Effects of short photoperiod on cashmere growth, hormone concentrations and hair follicle development-related gene expression in cashmere goats

ABSTRACT

Shanbei White Cashmere goat is a typical goat species, the growth of cashmere is affected by photoperiod. To further investigate the effects of short photoperiod treatment on cashmere growth, hormone concentrations and hair follicle development-related gene expression in cashmere goats, twenty Shannbei white cashmere goats were selected and randomly divided into long-day photoperiod treatment group and short-day photoperiod treatment group. The results revealed the cashmere on short-day photoperiod treatment began to develop earlier, and its length and growth rate increased dramatically (P < 0.05). The short-day photoperiod treatment increased the concentration of serum Melatonin, reduced the concentration of serum prolactin, decreased the expression of estrogen receptor alpha and raised the expression of hair follicle development-related genes [catenin beta-1, Bone morphogenetic protein 2, Fibroblast growth factor 5 and platelet-derived growth factor subunit A] (P < 0.05), thereby accelerating the reconstruction of the secondary follicle, increasing the density of the secondary follicle (P < 0.05) and triggering the growth of cashmere goats. The present study provides new insights into the dynamic changes in cashmere growth, hormone concentrations and hair follicle development-related gene expression in cashmere goats under short photoperiod, and is expected to be useful for future studies on intensive feeding research.

KEYWORDS:

• Cashmere goat
• photoperiod
• hair follicles
• hormone
• gene

Introduction

Cashmere goats have primary hair follicles (PHFs) and secondary hair follicles (SHFs), which are two different types of skin follicles (Zhang et al. 2020). SHFs evolved into cashmere, while PHFs produced coarse hair (Ansari-Renani et al. 2011). Cashmere is a crucial raw material for the textile industry in the world with a substantial economic value (Liu et al. 2012).

The SHFs of cashmere goats are clearly periodic, requiring passage through the anagen, catagen and telogen phases (Rile et al. 2018). The periodicity of SHFs in cashmere goats is directly to the photoperiod. The reduction of daylight encouraged the development and manufacturing of cashmere (Zhang et al. 2019).

Changes in photoperiod influence the growth of cashmere by modulating hormones. The light causes the pineal gland to secrete melatonin (MT) by transmitting nerve impulses through the retina to the superior chiasmal nucleus, then the paraventricular nucleus, and lastly the pineal gland (Cassone 1990). MT is essential to the growth of cashmere. Welch found that injecting MT to goats increased cashmere production in September (Welch et al. 1990). Implantation of melatonin from July to September improved cashmere production (Klören and Norton 1995). MT implantation significantly prolongs the growth phase of cashmere in the winter solstice (Cong et al. 2011). Recent research indicates that melatonin stimulated Cashmere growth by boosting antioxidant levels (Yang et al. 2019). Studies have pointed out that thyroid hormones and 17β-estradiol (E2) also are involved with the growth of cashmere (Rhind and McMillen 1995; Movérare et al. 2002). These hormones interact with each other. MT induces the secretion of prolactin, which causes hair follicles to enter the anagen phase (Nixon et al. 1993; Foitzik et al. 2006; Plikus et al. 2008). The transformation of anagen, catagen, and telogen phases were regulated by some specific pathways (Millar 2002; Blanpain and Fuchs 2006). The Wnt/β-catenin signalling pathway is the primary regulator of epidermal and mesenchymal cell differentiation (Andl et al. 2002). β-catenin (catenin beta-1) is a crucial downstream component of the canonical Wnt signalling pathway that binds to insulin-like growth factor 1 (IGF-1) to create transcription factors that regulate the growth and development of hair follicles in animals. Bone morphogenetic protein (BMP) is a growth and differentiation agent that stimulates bone production (Myllylä R et al. 2014). The ratio of BMP to β-catenin activity controls the direction of hair follicle stem cell development (Plikus et al. 2008; Kandyba et al. 2013). Bone morphogenetic protein 2 (BMP2) and bone morphogenetic protein 4 (BMP4) are the two most biologically active genes in the BMP family, which primarily influence the periodic growth and development of hair follicles (Bai W et al. 2016). Platelet-derived growth factor subunit A (PDGFA) is expressed in epidermal and follicular epithelial cells, promotes the formation of dermal papilla, stromal sheath, and dermal fibroblasts, IGF-1 treatment can up-regulate the expression of PDGFA, inhibit apoptosis, promote hair follicle growth, and maintain hair follicles in the anagen phase (Ahn et al. 2012). However, the pattern of hair regeneration varies among different species (Plikus et al. 2011), with the majority of these studies focusing on humans and other animals. There are few studies relating the short-day photoperiod treatment to the cashmere growth of goats, particularly the Shanbei White Cashmere goat. Therefore, it is necessary to evaluate the association between the short-day photoperiod treatment and cashmere growth in cashmere goats. In this context, We hypothesized that the short-day photoperiod treatment could affect the Shanbei White Cashmere goat’s cashmere development, and the aim of this study was to compare the cashmere growth, hormone concentrations and hair follicle development-related gene expression of cashmere goats under short-day photoperiod and natural conditions, and to determine the effect of short-day light on the cashmere growth of the Shanbei White Cashmere goat by comparing these differences. This research will be of great use for farming cashmere goat in places with short photoperiods and enhancing cashmere production through suitable light regulation.

