Effects of Artemisia ordosica polysaccharide on growth performance and antioxidant capacity in broilers

ABSTRACT

This study aimed to investigate the effects of dietary Artemisia ordosica polysaccharide (AOP) supplementation on broilers’ growth performance and antioxidant function. A total of 288 1-day-old Arbor Acre broilers were randomly divided into 6 groups with 6 replicates each (n = 8). The groups contained a control diet group (basal diet, CON), an antibiotic diet group (basal diet + 50 mg/kg chlortetracycline, CTC) and AOP diet groups (basal diet containing 250, 500, 750, 1000 mg/kg AOP, respectively). The experiment included starter phase (days 1–21) and grower phase (days 22–42). The results showed that adding 750 mg/kg AOP increased the average daily gain (ADG), decreased feed/gain (F/G). Adding 500–1000 mg/kg AOP in the diet of broilers increased the activities of total antioxidant capacity (T-AOC), catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) in spleen, liver and small intestine (P < 0.05). The addition of AOP increased the gene expression levels of nuclear factor E2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), CAT, GSH-Px and SOD in Nrf2 signalling pathway. Our data suggested that AOP could improve broilers’ growth performance and antioxidant function. Therefore, AOP may be used as a growth promotion and antioxidant feed additive in broiler chickens instead of antibiotics.

KEYWORDS:

• Artemisia ordosica
• polysaccharide
• feed additive
• broiler
• antioxidant ability

Highlights

• Artemisia ordosica polysaccharide could promote the growth performance of broilers.

• Artemisia ordosica polysaccharide could promote the tissue antioxidant capacity of broilers.

Introduction

Broilers can be exposed to numerous stress-inducing factors that impair redox balance (Estévez 2015). Redox imbalance induces the excessive activity of free radical species, which causes oxidative damage to biological molecules such as lipids, proteins and DNA (Ryter et al. 2007). Oxidative damage may affect the health and product quality of broilers. In general, antibiotics are frequently used in poultry diets due to their positive effects on the health of birds. However, the extensive use of antibiotics for growth promotion and disease prevention leads to various problems, such as food safety and environmental pollution (Salim et al. 2018). In this case, natural feed additives like medicinal plants have received increased attention as possible antibiotic substitutes.

Artemisia ordosica is a perennial semi-shrubby herb belonging to the composite family, which is a representative plant in the arid and semiarid regions of north China, especially the Inner Mongolian district. The plant has been used in traditional Chinese/Mongolian medicine as an immune enhancer to treat rheumatoid arthritis, sore throat, carbuncle and common cold (Xiao et al. 2020). Artemisia ordosica contains numerous bioactive compounds, including polysaccharides, flavonoids, terpenoids, trace elements and essential oils that have an antioxidant effect and are necessary for the antioxidant system (Zhou et al. 2019). Furthermore, previous studies demonstrated that dietary supplementation of A. ordosica extracts enhanced the antioxidant capacity and growth performance in broilers and weanling piglets (Li et al. 2017; Xing et al. 2019). However, the exact compounds with the antioxidant effects in A. ordosica extracts are not well characterized.

Plant polysaccharides have aroused interest since some have immune regulation, antioxidant, anti-cancer, antimicrobial and antiviral capacities (Javad et al. 2019; Li et al. 2019a). As an important source of antioxidants, AOP has great antioxidant activity in vivo and in vitro (Xing et al. 2020). Previous studies indicated that Artemisia selengensis Turcz polysaccharide has significant antioxidant activity in mice, which is achieved by scavenging free radicals and secreting antioxidant enzymes (Wang et al. 2016, 2020). Our lab found similar results, with AOP improving gut function and antioxidant capacity in rat (Xing et al. 2020). In addition, AOP regulation of the Nrf2/Keap1 signaling pathway alleviated the LPS-induced decrease in the activities of SOD, CAT and GSH-Px in the liver of broilers (Xing et al. 2021). Hence, considering the mentioned pharmaceutical advantages of A. ordosica derivatives, based on a previous study, the antioxidant activity in vivo of AOP was analysed by broiler experiment to investigate the impact of different levels of AOP on broiler growth performance and antioxidant function, and to provide a theoretical basis for the application of AOP in poultry feed.

