacturer's instruction. The purity and integrity of RNA was detected by UV/VIS spectrophotometer (Beckman Coulter, DU800) and electrophoresis in 1% agarose gel, respectively. Reverse transcription (RT) was carried out by RT Reagents (TaKaRa, Dalian, China) according to the manufacturer's instruction.

2.4. Real-time PCR

Following RT, expression levels of carnitine palmitoyltransferase-1 (CPT-1), heart-type fatty-acid-binding protein (H-FABP), peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α), sterol regulatory element-binding protein-1c (SREBP-1c), CCAAT/enhancer-binding protein α (C/EBPα) and β-actin in the liver, LM and leaf fat were analysed by real-time quantitative PCR using SYBR Premix Ex Taq reagents (TaKaRa, Dalian, China) and CFX-96 Real-Time PCR Detection System (Bio-Rad Laboratories, Richmond, CA), as previously described (Chen et al. 2012; Mao et al. 2013). Briefly, the gene-specific primers used were given in Table 2, and purchased from TaKaRa (Dalian, China). The PCR system consisted of 5 μL SYBR Premix Ex Taq^TM (2×), 1 μL forward primers (4 μM), 1 L reverse primers (4 μM), 2 μL double distilled water and 1 μL cDNA for a total volume of 10 μL. Cycling conditions were as follows: 95°C for 10 s, and 40 cycles involving a combination of 95°C for 5 s, annealing temperature (Table 2) for 25 s and 72°C for 15 s. Relative gene expression to the reference gene (β-action) was performed in order to correct for the variance in amounts of RNA input in the reaction. In addition, the relative gene expressions compared to the reference gene were calculated with the previous method (Livak & Schmittgen 2001; Chen et al. 2012, Mao et al. 2013).

Table 2. Primer sequences used for real-time RT-PCR.

Gene names	Primer sequence (5′-3′)	Product length (bp)	Annealing temperature (°C)
β-actin	F:TCTGGCACCACACCTTCT	132	60
	R:TGATCTGGGTCATCTTCTCAC
CPT-1	F:CCACTATGACCCGGAAGACG	111	60
	R:TTGAACGCGATGAGGGTGAA
H-FABP	F:CTCTTTCTCAGCCTAGCCCA	151	60
	R:TGTGGTAGGCTTGGTCATGTT
PGC-1α	F:GTCCTTCCTCCATGCCTGAC	145	60
	R:TGGTTTGCATGGTTCTGGGT
SREBP-1c	F:GCGACGGTGCCTCTGGTAGT	110	60
	R:CGCAAGACGGCGGATTTA
C/EBPα	F:CACGGTGCGTCTAAGATGAGG	218	60
	R:TCGGAGCGGTGAGTTTGC

2.5. Statistical analysis

All data, expressed as mean ± SD, were analysed as a 2 × 2 factorial using the general linear model procedures of the SAS (Version 8.1; SAS Institute, Gary, NC). The factors in the models included the main effects of birth weight (IUGR and NBW) and NL (normal and high) as well as their interaction. P < .05 was considered to indicate statistical significance.

3. Results

3.1. Growth performance

Regardless of the NL, the initial BW, final BW, average daily growth (ADG) and ADMI of IUGR piglets were lower (P < .05) than those of NBW neonates (Table 3). The feed conversion ratio (FCR) of IUGR piglets throughout the experimental period was non-significantly (P > .05) different from that of NBW piglets. HN increased the final BW (P < .05), BW gain (P < .05), ADG (P < .05), ADMI (P < .05) and FCR (P < .05) of piglets throughout the experimental period compared with NN. BW and NL had no profitable on the initial BW, final BW, ADG, ADMI and FCR during the experimental period. Although IUGR piglets that received HN had a comparable BW gain, the final BW was still lower (P < .05) relative to NBW piglets.

Table 3. Effects of NL on the growth performance of intrauterine growth-retarded (IUGR) and normal birth weight (NBW) neonate piglets.