Materials and methods

Animals

This study was conducted from 15 May 2020 to 15 May 2021 at the Shaanbei White Cashmere Goat Farm in Yulin, Shaanxi province, China (latitude N37°38′, longitude E109°12′; altitude: 1498 m). Randomly selected 20 empty pregnant ewes from 130 healthy Shaanbei white cashmere goats aged 2.5 years old, similar in weight and body condition, and divided evenly between the treatment group and the control group. The use of animals and all experimental protocols (protocol number: 100403) were authorized by the Institutional Animal Care and Use Committee of Northwest A&F University (Yangling, Shaanxi, China, Approval ID: 2014ZX08008-002).

Photoperiodic manipulations

After a two-week acclimation period on a long-day photoperiod, ten female Shanbei White Cashmere goats (2.5 years old with an initial body weight of 34.12 ± 1.54 kg) were placed into short-day photoperiod treatment conditions (Receive light from 9:30 am to 16:30 pm, 7 h of light per day) as the treatment group, and they were housed in a dark environment for the remainder of the time. The illumination was controlled at approximately 0.1 lux (Illuminance in the dark) by closing the doors and using shade cloth to avoid sunlight. As the control group, 10 additional goats were housed in an identical shed with long-day photoperiod (Natural photoperiod, 12–13.5 h of light per day) conditions. All goats were fed and allowed to drink from 9:30 am to 16:30 pm daily . These goats were administered to identical feeding and management environmental conditions, and the shed was routinely sanitized and poop removed. These Shanbei White Cashmere goats were exposed to photoperiod treatment between 15 May 2020 and 15 October 2020 (153 days in total). The sampling period lasted from 15 May 2020 to 15 May 2021 (365 days in total).

Cashmere collection

On May 15, a 10-by-10-centimeter region on the right side of each goat was sheared to the skin level. Fibre samples from the shorn area were clipped at skin level using stainless steel clippers on 21 July and 21 August. Each clipping was obtained adjacent to the location of the last shearing but was always distinct from any previously sampling location. A 30 mm² patch of cashmere sample on the left scapular region of each goat was obtained at the beginning of harvest in the following April. Samples were separated into cashmere fibre and guard hair samples. Then, the cashmere fibre samples were stored in sealed polythene bags at room temperature for fibre characteristic analyses. Cashmere samples were collected annually at the end of April by combing or shearing and weighed using an electronic scale (CP214; OHAUS, USA).

Cashmere measurement

The cashmere fibre samples were soaked in carbon tetrachloride detergent solution overnight, rinsed thoroughly washed with deionized water and dried at 80°C. A total of 100 fibres were randomly chosen from each sampling date of each goat to measure the stretched length of the cashmere using a steel ruler to calculate the amount of cashmere growth, while 200 fibres were randomly selected for the diameter measurement using an optical fibre diameter analyzer (FZ-002; SRI, China).