Materials and methods

Preparation of AOP

The ground part of A. ordosica was collected in July from Ordos district, Inner Mongolia, China. According to our previous study, the AOP was extracted by using the water-extraction-ethanol-precipitation method. Briefly, the grated dry A. ordosica was degreased by petroleum ether in the soxhlet apparatus for 12 h. After degreased, 200 g of A. ordosica powder was extracted with 3.08 L of water at 60℃ for 4.3 h. The aqueous extract was filtered and concentrated to 1/5 of the original liquid. The concentrated liquid was precipitated by absolute ethanol (the ratio of ethanol to liquid was 4:1, v/v) at 4℃ for 48 h, then centrifuged at 12,000×g for 15 min to obtain crude polysaccharides. The crude polysaccharide was washed with petroleum ether, acetone and ethanol. Then the polysaccharide was deproteinated twice with the mixture of n-butyl alcohol and chloroform (1:4, v/v) following the modified Sevag method (Zhang et al. 2019; Li, Chen et al. 2019; Long, Kang, et al. 2020). The obtained solution was dialysed using a biological semipermeable membrane (500 Da cutoff, Beijing Solarbio Science and Technology Co, Ltd, Beijing, China) against distilled water at 4°C for 2 days. The resulting solution was vacuum evaporated to obtain the AOP powder. The sugar content of the AOP was 52.65%. AOP was composed of arabinose, galactose, glucose, xylose, mannose, galacturonic acid and glucuronic acid with a molar ratio of 6.87:10.67:54.13:2.49:18.37:4.83:2.64.

Experimental broilers and management

A total of 288 broilers were randomly divided into 6 treatment groups with 6 replicates, 8 birds in each replicate. The control (CON) group was fed a basal diet, and the treatment groups were fed the basal diet supplemented with 250, 500, 750, 1000 mg/kg polysaccharide of A. ordosica and 50 mg/kg chlortetracycline (CTC), respectively. The experiment lasted for 42 days. Maize–soybean-based basal diet (Table 1) was formulated according to the NRC (1994) nutrient requirement of broilers. During the entire experimental period, all birds were housed in single-layer cages with plastic bottom mesh and 8 birds/cage (100 × 50 × 50 cm), and were provided with feed and water ad libitum. The room temperature was maintained about 32℃ to 34℃ for 7 days. Then gradually reduced to 21℃ at the rate of 3°C per week and then kept constant thereafter. All the animal experimental procedures were conducted by the national standard Guideline for Ethical Review of Animal Welfare (GB/T 35892-2018) and approved by the Animal Welfare and Ethics Committee of Inner Mongolia Agricultural University.

Table 1. Composition and nutrient levels of basal diets (air-dry basis, %).

Ingredients	1–21 days of age	22–42 days of age
Corn	52.50	58.80
Soybean meal	40.00	33.80
Soybean oil	3.00	3.00
Dicalcium phosphate	1.90	1.80
Limestone	1.08	1.22
Salt	0.37	0.37
Lysine	0.05	0.03
Methionine	0.19	0.07
Premix^a	0.80	0.80
Choline	0.11	0.11
Total	100.00	100.00
Nutrient levels^b
Metabolic energy (MJ/kg)	12.42	12.62
Crude protein	21.77	19.65
Calcium	1.00	1.02
Available phosphorus	0.44	0.42
Lysine	1.34	1.15
Methionine	0.55	0.40
Cystine	0.40	0.36

^a Premix provided the following per kilogram of diet: vitamin A 9000 IU; vitamin D₃ 3000 IU; vitamin E 26 IU; vitamin K₃ 1.20 mg; vitamin B₁ 3.00 mg; vitamin B₂ 8.00 mg; vitamin B₆ 4.40 mg; vitamin B₁₂ 0.012 mg; niacin 45 mg; calcium pantothenate 15 mg; folic acid 0.75 mg; biotin 0.20 mg; choline chloride 1100 mg; Fe 100 mg; Cu 10 mg; Zn 108 mg; Mn 120 mg; I 1.5 mg; Se 0.35 mg.

^b Crude protein was measured value, while others were all calculated values.

Sample collection

On days 21 and 42, six broilers per treatment (one bird per replicate) were chosen and weighed after 12 h fasting. Birds were euthanized by cervical dislocation and their abdomens were opened rapidly. After that, the liver, spleen and small intestine tissues were collected, then frozen in liquid nitrogen and stored at −80°C until analysis.

Growth performance

On days 1, 21 and 42, bird weight and feed intake were recorded and the average daily gain (ADG), average daily feed intake (ADFI) and feed/gain (F/G) ratio were calculated for each replicate.

Assay of antioxidant indices in tissue samples

Spleen, liver and small intestine tissues were minced and homogenized in saline (0.9%), then centrifuged at 12,000×g for 10 min at 4°C. The resulting supernatant was used to determine total antioxidant capacity (T-AOC), the activities of antioxidative enzymes including catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px), and the indicator of lipid peroxidation malondialdehyde (MDA). Antioxidant indexes and protein were measured by commercially available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China, Model numbers A045-2-2, A015-2-1, A007-1-1, A003-1-2, A005-1-2). All procedures were conducted by the manufacturer’s instructions.