Items	NN		HN		P-value
	IUGR	NBW	IUGR	NBW	BW	NL	BW × NL
Birth weight (kg)	0.91 ± 0.07^a	1.49 ± 0.06^b	0.89 ± 0.02^a	1.59 ± 0.11^c	.187	<.001	.079
Initial weight (kg)	1.84 ± 0.09^a	2.80 ± 0.16^b	1.86 ± 0.13^a	2.85 ± 0.10^b	<.001	.556	.828
Final weight (kg)	5.52 ± 0.45^a	7.39 ± 0.26^b	6.76 ± 0.18^b	8.85 ± 0.70^c	<.001	<.001	.608
ADG (g)
Days 0–7	111 ± 15^a	136 ± 43^a	160 ± 28^a	241 ± 85^b	.042	.006	.257
Days 7–14	167 ± 23	192 ± 69	222 ± 52	251 ± 82	.357	.066	.955
Days 14–21	249 ± 60^a	327 ± 81^ab	316 ± 26^ab	365 ± 55^b	.047	.087	.606
Days 0–21	175 ± 24^a	218 ± 13^b	233 ± 12^b	286 ± 29^c	<.001	<.001	.645
ADMI (g)
Days 0–7	108 ± 27^a	142 ± 16^b	151 ± 19^b	218 ± 10^c	<.001	<.001	.111
Days 7–14	118 ± 11^a	155 ± 22^ab	191 ± 59^b	243 ± 27^c	.017	<.001	.664
Days 14–21	206 ± 21^a	261 ± 10^ab	315 ± 49^b	406 ± 69^c	.004	<.001	.414
Days 0–21	144 ± 19^a	186 ± 14^b	219 ± 24^c	289 ± 27^d	<.001	<.001	.206
FCR
Days 0–7	0.98 ± 0.21	1.11 ± 0.29	0.97 ± 0.25	1.06 ± 0.57	.537	.871	.882
Days 7–14	0.72 ± 0.10	0.92 ± 0.47	0.86 ± 0.15	1.06 ± 0.39	.209	.361	.991
Days 14–21	0.86 ± 0.21	0.84 ± 0.24	1.00 ± 0.23	1.14 ± 0.28	.638	.085	.520
Days 0–21	0.82 ± 0.06^a	0.86 ± 0.11^ab	0.95 ± 0.14^ab	1.02 ± 0.17^b	.371	.031	.718

Notes: FCR was calculated by dividing the ADMI by its corresponding ADG. Mean values within a row with unlike superscript letters (a–d) were significantly different (P < .05).

NN, normal nutrient; HN, high nutrient; NL, nutrient level; BW, body weight; ADG, average daily gain; ADMI, average daily DM intake; FCR, feed conversion ratio; IUGR, intrauterine growth retardation; NBW, normal birth weight.

3.2. Leaf fat index and IMF

As given in Table 4, regardless of the NL, the LF weight/BW ratio of IUGR piglets was lower (P < .05) than that of NBW piglets. Increasing NL in diets could increase the IMF (P < .05) content of IUGR piglets. However, No interaction (P > .05) was found between BW and NL on the relative weight of the leaf fat and IMF content.

Table 4. Effects of NL on the leaf fat index and the content of IMF in longissimus dorsi of IUGR and NBW neonate piglets.

Items	NN		HN		P-value
	IUGR	NBW	IUGR	NBW	BW	NL	BW × NL
LF weight/BW (g/kg)	1.20 ± 0.26^a	1.67 ± 0.13^bc	1.32 ± 0.35^ab	2.01 ± 0.21^c	.001	.112	.392
IMF (%)	0.28 ± 0.06^a	0.31 ± 0.06^ac	0.42 ± 0.14^bc	0.44 ± 0.04^c	.624	.010	.874

Note: Mean values within a row with unlike superscript letters (a–c) were significantly different (P < .05).

LF, leaf fat; IMF, intramuscular fat; NN, normal nutrient; HN, high nutrient; NL, nutrient level; BW, body weight; IUGR, intrauterine growth retardation; NBW, normal birth weight.