Hair follicle density measurement

From the body side of the goats, approximately 1 cm² of skin tissues was taken, placed in Sample Protector (Takara, Dalian, China) and frozen at −80°C. After drying, the skin tissues were trimmed according to the cross-section, dehydrated by gradient ethanol, cleaned with xylene, embedded in paraffin, stained with HE, sealed with neutral gum and observed. Using digital microphotography (KEYENCE, Japan), The number of primary and secondary hair follicles in 10 complete hair follicles was recorded. ImageJ 1.60 image processing software was utilized to calculate the density of PHFs and SHFs in the skin area. The ratio of PHFs and SHFs was calculated.

Blood sampling

Blood samples were collected from a jugular vein using 5 mL EDTA-coated vacutainer tubes (KANGJIAN, China) to examine the effect of photoperiod treatment on hormone levels and hormone receptor gene expression in Shaanbei cashmere goats. Blood was drawn on the 15th of each month at 9:30 am Blood samples were allowed to stand at 37°C for 30 min before being centrifuged at 3 000 r / min for 15 min. The upper serum samples were collected and stored at −20°C for further analysis.

Hormone assay

Serum melatonin concentrations were measured using a commercial radioimmunoassay kit (HY 10177). The inter and intra-assay coefficients of variation (CVs) were 14% and 8.3%, respectively, while the sensitivity of the assay was 1.0 pg/ml. Serum prolactin concentrations were assessed using a ¹²⁵I-prolactin radioimmunoassay kit (HY-10026), and inter and intra-assay CVs were 10% and 5%, respectively. The sensitivity of the assay was 1.0 ng/ml. All commercial kits were provided by SINO-UK Institute of Biological Technology (Beijing, China).

Quantitative real-time polymerase chain reaction (qRT-PCR)

According to the manufacturer’s instructions, total RNA was extracted from skin tissues using the Eastep® Super Total RNA Extraction Kit (Promega, Shanghai, China). The concentration and quality of the extracted total RNA were assessed with the NanoDrop spectrophotometer (Bio-Rad, Benicia, USA). Complementary DNAs (cDNAs) were obtained from the reverse transcription of RNA with oligo (dT) primer using M-MLV reverse transcriptase kit (TaKaRa, Dalian, China). qRT-PCR was performed in triplicate on a Bio-Rad IQ5 Real-Time PCR system with a final volume of 25 μl containing 12.5 μl 2×SYBR® Premix Ex Taq^TMII (TaKaRa, Dalian, China), 1 μl of forward or reverse primer (10 μmol/L), 2 μl diluted template cDNA and 8.5 μl ddH₂O. The reaction conditions were carried out in accordance with the manufacturer's guidelines. Three technical replicates were allocated to each sample, and the average Ct value was determined. Using succinate dehydrogenase complex flavoprotein subunit A (SDHA) as the reference gene (Bai et al. 2014), the 2-ΔΔCt technique was used to calculate the relative expression of each gene. All sequences of primers are shown in Table 1.

Table 1. Primer sequences for quantitative real-time polymerase chain reaction (PCR).

Gene	GenBank ID	Full gene name	Primer sequence	Product length (bp)	Ta (1°C)
SDHA	XM_018065656.1	Succinate dehydrogenase complex, subunit A	F: AGCACTGGAGGAAGCACAC	105	53
			R: CACAGTCGGTCTCGTTCAA
TRβ	XM_005698927.2	Thyroid hormone receptor beta	F: ACTCTACGAAGCACACCCAG	208	55
			R: GTCCGAGTCCCTGCTTTTCA
TRα	XM_018065021.1	Thyroid hormone receptor alpha	F: GAATGGAACAGAAGCCAAGC	117	57
			R: TGCTGGTTTTCAGGGAACAT
PRLR	NM_001285669.1	Prolactin receptor	F: TGCAGCATCTAGAGTGGTTTTC	125	57
			R: AGGTGAACGTTTCCTTTCCA
ERα	XM_013966607.1	Estrogen receptor alpha	F: CGGTGGATGTGGTCCTTCTCT	234	61
			R: AGGGAAGCTCCTATTTGCTCC
ERβ	NM_001285688.1	Estrogen receptor beta	F: GCTAACCTGCTGATGCTCCTGTCTC	204	65
			R: GCCCTCTTTGCTCTCACTGTCCTC
RORα	NM_001285652.1	Receptor alpha	F: TGTGCTTCTCAAAGCAGGTT	120	56
			R: GATTTGAAGACATCGGGGCT
β-catenin	XM_018066894.1	Catenin beta-1	F: GCTGATTTGATGGAGCTGGA	182	58
			R: TCATACAGGACTTGGGTGGT
PDGFA	XM_018040679.1	Platelet-derived growth factor subunit A	F: CAGTCAGATCCACAGCATCC	85	56
			R: CAGACTGGTTTCCAAAGGCT
BMP2	NM_001287564.1	Bone morphogenetic protein 2	F: AAGAGGCATGTGCGGATTAG	129	58
			R: TTGCCGCTTTTCTCTTCTGT
BMP4	NM_001285646.1	Bone morphogenetic protein 4	F: GCTCTACGTGGACTTCAGTG	126	53
			R: TGGTTGGTTGAGTTGAGGTG