Total RNA extraction and reverse transcription

Total RNA in spleen, liver and small intestine tissues was isolated by using Trizol reagent (TaKaRa Biotechnology Co. Ltd, Dalian, China). The RNA was quantified and qualitatived with an ultraviolet spectrophotometer (Pultton P200CM, San Jose, CA, USA). According to the manufacturer’s instructions, cDNA was synthesized from 1 μg of total RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio Inc., Otsu, Japan).

Quantitative real-time PCR

Fluorescence quantitative PCR was performed to detect the mRNA expressions of β-actin, CAT, SOD, GSH-Px, heme oxygenase-1 (HO-1) and nuclear factor E2-related factor 2 (Nrf2) according to the SYBP Premix ExTaq (TAKARA, China Dalian) manual. The RT-PCR primers are indicated in Table 2. The following PCR conditions were applied: CAT, SOD, GSH-Px, HO-1 and Nrf2 with 95°C for 300 s; followed by 35 cycles of 95°C for 5 s and 60°C for 33 s; then 95°C for 10 s, 60°C for 60 s; β-actin with 95°C for 300 s; followed by 40 cycles of 95°C for 10 s, 60°C for 33 s, 72°C for 45 s; then 95°C for 10 s, 60°C for 60 s. The mRNA levels were normalized as the ratio to β-actin mRNA in arbitrary units using the 2^−ΔΔCT method.

Table 2. Primer sequences and parameter.

Genes	GenBank no.	Primer sequences (5’–3’)	Length (bp)	Ta (°C)
β-actin	NM_205518	F. GCCAACAGAGAGAAGATGACAC R. GTAACACCATCACCAGAGTCCA	118	60
CAT	NM_001031215.1	F. GTTGGCGGTAGGAGTCTGGTCT R. GTGGTCAAGGCATCTGGCTTCTG	182	60
GPx7	NM_001163245.1	F. CAAAGTTGCGGTCAGTGGA R. AGAGTCCCAGGCCTTTACTACTTTC	136	60
SOD	NM_205064.1	F. TTGTCTGATGGAGATCATGGCTTC	98	60
		R. TGCTTGCCTTCAGGATTAAAGTGA
HO-1	HM237181.1	F. GGTCCCGAATGAATGCCCTTG	138	60
		R. ACCGTTCTCCTGGCTCTTGG
Nrf2	NM_205117.1	F. GATGTCACCCTGCCCTTAG R. CTGCCACCATGTTATTCC	215	60

CAT = catalase; GPx7 = glutathione peroxidase7; SOD = superoxidase dismutase; HO-1 = heme oxygenase-1; Nrf2 = transcription factor nuclear factor- erythroid 2 (E2)-related factor 2.

Statistical analysis

One-way ANOVA with the GLM procedure was conducted by the SAS 9.2 (SAS Institute Inc., Cary, NC). The statistical differences among treatments were determined by the Duncan test. All data were expressed as the mean and standard error of the mean (SEM). P < 0.05 was considered as statistically significant.

Results

Growth performance

The growth performance results of broilers were shown in Table 3. ADG on the grower phase (from days 22 to 42) was significantly improved in the 750 mg/kg AOP group compared with the CON group (P < 0.05). Overall (days 1–42), ADG in the 750 mg/kg AOP group was significantly higher than that of the CON group (P < 0.05), and F/G was significantly lower than that of the CON group (P < 0.05), but there was no significant difference compared with the CTC group (P > 0.05).

Table 3. Effects of AOP on growth performance of broilers.

Items	AOP supplemental level (mg/kg)					CTC (mg/kg)	SEM	P-value
	0	250	500	750	1000	50
1–21 d	27.08	29.11	29.12	29.14	29.32	27.81	1.14	0.67
22–42 d	68.50^b	69.12^b	69.79^ab	74.42^a	72.82^ab	72.82^ab	1.45	0.03
1–42 d	49.90^c	50.09^c	51.62^bc	54.29^a	53.57^ab	53.05^ab	0.65	0.04
1–21 d	41.20	41.31	40.34	41.34	41.92	40.25	1.14	0.89
22–42 d	135.37	142.37	141.57	142.28	136.67	139.15	4.65	0.72
1–42 d	84.82	87.89	87.01	89.40	87.04	87.34	2.73	0.93
1–21 d	1.52	1.42	1.39	1.42	1.43	1.45	0.03	0.26
22–42 d	2.04	1.99	2.09	2.02	2.01	1.91	0.03	0.06
1–42 d	1.83^ab	1.82^ab	1.83^ab	1.69^c	1.73^bc	1.73^bc	0.02	0.04

^a ADG = average daily body weight gain; ADFI = average daily feed intake; F/G = feed/gain ratio.

^abc Different letters within the same row denote differ significantly between treatments.