3.3. The IGF-1, adiponectin, insulin and leptin levels

As given in Table 5, regardless of the NL, the serum leptin concentrations of IUGR piglets were higher (P < .05) than that of NBW piglets. HN increased the IGF-I and leptin concentrations (P < .05), and decreased the adiponectin concentrations (P < .05), but had non-significant (P > .05) on insulin concentrations in the serum of IUGR piglets. BW and NL had an interaction (P < .05) to increase the serum IGF-I concentrations, but non-significant (P > .05) effect on the serum adiponectin, insulin and letpin concentrations.

Table 5. The effects of NL on hormone level of intrauterine growth-retarded (IUGR) and normal birth weight (NBW) neonate piglets.

Items	NN		HN		P-value
	IUGR	NBW	IUGR	NBW	BW	NL	BW × NL
IGF-I (μg/L)	201.53 ± 20.7^a	220.01 ± 19.61^a	246.57 ± 21.70^bc	222.95 ± 1.89^ac	.780	.018	.034
Adiponectin (μg/L)	980.85 ± 156.17^a	883.04 ± 154.18^ac	708.11 ± 81.05^bc	741.62 ± 80.29^b	.613	.006	.309
Insulin (mIU/L)	36.55 ± 7.87^a	43.15 ± 4.01^ac	44.69 ± 3.04^bc	43.94 ± 3.41^ac	.263	.098	.165
Leptin (μg/L)	6.82 ± 0.89^a	5.72 ± 0.86^a	9.51 ± 0.70^b	7.11 ± 0.73^a	.004	.002	.184

Note: Mean values within a row with unlike superscript letters (a–c) were significantly different (P < .05).

IGF-I, insulin-like growth factor I; NN, normal nutrient; HN, high nutrient; NL, nutrient level; BW, body weight; IUGR, intrauterine growth retardation; NBW, normal birth weight.

3.4. Expression of genes in the liver, muscle and adipose tissue

The expression of gene involved in lipid metabolism in the liver, longissimus dorsi and abdominal fat are given in Table 6. Regardless of the NL, the mRNA levels of PGC-1α (P < .05) and SREBP-1c (P < .05) in longissimus dorsi of IUGR piglets were lower than those of NBW piglets. HN increased the mRNA expression of PGC-1α (P < .05) in liver, and PGC-1α (P < .05), C/EBPα (P < .05), CPT-1 (P < .05) and SREBP-1c (P < .05) in longissimus dorsi, but decreased the mRNA expression of CPT-1 (P < .05) in abdominal fat. In addition, BW and NL had the interaction on the mRNA expression of SREBP-1c (P < .05) in liver, and H-FABP (P < .05) and SREBP-1c (P < .05) in longissimus dorsi.

Table 6. Effects of NL on the expression of lipid gene in the longissimus dorsi, abdominal fat and liver of intrauterine growth-retarded (IUGR) and normal birth weight (NBW) neonate piglets.