Ta:annealing temperature.

Statistical analysis

The data were done using Statistical Package for the Social Sciences (SPSS) ver. 20.0 (SPSS Inc., Chicago, IL, USA). The Shapiro–Wilk test was used to examine the data's normality. Student's t-test was used to examine differences between groups, and P values less than 0.05 were considered statistically significant. Results were presented as mean ± standard error (SE).

Results

Cashmere growth, fibre quality and hair follicle density

The cashmere treated with short-day photoperiod treatment began to develop earlier, and its length increased significantly from June to July and September to April the following year (P < 0.05; Figure 1A). In June and July, the cashmere growth rate increased significantly (P < 0.05; Figure 1B). The effect of short-day photoperiod treatment on the weight of cashmere fluff mixes and cashmere fibre diameter was insignificant (P > 0.05; Table 2). The cashmere fibre length of the treatment group rose by 1.25 cm (P < 0.05), although the cashmere weight did not differ substantially. (P > 0.05; Table 2).

Figure 1. Effects of short-day photoperiod treatment on growth length and growth rate of Shaanbei white cashmere goats. (A) Cashmere growth length of Shaanbei white cashmere goats. * P < 0.05. (B) Cashmere growth rate of Shaanbei white cashmere goats.Different letters means significant difference P < 0.05. Control: Long-day photoperiod treatment group; Treatment: Short-day photoperiod treatment group.

Table 2. Effects of short-day photoperiod treatment on cashmere fibre quality of Shaanbei white cashmere goats. Data are expressed as mean ± standard error (SE).

Items	Control	Treatment	P-value
Fluff mixtures weight (g)	1153.35 ± 145.11	1228.16 ± 66.58	0.462
Cashmere weight (g)	593.15 ± 51.04	692.49 ± 49.31	0.072
Cashmere fibre length (cm)	9.34 ± 0.46	10.59 ± 0.53	0.036
Cashmere fibre diameter (µm)	16.92 ± 0.98	17.15 ± 1.07	0.794

Note: Control: Long-day photoperiod treatment group.

Treatment: Short-day photoperiod treatment group.

Compared to the long-day photoperiod treatment, the short-day photoperiod treatment significantly decreased the primary hair follicle density in September (P < 0.05; Table 3), and increased the secondary hair follicle density in June and July (P < 0.05; Table 3). April had the lowest ratio of secondary to primary follicle density (S:P). In July and September, short-day photoperiod treatment significantly enhanced the S:P ratio (P < 0.05; Table 3).

Table 3. Effects of short-day photoperiod treatment on hair follicle density of Shaanbei white cashmere goats. Data are expressed as mean ± standard error (SE).