Antioxidant status in tissues

The results of the antioxidant index in the spleen were shown in Table 4. Diets supplemented with 750–1000 mg/kg AOP significantly elevated the activity of spleen CAT compared with the CON group on d 21 (P < 0.05). The 1000 mg/kg AOP group had higher spleen SOD activity than in CON and CTC groups (P = 0.05). Moreover, diets supplemented with 1000 mg/kg AOP significantly enhanced spleen T-AOC compared with the CON (P < 0.05). However, there was no significant difference in GSH-Px and MDA among treatments on day 21 (P > 0.05).

Table 4. Effect of AOP on spleen antioxidant capacity in broilers.

Items	AOP supplemental level (mg/kg)					CTC (mg/kg)	SEM	P-value
	0	250	500	750	1000	50
21 d
CAT,	1.15^b	1.28^ab	1.31^ab	1.48^a	1.49^a	1.19^ab	0.07	0.02
U/mg prot.
SOD,	120.80^b	145.09^ab	140.30^ab	128.60^ab	151.07^a	117.95^b	7.35	0.05
U/mg prot.
T-AOC,	37.42^b	44.80^ab	38.57^b	46.87^ab	59.21^a	50.62^ab	2.86	0.03
µmol/g prot.
GSH-Px,	27.85	29.77	26.05	26.13	27.51	27.49	2.52	0.97
U/mg prot.
MDA,	0.58	0.62	0.59	0.64	0.54	0.61	0.07	0.96
nmol/mg prot.
42 d
CAT,	0.84^c	0.86^c	1.09^bc	1.78^a	1.18^b	1.23^b	0.06	<0.01
U/mg prot.
SOD,	151.04	179.86	162.78	180.08	167.85	154.64	17.12	0.79
U/mg prot.
T-AOC,	28.98^b	39.77^ab	37.05^ab	44.17^a	30.10^b	31.18^b	2.60	0.01
µmol/g prot.
GSH-Px,	34.22^b	40.23^ab	37.59^b	47.26^a	35.74^b	42.33^ab	2.56	0.04
U/mg prot.
MDA,	1.07^a	0.81^b	0.78^b	0.82^b	0.78^b	0.99^ab	0.07	0.05
nmol/mg prot.

^a CAT = catalase; SOD = superoxidase dismutase; T-AOC = total antioxidant capacity; GSH-Px = glutathione peroxidase; MDA = malondialdehyde.

^abc Different letters within the same row denote differ significantly between treatments.

On day 42, a diet supplemented with 750 mg/kg AOP significantly enhanced spleen CAT activity compared with the other groups (P < 0.01). The activity of GSH-Px in the 750 mg/kg AOP group was higher than that in the CON group (P < 0.05). Furthermore, there was no significant difference between the AOP and CTC groups in GSH-Px (P > 0.05). T-AOC in the 750 mg/kg AOP group showed a significant increase compared to that of the CON group and CTC group (P = 0.01). Broilers in the AOP groups had lower MDA concentration than those in the CON and CTC groups (P < 0.05). There were no significant differences in SOD among treatments on day 42 (P > 0.05).

The activity of antioxidant enzymes in the liver was shown in Table 5. On day 21, broilers fed 1000 mg/kg AOP showed a lower MDA concentration than broilers in CON (P = 0.05). There were no significant differences in treatments in T-AOC, CAT, SOD and GSH-Px (P > 0.05).

Table 5. Effect of AOP on liver antioxidant capacity in broilers.

Items	AOP supplemental level (mg/kg)					CTC (mg/kg)	SEM	P-value
	0	250	500	750	1000	50
21 d
CAT,	17.91	15.86	14.23	14.63	14.23	13.73	1.13	0.20
U/mg prot.
SOD,	530.09	469.99	449.52	497.18	455.60	455.46	44.49	0.86
U/mg prot.
T-AOC,	40.43	40.61	38.74	42.25	40.22	33.70	4.49	0.83
µmol/g prot.
GSH-Px,	37.99	30.08	32.87	34.12	34.03	32.70	2.84	0.59
U/mg prot.
MDA,	0.71^a	0.70^ab	0.64^abc	0.61^abc	0.52^bc	0.50^c	0.04	0.05
nmol/mg prot.
42 d
CAT,	13.47	12.01	11.93	10.21	14.55	11.86	1.79	0.71
U/mg prot.
SOD,	319.54^c	314.76^c	347.13^bc	386.79^ab	384.92^ab	427.31^a	17.55	<0.01
U/mg prot.
T-AOC,	16.51^b	21.98^ab	23.80^a	24.26^a	24.66^a	25.78^a	1.83	0.04
µmol/g prot.
GSH-Px,	29.61	26.90	24.08	23.33	25.95	27.24	2.69	0.66
U/mg prot.
MDA,	0.72	0.75	0.87	0.64	0.67	0.67	0.04	0.36
nmol/mg prot.