Items	NN		HN		P-value
	IUGR	NBW	IUGR	NBW	BW	NL	BW × NL
Longissimus dorsi
PGC-1α	0.68 ± 0.11^a	1.0 ± 0.16^b	0.79 ± 0.12^ab	1.32 ± 0.19^c	<.001	.007	.148
CPT-1	1.21 ± 0.24^ab	1.0 ± 0.23^a	1.32 ± 0.26^ab	1.49 ± 0.08^b	.835	.019	.104
C/EBPα	0.86 ± 0.24^a	1.0 ± 0.25^ac	1.56 ± 0.48^bc	1.54 ± 0.27^b	.782	.012	.694
H-FABP	1.16 ± 0.26^a	1.0 ± 0.07^a	0.99 ± 0.36^a	1.64 ± 0.31^b	.103	.078	.008
SREBP-1c	0.81 ± 0.10^a	1.0 ± 0.13^a	0.99 ± 0.28^a	2.07 ± 0.18^b	.001	.001	.001
Abdominal fat
PGC-1α	1.03 ± 0. 37	1.0 ± 0.32	1.14 ± 0.40	1.18 ± 0.41	.983	.451	.847
CPT-1	0.99 ± 0.21^a	1.0 ± 0.06^a	0.69 ± 0.22^bc	0.74 ± 0.10^ac	.676	.001	.862
C/EBPα	0.79 ± 0.44^a	1.0 ± 0.24^ac	0.97 ± 0.31^bc	1.41 ± 0.67^a	.176	.214	.636
H-FABP	1.34 ± 0.28	1.0 ± 0.33	1.46 ± 0.28	1.50 ± 0.61	.498	.179	.397
SREBP-1c	0.66 ± 0.12	1.0 ± 0.09	0.91 ± 0.29	0.98 ± 0.21	.116	.234	.236
Liver
PGC-1α	0.94 ± 0.34^a	1.0 ± 0.03^ac	1.54 ± 0.37^bc	1.55 ± 0.46^bc	.873	.011	.922
CPT-1	1.36 ± 0.13^a	1.0 ± 0.09^b	1.13 ± 0.35^ab	1.18 ± 0.18^ab	.178	.833	.098
C/EBPα	0.75 ± 0.04	1.0 ± 0.21	0.92 ± 0.22	0.98 ± 0.11	.086	.361	.268
H-FABP	1.07 ± 0.01	1.0 ± 0.12	1.10 ± 0.47	1.10 ± 0.20	.795	.640	.786
SREBP-1c	1.04 ± 0.21^ab	1.0 ± 0.24^ab	0.78 ± 0.04^a	1.27 ± 0.30^b	.069	.961	.035

Note: Mean values within a row with unlike superscript letters (a–c) were significantly different (P < .05).

CPT-1, carnitine palmitoyltransferase-1; C/EBPα, ccat/enhancer-binding protein; SREBP-1c, sterol regulatory element-binding protein-1c; PGC-1α, peroxisome proliferators-activated receptor-γcoactivator-1α, H-FABP, heart fatty-acid-binding protein; NN, normal nutrient; HN, high nutrient; NL, nutrient level; BW, body weight; IUGR, intrauterine growth retardation; NBW, normal birth weight.

4. Discussion

In the previous studies, in polytocous species including the pig, there were variations in birth weight and skeletal muscle fibre number (Rehfeldt & Kuhn 2006). In the pig, undernutrition in utero causes low birth weight, and decrease in muscle fibre number and a reduction in postnatal growth rate, but the growth rate could be improved with increasing the feeding level (Campbell et al. 1984; Dwyer et al. 1994). Intestine, liver, kidney and pancreas are important organs involved in digestion, absorption and metabolism of dietary nutrients (Jobgen et al. 2006; Han et al. 2013) IUGR was found to reduce the visceral organ weight, impair intestinal growth by decreasing cell number and size as well as reduce the villi height. Our findings showed that IUGR piglets exhibited differential adipose deposition and mRNA expressions of lipid metabolism related to liver, abdominal fat and muscle by HN. Specifically, the changes of hormone level were more sensitive to HN in piglets with IUGR. Furthermore, postnatal HN during the suckling period allowed rapid postnatal catch-up growth in piglets with IUGR. In agreement with previous reports (Han et al. 2013), the present study showed that the BW of IUGR piglets were lower than NBW at 7 and 28 days of age, but IUGR piglets achieved catch-up growth when received HN. Therefore, it is possible that the growth retardation of IUGR piglets was due to the development of visceral organ and villi height was limited in utero, which reduced the absorption of nutrients. Increasing the NL in diets may promote the absorption of nutrition and skeletal muscle fibre hypertrophy or adipocyte differentiation proliferation to promote the IUGR piglets catch-up growth.