Month	Group	Primary follicle density (per mm-2)	p value	Secondary follicle density (per mm-2)	p value	S:P ratio	p value
May	Control	3.34 ± 0.50	0.371	22.08 ± 2.29	0.088	6.75 ± 0.70	0.427
	Treatment	2.75 ± 0.31		16.39 ± 1.86		6.03 ± 0.42
June	Control	3.00 ± 0.31	0.195	22.04 ± 0.87	0.049	7.44 ± 0.50	0.869
	Treatment	3.68 ± 0.30		27.56 ± 1.78		7.58 ± 0.66
July	Control	3.06 ± 0.29	0.691	21.50 ± 0.63	0.002	7.15 ± 0.65	0.027
	Treatment	3.19 ± 0.08		32.81 ± 1.32		10.33 ± 0.66
August	Control	3.37 ± 0.18	0.140	19.94 ± 1.40	0.101	5.98 ± 0.67	0.072
	Treatment	2.51 ± 0.43		22.95 ± 0.21		9.60 ± 1.34
September	Control	3.52 ± 0.05	0.001	24.45 ± 2.19	0.387	6.93 ± 0.54	0.048
	Treatment	2.61 ± 0.06		22.28 ± 0.44		8.62 ± 0.15
October	Control	2.68 ± 0.21	0.990	20.00 ± 1.59	0.312	7.51 ± 0.64	0.276
	Treatment	2.69 ± 0.12		17.92 ± 0.83		6.67 ± 0.16
November	Control	2.53 ± 0.29	0.194	18.18 ± 1.35	0.054	7.30 ± 0.69	0.542
	Treatment	3.02 ± 0.13		23.52 ± 1.44		7.77 ± 0.16
December	Control	2.44 ± 0.25	0.182	17.48 ± 1.15	0.182	7.22 ± 0.31	0.952
	Treatment	1.99 ± 0.12		14.51 ± 1.44		7.26 ± 0.47
January	Control	2.27 ± 0.12	0.347	16.94 ± 0.29	0.134	7.51 ± 0.47	0.889
	Treatment	2.05 ± 0.16		15.23 ± 0.89		7.44 ± 0.14
February	Control	1.84 ± 0.24	0.186	18.95 ± 3.41	0.118	10.18 ± 0.43	0.744
	Treatment	2.64 ± 0.44		27.11 ± 2.30		10.58 ± 1.05
March	Control	3.12 ± 0.11	0.235	20.74 ± 1.02	0.574	6.68 ± 0.55	0.401
	Treatment	2.89 ± 0.13		23.12 ± 3.75		8.05 ± 1.36
April	Control	3.72 ± 0.55	0.171	15.21 ± 1.00	0.776	4.33 ± 0.82	0.247
	Treatment	2.79 ± 0.04		15.72 ± 1.35		5.63 ± 0.50

Note: Control: Long-day photoperiod treatment group.

Treatment: Short-day photoperiod treatment group.

Serum hormone concentration

In June, July and September, Short-day photoperiod treatment significantly raised MT concentrations (P < 0.05; Figure 2A). In the short-day photoperiod treatment group, the cyclical fluctuations of MT concentrations fluctuated differently than in the long-day photoperiod treatment group from May to August, and MT concentrations kept at a high level from June to October in the short-day photoperiod treatment group (Figure 2A).

Figure 2. Effects of short-day photoperiod treatment on related hormone concentrations of Shaanbei white cashmere goats. (A) Melatonin (MT). (B) Prolactin (PRL). (C) Thyroxine (T4). (D) Estradiol (E2). * P < 0.05. Control: Long-day photoperiod treatment group; Treatment: Short-day photoperiod treatment group.

The initial peak of prolactin (PRL) concentrations in serum of long-day photoperiod treatment group occurred in July, followed by the second peak in October. Short-day photoperiod treatment significantly reduced PRL concentrations in June, July and December (P < 0.05; Figure 2B) and altered the periodic fluctuation of PRL (Figure 2B).

Short-day photoperiod treatment increased thyroxine 4 (T4) concentrations significantly in July, October and November (P < 0.05), but no significant difference in other months (Figure 2C).

In the short-day photoperiod treatment group, blood E2 concentrations were substantially higher in June, August, January, February and March (P < 0.05; Figure 2D).

Hormone receptor expression

In the long-day photoperiod treatment group, retinoid-related orphan receptor alpha (RORα) expression was lower in August, October and February and greater in November, March and April. The expression of RORα was considerably up-regulated in June, October, December and February and significantly down-regulated in July, November, January, March and April in the short-day photoperiod treatment group (P < 0.05; Figure 3A), delaying the expression peak to December (Figure 3A).