^a CAT = catalase; SOD = superoxidase dismutase; T-AOC = total antioxidant capacity; GSH-Px = glutathione peroxidase; MDA = malondialdehyde.

^abc Different letters within the same row denote differ significantly between treatments.

On day 42, the SOD activity in 750 and 1000 mg/kg AOP groups was higher than that in the CON group (P < 0.01). Diets supplemented with 500–1000 mg/kg AOP significantly elevated T-AOC in the liver compared with CON (P < 0.05). There was no significant difference between the AOP and CTC groups in T-AOC (P > 0.05).

Table 6 showed the effects of different dietary levels of AOP on intestinal antioxidant indexes of broilers on day 21. The ileum CAT activity in the 1000 mg/kg AOP group was significantly higher than that in the CON group (P < 0.05), but there was no significant difference with the CTC group. There was no significant difference in CAT activity in the duodenum and jejunum of broilers among different treatment groups (P > 0.05). The SOD activity in the duodenum of 500 mg/kg AOP group and ileum of 1000 mg/kg AOP group was significantly higher than that in the CON group (P = 0.01). The SOD activity in the ileum of the 750 mg/kg AOP group was significantly higher than that in the CON and CTC groups (P = 0.01). There was no significant difference in SOD activity in the jejunum of broilers among different treatment groups (P > 0.05). The activity of GSH-Px in the jejunum in 1000 mg/kg AOP group was significantly higher than that in the CON group (P < 0.01). The activity of GSH-Px in the jejunum in the 750 mg/kg AOP group was significantly higher than that in the CON group and CTC group (P < 0.01). There was no significant difference in GSH-Px activity in the duodenum and ileum among all treatment groups (P > 0.05). Duodenal T-AOC capacity of 500 mg/kg AOP and 1000 mg/kg AOP groups was significantly higher than that of the CON group (P < 0.05), but there was no significant difference with the CTC group. Dietary 750 mg/kg AOP significantly increased the T-AOC capacity in ileum (P < 0.01). The content of MDA in the jejunum in the 500 mg/kg AOP group was significantly lower than that in the CON group (P = 0.01). The 1000 mg/kg AOP group was significantly lower than that in the CON and CTC groups (P = 0.01). There was no significant difference in MDA content in the duodenum and ileum among all treatment groups (P > 0.05).

Table 6. Effect of AOP on small intestine antioxidant parameters in broilers on day 21.

Items		AOP supplemental level (mg/kg)					CTC (mg/kg)	SEM	P-value
		0	250	500	750	1000	50
CAT,	Duodenum	1.57	1.32	1.29	0.90	1.26	1.53	0.14	0.32
U/mg prot.	Jejunum	1.65	1.73	1.36	1.47	1.64	1.59	0.16	0.74
	Ileum	1.57^b	1.55^b	2.20^ab	2.41^ab	3.10^a	3.00^a	0.29	0.04
SOD,	Duodenum	225.32^b	227.83^ab	280.98^a	233.87^ab	250.78^ab	283.22^a	10.20	0.01
U/mg prot.	Jejunum	224.06	230.48	216.18	205.09	223.46	231.57	15.92	0.96
	Ileum	286.50^c	295.09^bc	322.94^bc	414.75^a	381.22^ab	313.37^bc	16.73	0.01
GSH-Px,	Duodenum	10.43	8.88	5.25	10.25	6.19	6.19	2.94	0.71
U/mg prot.	Jejunum	2.50^c	4.52^bc	2.22^c	9.89^a	6.31^b	2.93^bc	0.76	<0.01
	Ileum	41.50	42.05	35.81	33.10	46.07	28.82	3.06	0.08
T-AOC,	Duodenum	60.95^b	67.00^ab	85.06^a	78.98^ab	84.71^a	79.92^ab	4.49	0.02
µmol/g prot.	Jejunum	51.00^b	58.06^ab	58.94^ab	52.01^b	51.83^b	68.93^a	4.00	0.02
	Ileum	64.48^c	57.06^c	65.03^c	166.11^a	111.50^b	129.42^b	6.86	<0.01
MDA,	Duodenum	0.63	0.51	0.63	0.37	0.31	0.69	0.12	0.69
nmol/mg prot.	Jejunum	0.29^a	0.27^a	0.19^bc	0.24^ab	0.18^c	0.25^ab	0.02	0.01
	Ileum	0.40	0.39	0.52	0.55	0.58	0.46	0.07	0.45

^a CAT = catalase; SOD = superoxidase dismutase; T-AOC = total antioxidant capacity; GSH-Px = glutathione peroxidase; MDA = malondialdehyde.

^abc Different letters within the same row denote differ significantly between treatments.

