Association of polymorphisms in SLC11A1 gene with bovine tuberculosis trait among Indian cattle

ABSTRACT

In the present study, polymorphisms at two single nucleotide polymorphisms (SNPs)  and one microsatellite locus of SLC11A1 gene were investigated for finding their association with susceptibility to bovine tuberculosis trait (tuberculin reaction) in Indian cattle. A total of 245 animals were tested with single intradermal tuberculin test for screening positive animals for tuberculin reaction. At rs109915208 locus very low polymorphism information content of 0.0454 was observed, whereas it was moderate (0.352) at rs109453173 locus of SLC11A1. At rs109915208 locus the genotypic as well as allelic frequencies were differing significantly (p-value < .05) in case–control animals where the odds ratio (OR) of ‘CC’ verses ‘CT’ genotype and the OR of ‘C’ verses ‘T’ allele were approaching towards infinity, suggesting that animals having ‘CT’ genotype and ‘T’ allele were less susceptible for tuberculin reaction as compared to their contemporary genotype/allele. The significantly associated SNP was non-synonymous causing an amino acid change.

KEYWORDS:

• Bovine tuberculosis
• microsatellite
• tuberculin test
• SLC11A1
• SNPs

1. Introduction

The Mycobacterium tuberculosis comprises Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium canettii, Mycobacterium pinnipedii, Mycobacterium microti, Mycobacterium bovis and Mycobacterium bovis subspecies caprae responsible for causing chronic disease tuberculosis. However, M. bovis is the most universal pathogen among mycobacteria and affects many vertebrate animals of all age groups. In 46% of African, 44% of Asian and 35% of the South American and the Caribbean countries, sporadic and enzootic occurrences of bovine tuberculosis (bTB) have been reported (Cosivi et al. 1998). The bTB has significant public health importance, apart from being the most important disease with serious effects on animal production (O'Reilly & Daborn 1995). Generally treatment for bTB is not recommended in animals since there is no cost-effective treatment. The socio-economic condition of people in India and prevailing religious customs prevent the slaughtering of affected cows making bTB much difficult to eradicate. Therefore, there is an urgent need to develop some alternative strategies to combat infectious diseases.

An ideal approach to the control of the infectious diseases in animals is the development of genetic resistance. One of the candidate genes having role in resistance/susceptibility to infectious diseases is solute-like carrier family 11 A1 (SLC11A1) also known as NRAMP1 (Natural resistance-associated macrophage protein 1) (Ganguly et al. 2008; Prakash et al. 2014). NRAMP1 is a member of the solute carrier (SLC11A1) family of ion transporter (Horin & Matiasovic 2000), which is an integral trans-membrane protein and expresses particularly on phagosome of macrophage (Gruenheid et al. 1997). Genetic studies in mice have demonstrated SLC11A1 controls' innate resistance and susceptibility for M. bovis (Gros et al. 1981). The NRAMP1 gene mediates activity of macrophages against intracellular parasites during the early stages of infection (Blackwell et al. 1994). NRAMP1 affects the intraphagosomal microbial replication primarily by eliminating Mn²⁺ (Supek et al. 1996) or other divalent cations (Fe², Mn², Co², etc.) from phagosomal interior (Gruenheid & Gros 2000; Forbes & Gross 2003), which serve as essential cofactors for their survival by helping in many microbial metabolic processes. There are reports about association of SNPs in SLC11A1 to resistance/susceptibility to tuberculin reaction in humans as well as in animals (Puzyrev et al. 2002; Selvaraj et al. 2002; Qu et al. 2006). In the present study, an association of two polymorphic SNPs and one microsatellite marker pertaining to SLC11A1 genes with tuberculin reaction was observed.

2. Materials and method

A cattle population (N = 245) comprising Indigenous (Koshi, Sahiwal, Gir)/Nondescript and crossbred (two groups Indigenous/Nondescript verses crossbred) from Shri Mataji Gaushala, Barsana, Mathura, India, was selected for case and control study for bTB trait in cattle. All animals were kept in same herd had an equal opportunity of infection. Cattle of both sexes were aged from 2 to 8 years (two groups < 3 years verses ≥ 3 years) and kept under similar managemental and feeding practices. The tuberculin test was used for diagnosis of mycobacterium infection in herd, which is globally one of the most accepted tests for diagnosis of bTB. Single intradermal tuberculin test was performed and increase in thickness of skin after 72 h of intradermal injection of tuberculin antigen was noted to develop Case (tuberculin positive) and Control (tuberculin negative) resource panel as per the standard protocol. Bovine Purified Protein derivative (PPD) 0.1 ml was injected in cervical region and measurement of skin was taken before injecting PPD and after 72 h of Bovine PPD injection. Animals were divided into three groups: those showed marked swelling and skin thickness more than 4 mm (Positive), skin thickness < 4 mm and >2 mm (inconclusive) and no reaction > 2 mm (negative). The inconclusive animals were not included in the present investigation. A total of 35 tuberculin positive and 49 negative animals were included in the present study.