Figure 3. Effects of short-day photoperiod treatment on related hormone receptor expression of Shaanbei white cashmere goats. (A) Retinoid-related orphan receptor alpha (RORα).(B) Prolactin receptor (PRLR).(C) Thyroid hormone receptor alpha (TRα).(D) Thyroid hormone receptor beta (TRβ). (E) Estrogen receptor alpha (ERα). (F) Estrogen receptor beta (ERβ). * P < 0.05. Control: Long-day photoperiod treatment group; Treatment: Short-day photoperiod treatment group.

As shown in Figure 3, the expression of prolactin receptor (PRLR) in the long-day photoperiod treatment group increased from May until November, when it reached its initial peak, and then decreased. The short-day photoperiod treatment group showed similar patterns. With the short-day photoperiod treatment, PRLR expression was substantially higher in May, June, August, December, February and March (P < 0.05) and significantly lower in October and January (P < 0.05; Figure 3B).

The expression of thyroid hormone receptor alpha (TRα) in the short-day photoperiod treatment group was significantly higher in June and August and significantly lower in July, September, January, March and April (P < 0.05; Figure 3C).

The expression of thyroid hormone receptor beta (TRβ) in the long-day photoperiod treatment group showed a trend of increasing volatility from May and peaked in March of the following year. The short-day photoperiod treatment group advanced the expression peak of TRβ to February, significantly up-regulated the expression of TRβ in August, October, December and February, and significantly down-regulated the expression of TRβ in March (P < 0.05; Figure 3D).

The expression of estrogen receptor alpha (ERα) in the long-day photoperiod treatment group increased from May, reached a peak in August and then dropped. Short-day photoperiod treatment group significantly down-regulated the expression of ERα in July, August, January, March and April (P < 0.05). In September and October, the concentrations of ERα were elevated in the short-day photoperiod group (P < 0.05). The peak was postponed to October (Figure 3E).

In the long-day photoperiod treatment group, the expression of estrogen receptor beta (ERβ) was lowest in October and highest in January. In the short-day photoperiod treatment group, ERβ expression was significantly up-regulated (P < 0.05) in June, August, October and March, and significantly down-regulated in July, February and April (P < 0.05; Figure 3F), with the peak occurring in August.

Gene expression associated with hair follicle development

The expression of β-catenin in two groups increased gradually from May and reached the highest peak in November and then decreased. From May to July, the expression of β-catenin and Platelet Derived Growth Factor Subunit A (PDGFA) was considerably upregulated by Short-day photoperiod treatment (P < 0.05; Figure 4A; Figure 4B). With short-day photoperiod treatment, the first expression peak of PDGFA was observed in August, one month earlier than with long-day photoperiod treatment (Figure 4B). Compared with the long-day photoperiod treatment, the short-day photoperiod treatment increased the expression of bone morphogenetic protein-2 considerably from June to August (P < 0.05; Figure 4C). Short-day photoperiod treatment reduced the expression of bone morphogenetic protein-4 during July (P < 0.05; Figure 4D). Except for March, short-day photoperiod treatment dramatically raised the expression of Fibroblast growth factor 5 gene in all months (P < 0.05; Figure 4E).

Figure 4. Effects of short photoperiod treatment on the hair follicle development-related gene expression of Shaanbei white cashmere goats. (A) Catenin beta-1 (β-catenin). (B) Platelet-derived growth factor subunit A (PDGFA). (C) Bone morphogenetic protein 2 (BMP2). (D) Bone morphogenetic protein 4 (BMP4). * P < 0.05. Control: Long-day photoperiod treatment group; Treatment: Short-day photoperiod treatment group.