In this study, the LF weight/BW ratio of IUGR piglets was lower than that of NBW piglets. However, increasing NL in diets could increase the IMF content of IUGR piglets. The previous reports have shown that the lower birth weight of newborn animals reduced the weight of adipose tissue, and delayed the adipocyte proliferation or differentiation (Shelley 1961; Lapillonne et al. 1997), but the high-protein diet could increase the IMF content (Teye et al. 2006), which is similar to our results. It is possible that IUGR piglets used more nutrients to muscle or bone growth in utero, so the proliferation and differentiation of adipocyte cells was reduced hence the weight of adipose tissue was reduced. It is possible that IUGR piglets exhibited an increase in the proliferation and differentiation of adipocyte cells when the nutrient supply was adequate during the newborn period to promote the fat deposition. It maybe had tissues or time specificity of fat deposition and one of the reasons to IUGR piglets' catch-up growth.

Growth of adipose tissue results from both proliferation and differentiation of adipocyte precursor cells, and subsequent enlargement of the mature fat cells, which is under the control of hormones and growth factors (Gregoire et al. 1998; Louveau & Gondret 2004). Insulin stimulates the anabolic lipid metabolism pathways and regulates of maturation of pre-adipocytes into adipocytes, since in vitro, and is required for all adipocyte cell-type differentiation (Mersmann & Smith 2005). Adiponectin is a hormone secreted by adipocytes that regulates energy homoeostasis and glucose and lipid metabolism (Yamauchi et al. 2002). IGF-I regulates proliferation and differentiation of a multitude of cell types, and promotes animal growth (Cohick & Clemmons 1993). Leptin is the protein product of the obese gene and is involved in the regulation of food intake, BW and whole body energy balance (Barb et al. 2001). Accumulation of intracellular lipids due to deficient fatty-acid oxidation by mitochondria leads to the suppression of insulin signalling(Lowell & Shulman 2005) and insulin resistance(Krebs & Roden 2004). The previous reports have shown that lower BW has higher leptin concentrations of human than that of higher BW (Phillips et al. 1999), but had lower IGF-I concentrations in plasma of pigs than that of higher BW (Schoknecht et al. 1997). Our data are similar to the previous studies. It is possible that the hormone promoted more material to oxidation, letting more energy to maintain growth in utero.

Adipose tissue development is regulated by many genes (MacDougald & Lane 1995). A previous study has shown that, during adipogenesis, C/EBPs, SREBP-1c and PPARγ can regulate the development of fat-laden mature adipocytes (Rosen et al. 2000). H-FABPs may regulate fatty-acid uptake and intracellular transport (Storch & Thumser 2000). PGC-1α, coactivator by PPARγ, can activate specific gene expression associated with the conversion of pre-adipocytes to brown adipocytes (Tiraby & Langin 2003). CPT-1 catalyses the rate determining step in mitochondrial fatty-acid β-oxidation (Kerner & Hoppel 2000). Our results showed that the birth weight had no significant effect on the expression of gene in abdominal fat and liver, but high birth weight could increase the expression of PGC-1α, SREBP-1c in longissimus dorsi. The NL increased the expression of PGC-1α, C/EBPα, SREBP-1c in longissimus dorsi, the BW and NL had an effect on the expression of H-FABP in longissimus dorsi and SREBP-1c in longissimus dorsi and liver, which was consistent with the previous studies (Kim & Park 2008; Williams et al. 2009). It is possible that HN allowed the more nutrients to be used to the muscle fibre hypertrophy rather than fat deposition during the suckling period of IUGR piglets. Therefore, the gene expression of lipid metabolism was not affected by HN. But, the birth weight and NL had an effect on the growth and the fat deposition may be regulated via the expression of gene in muscles.

5. Conclusion

In conclusion, IUGR piglets' performance was lower than that of NBW piglets. 50% higher dietary nutrient concentration could improve growth performance of IUGR piglets, but the IUGR piglets could not achieve the same weight of NBW piglets at 28 days. Higher nutrient concentration increased the risk of lipid metabolic disorder in IUGR piglets, which may have a danger to the animal health in later growth.

Disclosure statement

No potential conflict of interest was reported by the authors.

Funding

This work was financially supported by the earmarked fund for the National 973 Project [2012CB124701], and the grant from National Natural Science Foundation of China [grant number. 31372323].