Approximately 6 ml of venous blood from Jugular vein was collected in an ethylenediaminetetraacetic acid coating tube (2 mg/ml of blood) and stored at −20°C till further use. DNA was extracted by using Promega Wizard^® Genomic DNA Purification Kit as per recommended protocols. The concentration of DNA was determined using Qubit Flurometer. Primers for the 2 SNPs (rs109915208 and rs109453173) were designed using Oligoanalyser while reported primer for SLC11A1 microsatellite marker was used for amplification of the loci. The details of primers and restriction enzymes are tabulated in Table 1. Concerned amplicons were amplified under the optimized PCR condition. The polymerase chain reaction (PCR) product are resolved in 1.5% agarose gel and visualized under UV light after staining with ethidium bromide. The Restriction enzyme digestion was made at the optimized conditions and the restriction digested products were resolved in 3– 5% agarose gel and visualized under UV light after staining with ethidium bromide. Mass genotyping of all case–control resource population was done by using PCR-RFLP (restriction fragment length polymorphism). The PROC ALLELE procedure of the SAS 9.3 used for the estimation of polymorphism information content (PIC), Hardy Weinberg Equilibrium (HWE) and heterozygosity. Initially in univariate logistic regression analysis, the non-genetic factors like age (two levels), sex (two levels) and breed (two levels) were fitted and found that none of these effects were significantly affecting the tuberculin test reaction. The PROC LOGISTIC procedure of SAS 9.3 was used to find association of allelic and genotypic frequencies with tuberculin reaction and to find out the overall association of the microsatellite loci with the tuberculin reaction status of the animal.

Table 1. Details of SNPs and microsatellite marker from Slc11A1 gene.

SNP	Chromo-some	SNP/repeat	Primer Sequence (5′–3′)	AT (°C)	RE	Fragments	Change of AA
rs109915208	2	C/T	TGGACTGGAGGGTAAGAACG AGGGAGGAATGCAGGTAGATG	59	Bpu10I	344, 215, 129	Ala-Val
rs109453173	2	C/G	ATCTCCTTCCTACTGCCCG CACAAACTGTCCCGCGTAG	58	PstI	374, 293, 81	Pro-Ala
Slc11A1	2	(CA)n	GGAATGAGTGGGCACAGTGGC CCTTCCAGAACTCCCTCTCCG	61	–	–	–

3. Results and discussion

Out of total screened 245 animals only 35 cattle (14.28%) were found to be positive for the tuberculin test. All non-genetic factors (breed, age and sex) had non-significant (p < .05) effect the tuberculin test reaction.

3.1. PCR-RFLP assay

The case–control population was genotyped by using PCR-RFLP for two SNPs from SlC11A1 gene and these SNPs were found to be polymorphic in our resource population. At rs109915208 locus, two genotypes, ‘CC’ (215 and 129 bp) and ‘CT’ (344, 215 and 129 bp) were found, while three genotypes ‘GG’ (293 and 81 bp), ‘CC’ (374 bp) and ‘CG’ (374, 293 and 81 bp) were observed at rs109453173 locus (Figure 1). A moderate heterozygocity (0.488) was observed at rs109453173 locus and it was very low (0.047) at rs109915208 locus. At rs109915208 locus very low PIC of 0.0454 was observed, whereas moderate PIC of 0.352 was estimated at rs109453173 single nucleotide polymorphism (SNP) locus. The population was in HWE for the SNPs pertaining to SLC11A1 gene.

Figure 1. PCR-RFLP profile of SNPs on 3.5% agarose gel.

The chi-square probabilities revealed that out of two SNPs from SLC11A1 gene, one had the significant association with the susceptibility to tuberculin reaction. At rs109915208 locus, the frequencies of ‘CC’ and ‘CT’ genotypes were 0.918 and 0.082, respectively, in control population, whereas only one genotype (CC) was present in case population (Table 3). The differences for the genotypic frequencies between case and control population were found to be statistically significant (p = .027). While the ‘T’ and ‘C’ alleles had the frequencies of 0.041 and 0.959, respectively, in the control population, whereas in the tuberculin test positive animals only ‘C’ allele was observed. The difference in allelic frequencies between case and control population was found significant (p = .03) (Table 2). At SNP locus (rs109453173), the genotypic as well as allelic frequencies did not differ significantly in case and control populations.

Table 2. Allelic frequencies and their association with susceptibility to the tuberculin test in case:control population.