Discussion

Length, diameter and yield are important traits of cashmere, which determine the economic value of cashmere. Feral doe goats have seasonal characteristics, and the change of illumination time affects the growth rate, length and diameter of Australian cashmere goats (McDonald and Hoey 1987). The results of our investigation revealed that the short-day photoperiod treatment boosted cashmere length by 1.25 cm and cashmere output by 99.34 g, which increased by 16.75% year-on-year. Both hair follicle density and the S:P ratio are essential morphological parameters of villus hair follicles, having high heritability related to sheep wool production (Ansari-Renani et al. 2011). Previous research has demonstrated that melatonin can stimulate the growth of hair follicles (Feng and Gun 2021). Embedding MT in vitro induced cashmere growth in advance, prolonged the growth of the cashmere and increased the length of the cashmere (Welch et al. 1990; Cong et al. 2011). In this study, short-day photoperiod treatment reduced sunshine hours in June, July and September, and as melatonin production is directly related to light, there was less melatonin secretion during the day and more at night (Bedrosian et al. 2013). Due to the prolonged darkness, the MT concentration of the short-day photoperiod treatment group was significantly higher than that of the long-day photoperiod treatment group in June, July and September, which advanced the reconstruction of secondary hair follicles and stimulated the accelerated growth of cashmere.

MT has both membrane receptors (MT1, MT2 and MT3) and nuclear receptors (RORα, RORβ and RORγ) (Fischer et al. 2008; Cutando et al. 2011). The expression of membrane receptor was not detected in goat skin (Dicks et al. 1996). In addition, a prior study demonstrated that RORα was expressed in the secondary hair follicles of the hair shaft, inner root sheath, outer root sheath and medulla (Zhao et al. 2015). On the basis of these studies, we detected the relative expression of RORα gene in the samples and found that the expression of RORα in the long-day photoperiod treatment group peaked in November, but the short-day photoperiod treatment delayed the peak expression to December. Melatonin affects the transcriptional control of ROR (Karasek et al. 2003), and Fischer suggests that MT mediates the role of RORα in regulating hair growth (Fischer et al. 2008). Therefore, we compared MT concentration and RORα expression, and found that in the long-day photoperiod treatment group, RORα expression and MT concentration appeared opposite peaks in October, February and November. The result confirmed the negative correlation between MT concentration and RORα expression (Wang et al. 2013). In June and January, however, contrasting results emerged in the short-day photoperiod treatment group. We hypothesize that short-day treatment could affect the interaction between MT and RORα. But the relevant mechanism of action has not been elucidated and there are various controversies as to whether MT directly impacts RORα (Ma et al. 2021), so further research is required.

Previous research indicates that PRL has an inhibitory effect on hair cycle, with high concentrations promoting the termination of cashmere growth (Kloren and Norton 1993; Dicks et al. 1994; Craven et al. 2001). This is consistent with the results of our study. During the early stage of cashmere growth, from May to August, PRL concentrations were considerably lower in the short-day photoperiod treatment group than in the long-day photoperiod treatment group, Additionally, PRL and MT levels exhibited opposing tendencies simultaneously. MT is able to reduce PRL secretion (Rose et al. 1985; Emesih et al. 1993; Nixon et al. 1993; Dicks et al. 1995; Duan et al. 2017). By boosting MT concentrations to inhibit PRL levels in cashmere's early growth period, short-day photoperiod treatment may enhance the advanced growth of cashmere. PRL exerts its biological effects via receptor binding (Morammazi et al. 2016). During the anagen phase (August to December), high concentrations of PRL up-regulated PRLR expression, which peaked during the catagen (January to February) and telogen (March to April) phases, which supports the research findings of Nixon et al (Nixon et al. 2002).

T4 regulates the metabolism and growth of the body. Its secretion is related to the physiological state of an individual. The T4 concentrations of Australian cashmere goats were higher in the summer than in the winter, although the seasonal variation was not obvious (Kloren et al. 1993). The findings of this study agree with previous reports. Short-day photoperiod treatment significantly increased the T4 concentrations in the short-day photoperiod group in July, October and November, but did not significantly change the T4 secretion trend. In addition, short-day photoperiod treatment had no significant effect on their expression patterns.