Table 7 showed the effect of different dietary levels of AOP on the antioxidant index in the small intestine of the broiler on day 42. The CAT activity of jejunum in the 750 mg/kg AOP group was significantly higher than that in the CON group (P < 0.05), but there was no significant difference between the 750 mg/kg AOP group and CTC groups. There was no significant difference in CAT activity in the duodenum and ileum among treatment groups (P > 0.05). The SOD activity of the duodenum and ileum in the 500–750 mg/kg AOP group was significantly higher than that in the CTC group (P < 0.05). The SOD activity in jejunum in the 500 and 750 mg/kg AOP groups was significantly higher than that in the CTC group (P < 0.01). Duodenal GSH-Px activity in the 250–750 mg/kg AOP groups was significantly higher than that in the CTC group (P < 0.05). The activity of ileum GSH-Px in 750 and 1000 mg/kg AOP groups was significantly higher than that in the CON group (P = 0.01). There was no significant difference between the AOP and CTC groups. The T-AOC ability in jejunum in 1000 mg/kg AOP group was significantly higher than that in the CON group (P < 0.01). The ileum T-AOC of 500 and 750 mg/kg AOP groups was significantly higher than that of the CON group (P < 0.05), but there was no significant difference between the AOP and CTC groups. The ileum MDA content in the 750–1000 mg/kg AOP group was significantly lower than that in the CON group (P < 0.05), but there was no significant difference between the AOP and CTC groups. There was no significant difference in MDA content in the duodenum and jejunum among all treatment groups (P > 0.05).

Table 7. Effect of AOP on small intestine antioxidant parameters in broilers on day 42.

Items		AOP supplemental level (mg/kg)					CTC (mg/kg)	SEM	P-value
		0	250	500	750	1000	50
CAT,	Duodenum	1.54	1.20	1.44	0.91	0.89	1.12	0.18	0.16
U/mg prot.	Jejunum	0.88^b	1.13^ab	1.20^ab	1.68^a	1.28^ab	1.14^ab	0.14	0.04
	Ileum	4.03	3.80	3.67	3.53	3.66	3.75	0.19	1.00
SOD,	Duodenum	260.44^ab	262.65^ab	270.61^a	286.14^a	204.96^b	212.94^b	19.59	0.05
U/mg prot.	Jejunum	216.85^a	175.70^b	222.50^a	221.63^a	162.89^b	173.01^b	9.80	<0.01
	Ileum	371.89^a	377.63^a	403.35^a	357.40^a	271.90^b	280.30^b	17.96	0.02
GSH-Px,	Duodenum	12.37^abc	15.39^ab	17.51^a	14.44^ab	9.78^bc	7.44^c	1.78	0.01
U/mg prot.	Jejunum	5.05	3.70	4.71	3.33	4.70	4.15	0.82	0.80
	Ileum	5.57^b	9.02^b	12.62^ab	17.95^a	17.50^a	16.95^a	1.84	0.01
T-AOC,	Duodenum	85.39	86.49	82.08	77.29	83.57	83.97	2.73	0.47
µmol/g prot.	Jejunum	44.41^b	39.81^b	49.3^ab	49.83^ab	57.99^a	46.70^a	2.57	<0.01
	Ileum	70.04^b	85.74^ab	98.82^a	96.19^a	67.41^b	86.11^ab	6.66	0.03
MDA,	Duodenum	0.70	0.68	0.67	0.56	0.61	0.71	0.08	0.88
nmol/mg prot.	Jejunum	0.19	0.20	0.18	0.22	0.19	0.15	0.02	0.65
	Ileum	0.48^a	0.43^ab	0.47^a	0.39^b	0.30^c	0.35^bc	0.02	<0.01

^a CAT = catalase; SOD = superoxidase dismutase; T-AOC = total antioxidant capacity; GSH-Px = glutathione peroxidase; MDA = malondialdehyde.

^abc Different letters within the same row denote differ significantly between treatments.

Antioxidant gene expression in tissues

The role of AOP on antioxidant status was evaluated by measuring the gene expression of antioxidant enzymes. Table 8 showed the mRNA expression of antioxidant enzymes in the spleen. On day 21, the highest mRNA expression level of SOD, CAT and Nrf2 in the spleen was observed in the 750 mg/kg AOP group (P < 0.01). The expression of GSH-Px and HO-1 elevated in the 750 mg/kg AOP group compared with the CTC group (P < 0.01).

Table 8. Effect of AOP on relative mRNA expression in spleen of broilers.