SNP	Allele	Allelic frequency		p-Value	Odds ratio (95% CI)
		Case	Control
rs109915208	T	0 (0.00)	4 (4.08)	.03	1.00
	C	70 (1.000)	94 (95.92)		>999.9 (<0.001 to >999.999)
rs109453173	G	50 (71.43)	59 (60.20)	.13	1.00
	C	20 (28.57)	39 (39.80)		0.60 (0.31–1.16)

Table 3. Genotypic frequencies and their association with susceptibility to the tuberculin test in case:control population.

SNP	Genotype	Genotypic frequency		p-Value	Odds ratio (95% CI)
		Case	Control
rs109915208	CC	35 (1.000)	45 (91.84)	.027	>999.9 (<0.001 to >999.9)
	CT		4 (8.16)		1.00
rs109453173	GG	18 (51.43)	16 (32.65)	.22	1.00
	CC	3 (8.57)	6 (12.24)		0.44 (0.09–2.07)
	CG	14 (40.00)	27 (55.10)		0.46 (0.18–1.17)

The genotypes observed at rs109915208 locus showed significant association with the susceptibility to bovine tuberculin reaction in cattle. At rs109915208, the OR of ‘CC’ verses ‘CT’ genotype was approaching towards infinity, suggesting that animals having ‘CT’ genotype were less susceptible for tuberculin positive reaction as compared to ‘CC’ genotype. The OR of ‘C’ allele verses ‘T’ allele was approaching towards infinity, suggesting the association of ‘T’ allele with negative tuberculin test as compared to ‘C’ allele. The SNP (rs109915208) was non-synonymous which was causing an amino acid change of Alanine to Valine due to mutation of ‘C’ to ‘T’. The change of amino acids may have some role in susceptibility/resistance of animals for bovine tuberculin reaction.

NRAMP1 gene polymorphisms at 823 C/T (exon 8) are associated with resistance to human tuberculosis (Selvaraj et al. 2002). In a study in human, the G > C mutation of intron 4 of NRAMP1 gene was reported as a susceptible factor to Paratuberculosis (Qu et al. 2006). Studies at 469 + 14 G/C (INT4), 1465–85 G/A and C274T polymorphisms of NRAMP1 in ethnic Russians revealed that none of the polymorphisms was associated with tuberculosis (Puzyrev et al. 2002).

3.2. Microsatellite analysis

One microsatellite marker from intronic region of SLC11A1 was studied for its association with the tuberculin test. The locus was found to be highly polymorphic. A total number of six alleles and six genotypes were identified at this microsatellite locus (Table 4). Estimates of 0.61 for PIC and 0.68 for allelic diversity also revealed high polymorphism at this locus, however, the heterozygocity was moderate (0.50) at the locus. A non-significant association (p = .37) with the tuberculin test was observed for the microsatellite locus present inside gene SLC11A1 by the univariate logistic regression analysis, however one allele of 233 bp was differing significantly (p = .04) with the odds ratio towards infinity in tuberculin positive cases as compared to control population. However, all the observed genotypes differed non-significantly (p ≤ .05) in case versus control animals.

Table 4. Allelic and genotypic frequencies with their χ² probabilities at SLCLLA1-I locus in case verses control animals.

Sl no	Allele/Genotype	Allelic/Genotypic frequency		χ^2	Odds ratio
		Case	Control
Alleles
1	227	0.329	0.400	0.37	1.36 (0.70–2.64)
2	229	0.342	0.371	0.70	1.14 (0.59–2.21)
3	231	0.012	0.000	1.00	Infinity
4	233	0.049	0.000	0.04	Infinity
5	245	0.256	0.229	0.70	0.86 (0.41–1.82)
6	249	0.012	0.000	1.00	Infinity
Genotypes
1	227/227	0.293	0.343	0.64	1.26 (0.48–3.32)
2	227/245	0.073	0.114	0.70	1.63 (0.34–7.86)
3	229/229	0.122	0.200	0.35	1.80 (0.52–6.28)
4	229/245	0.439	0.343	0.39	0.67 (0.26–1.70)
5	231/249	0.024	0.000	1.00	Infinity
6	233/233	0.049	0.000	0.50	Infinity

The microsatellite locus investigated in the present study was reported to be significantly associated with occurrence of tuberculosis (Ali et al. 2009). One microsatellite marker from the 3′UTR region of SLC11A1 (NRAMP) gene was reported to be significantly (p < .001) associated with the incidence of bTB (Kadarmideen et al. 2011). Ali et al. (2013) reported a significant association of ILSTS005 and ILSTS006 microsatellite loci with Single Intradermal Comparative Cervical Tuberculin Test positive animals.

In summary, it could be concluded that SNPs of SLC11A1 gene had a significant role for the tuberculin reaction test, a key trait to bTB. But these findings need further validation of markers on larger population by including few more confirmatory diagnostic tests.

Disclosure statement

No potential conflict of interest was reported by the authors.