The research conducted by Chanda demonstrated that E2 could promote suppression of the telogen to anagen transition. It induced hair follicles in the catagen phase to enter the telogen phase and regulated the hair follicle cycle (Chanda et al. 2000a). E2 increased gradually during the late catagen phase of SHFs (December). The SHFs were transformed from the anagen phase to catagen phase. In male mice, E2 regulated the vital movement of hair follicles by mediating the inhibition of telogen–anagen transition (Movérare et al. 2002). The catagen-promoting activities of E2 were mediated by Erα (Chanda et al. 2000b; Ohnemus et al. 2005). ERβ antagonized the mediated action of ERα and MT inhibited the expression of ERα (Ohnemus et al. 2005; Martinez-Campa et al. 2006). Our study demonstrated that short-day photoperiod treatment inhibited the expression of ERα between June and August, which is due to the increase of serum MT concentration and the up-regulation of expression of ERβ. These regulations attenuated the inhibition of hair follicle growth by E2 and promoted the growth and development of hair follicles.

Wnt / β-catenin signalling pathway plays a key role in the development of hair follicles. The expression of Wnt signalling can promote the development, occurrence and differentiation of hair follicles (Andl et al. 2002; Fu and Hsu 2013). Low expression of β-catenin stimulates hair follicle stem cell differentiation to epithelial and hair follicle sebaceous glands, while high expression of β-catenin induces hair follicle reconstruction (Silva-Vargas et al. 2005). Implantation of MT in vitro significantly up-regulated the expression of β-catenin gene in Inner Mongolia cashmere goats (Liu et al. 2016). The present study found that short-day photoperiod treatment boosted β-catenin gene expression during the early anagen phase of the cashmere growth (May to July).

The bone morphogenetic protein (BMP) signal pathway plays a crucial role in hair follicle morphogenesis and hair follicle cycling (Botchkarev and Kishimoto 2003). BMP signalling limits hair follicle cell growth and maintains hair follicles in the telogen period (Millar 2002). Our research revealed that short-day photoperiod treatment increased the expression of BMP2 gene during the early anagen phase, but had no effect on the expression of BMP4 during the telogen and catagen phases.

PDGF is a cell growth factor that inhibits apoptosis (Gruber et al. 2000). It is associated with hair follicle growth and angiogenesis (Kamp et al. 2003). Insulin-like growth factor 1 (IGF-1) treatment up-regulated the expression of PDGFA and platelet-derived growth factor subunit B (PDGFB), thereby inhibiting cell apoptosis. These regulations promote hair follicle growth and maintain hair follicles in the anagen phase (Ahn et al. 2012; Pazzaglia et al. 2019). Our research demonstrated that short-day photoperiod treatment increased PDGFA gene expression significantly during the early anagen phase.

Noggin is an inhibitor of BMP (Zimmerman et al. 1996). BMP is located downstream of Wnt /β-catenin (Suzuki et al. 2009). High expression of β-catenin up-regulated noggin expression (Plikus et al. 2008). PDGFA and SHH enhanced the expression of the noggin gene in dermal papilla cells. By upregulating the expression of -catenin and PDGFA genes in anagen, short-day photoperiod treatment suppressed the expression of the BMP4 gene, hence encouraging hair follicle rebuilding.

It has been reported that human hair follicles cultured in vitro and exposed to recombinant FGF5 enters into catagen phase prematurely (Higgins et al. 2014). In the early stages of the study, the serum FGF5 concentration and cashmere length of goats in the short-day photoperiod treatment group were significantly higher than those of the control group, suggesting that the increase in serum FGF5 concentration lead to the catagen phase of hair follicles, thus promoting cashmere growth.

Conclusion

In summary, under the short-day photoperiod treatment, primary hair follicle density dropped by 0.91 follicles/mm2 in September, secondary hair follicle density rose by 5.52 and 11.31 follicles/mm² in June and July. In addition, short photoperiod treatment elevated serum MT concentration, decreased serum PRL concentration, down-regulated the expression of ERα and up-regulated the expression of hair follicle development-related genes (β-catenin, BMP2,FGF5 and PDGFA). These changes accelerated the reconstruction and increased the density of secondary hair follicles, as well as raised the S:P ratio, which stimulated the faster growth and increased the quantity of cashmere.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This work was supported by Key Science and Technology Program of Inner Mongolia Autonomous Region [grant number 2021ZD0012]; China Agriculture Research System [grant number CARS-39-12]; Special Fund for Agro-scientific Research in the Public Interest [grant number 201303059].