Items	AOP supplemental level (mg/kg)					CTC (mg/kg)	SEM	P-value
	0	250	500	750	1000	50
21 d
Nrf2	1.00^c	0.97^c	1.11^bc	1.67^a	1.51^ab	1.07^bc	0.16	<0.01
HO-1	1.00^ab	0.76^b	0.83^b	1.07^a	0.77^b	0.78^b	0.09	0.01
GSH-Px	1.00^abc	0.89^bc	1.03^ab	1.23^a	0.76^cd	0.64^d	0.08	<0.01
CAT	1.00^bc	0.71^c	0.89^bc	1.56^a	1.24^ab	0.98^bc	0.12	<0.01
SOD	1.00^bc	0.91^bc	0.98^b	1.32^a	0.67^c	0.63^c	0.09	<0.01
42 d
Nrf2	1.00^b	1.54^ab	1.27^b	1.19^b	2.27^a	2.25^a	0.20	0.02
HO-1	1.00	1.01	0.96	1.04	0.98	0.98	0.08	0.99
GSH-Px	1.00^b	1.30^ab	0.95^b	1.57^a	1.19^ab	1.40^a	0.13	<0.01
CAT	1.00^b	0.47^c	0.65^bc	1.64^a	1.02^b	0.66^bc	0.13	<0.01
SOD	1.00^bc	0.95^c	1.05^abc	1.78^ab	1.08^abc	1.82^a	0.18	0.04

^a Nrf2 = transcription factor nuclear factor- erythroid 2 (E2)-related factor 2; HO-1 = heme oxygenase-1; GSH-Px = glutathione peroxidase; CAT = catalase; SOD = superoxidase dismutase.

^abc Different letters within the same row denote differ significantly between treatments.

On day 42, the highest mRNA expression level of GSH-Px and CAT in the spleen was observed in the 750 mg/kg AOP group (P < 0.01). There was no significant difference in the mRNA level of HO-1 among the treatments.

Table 9 showed the mRNA expression of antioxidant enzymes in the liver. On day 21, there were no significant differences in mRNA expression of CAT, SOD, and GSH-Px and Nrf2 among the treatments.

Table 9. Effect of AOP on relative mRNA expression in liver of broilers.

Items	AOP supplemental level (mg/kg)					CTC (mg/kg)	SEM	P-value
	0	250	500	750	1000	50
21 d
Nrf2	1.00	0.96	0.93	1.10	0.92	0.86	0.11	0.79
HO-1	1.00	1.11	1.21	1.25	1.49	1.16	0.11	0.07
GSH-Px	1.00	0.83	1.02	1.01	1.12	1.05	0.09	0.41
CAT	1.00	1.02	1.11	1.13	1.17	1.29	0.09	0.39
SOD	1.00	0.95	0.90	1.10	1.07	1.13	0.11	0.72
42 d
Nrf2	1.00^b	1.46^ab	1.02^b	1.55^a	1.17^ab	1.05^b	0.14	0.03
HO-1	1.00	0.91	1.05	1.06	1.17	1.13	0.09	0.43
GSH-Px	1.00^b	0.99^b	0.82^b	0.85^b	1.23^a	1.44^a	0.14	0.04
CAT	1.00^a	0.89^ab	0.82^ab	1.01^a	0.65^b	0.66^b	0.07	<0.01
SOD	1.00	0.82	0.70	0.86	0.75	0.85	0.09	0.34

^a Nrf2 = transcription factor nuclear factor- erythroid 2 (E2)-related factor 2; HO-1 = heme oxygenase-1; GSH-Px = glutathione peroxidase; CAT = catalase; SOD = superoxidase dismutase.

^abc Different letters within the same row denote differ significantly between treatments.

On day 42, the 1000 mg/kg AOP group significantly increased the mRNA expression of GSH-Px compared with the other AOP groups and CON group (P < 0.05), but there was no significant difference from the CTC group. The 750 mg/kg AOP group significantly increased the mRNA expression of CAT compared to the CTC group (P < 0.01). When supplementing AOP at the concentration of 750 mg/kg, Nrf2 gene expression was significantly increased compared with the CON and CTC groups (P < 0.05). There was no significant difference in SOD and HO-1 in the liver between the treatments.

Table 10 showed the mRNA expression of antioxidant enzymes in the small intestine. On day 21, the mRNA expression level of ileum Nrf2 in the 1000 mg/kg AOP group was significantly higher than that in the CON group (P < 0.01). Broilers fed 750 mg/kg AOP diets significantly increased the mRNA expression level of HO-1 in jejunum (P < 0.01). The mRNA expression level of CAT in the jejunum in 750 and 1000 mg/kg AOP groups was significantly higher than that in the CTC group (P < 0.05). The SOD mRNA expression level in the duodenum of the 1000 mg/kg AOP group was significantly higher than that of the CON group (P = 0.01). There was no significant difference between the 1000 mg/kg AOP and CTC groups. The mRNA expression level of SOD in the ileum in the 250–750 mg/kg AOP group was significantly higher than that of the CTC group (P < 0.01). The mRNA expression level of GSH-Px in the ileum of the 1000 mg/kg AOP group was significantly higher than that of the CON group (P < 0.05), but there was no significant difference between the 1000 mg/kg AOP and CTC groups. There was no significant difference in GSH-Px gene expression in the duodenum among all treatment groups (P > 0.05).

Table 10. Effect of AOP on relative mRNA expression in small intestine of broilers.

Items		AOP supplemental level (mg/kg)					CTC (mg/kg)	SEM	P-value
		0	250	500	750	1000	50
21d
Nrf2	Duodenum	1.00	1.00	1.17	0.95	0.87	1.02	0.12	0.65
	Jejunum	1.00	1.21	1.27	1.32	1.24	1.13	0.13	0.63
	Ileum	1.00^b	1.17^b	1.06^b	1.07^b	5.30^a	5.45^a	0.33	<0.01
HO-1	Duodenum	1.00^ab	0.79^b	0.79^b	0.87^ab	0.95^ab	1.07^a	0.07	0.05
	Jejunum	1.00^b	0.58^b	0.71^b	1.48^a	0.76^b	0.75^b	0.14	<0.01
	Ileum	1.00^ab	0.87^b	0.80^b	0.89^b	1.10^ab	1.28^a	0.10	0.04
GSH-Px	Duodenum	1.00	0.86	0.92	1.51	1.21	1.27	0.24	0.46
	Jejunum	1.00	1.14	1.08	1.19	1.58	1.01	0.24	0.53
	Ileum	1.00^b	1.00^b	0.97^b	1.05^b	1.32^a	1.13^ab	0.09	0.07
CAT	Duodenum	1.00^b	1.10^b	0.88^b	1.04^b	1.19^b	1.66^a	0.15	0.04
	Jejunum	1.00^a	0.73^ab	0.95^ab	1.25^a	1.00^a	0.48^b	0.16	0.04
	Ileum	1.00^ab	0.73^b	0.63^b	0.82^b	0.81^b	1.19^a	0.11	0.03
SOD	Duodenum	1.00^c	1.21^abc	0.99^c	1.16^bc	1.52^ab	1.65^a	0.15	0.02
	Jejunum	1.00	0.96	1.09	1.07	0.97	0.78	0.13	0.60
	Ileum	1.00^a	0.83^a	1.01^a	0.82^a	0.53^b	0.62^b	0.06	<0.01
42d
Nrf2	Duodenum	1.00	1.24	1.12	1.15	1.25	1.87	0.20	0.08
	Jejunum	1.00^bc	1.19^b	1.40^b	1.80^a	0.70^c	0.63^c	0.13	<0.01
	Ileum	1.00^bc	0.96^c	1.10^abc	1.29^a	1.26^ab	1.18^abc	0.08	0.04
HO-1	Duodenum	1.00	1.16	1.14	1.11	1.27	1.22	0.10	0.91
	Jejunum	1.00^b	1.46^a	1.66^a	1.41^a	1.54^a	1.47^a	0.11	<0.01
	Ileum	1.00^ab	1.00^ab	0.95^b	1.19^a	1.06^ab	0.88^b	0.10	0.05
GSH-Px	Duodenum	1.00	1.13	1.16	1.17	0.92	1.29	0.18	0.73
	Jejunum	1.00^ab	1.26^a	0.99^ab	1.28^a	0.73^b	1.09^ab	0.12	0.04
	Ileum	1.00^b	1.10^ab	0.95^b	1.10^ab	1.23^ab	1.44^a	0.12	0.04
CAT	Duodenum	1.00^ab	0.88^b	0.85^b	0.82^b	1.06^ab	1.21^a	0.09	0.02
	Jejunum	1.00^b	1.54^b	1.01^b	2.29^a	1.03^b	0.85^b	0.23	<0.01
	Ileum	1.00^b	1.37^ab	1.40^a	1.57^a	1.33^ab	1.25^ab	0.12	0.04
SOD	Duodenum	1.00^b	0.93^b	1.05^ab	1.25^a	1.14^ab	1.14^ab	0.08	0.06
	Jejunum	1.00^c	1.30^bc	1.54^ab	1.94^a	1.59^ab	1.38^bc	0.15	<0.01
	Ileum	1.00	0.84	0.94	1.11	0.94	1.14	0.10	0.32

^a Nrf2 = transcription factor nuclear factor- erythroid 2 (E2)-related factor 2; HO-1 = heme oxygenase-1; GSH-Px = glutathione peroxidase; CAT = catalase; SOD = superoxidase dismutase.

^abc Different letters within the same row denote differ significantly between treatments.

On day 42, broilers in the 750 mg/kg AOP group significantly increased Nrf2 mRNA expression level in jejunum (P < 0.01). The 750 mg/kg AOP groups significantly increased the mRNA expression of Nrf2 in ileum compared with the CON group (P < 0.05), but there was no significant difference with the CTC group. The 250–1000 mg/kg AOP groups had higher HO-1 mRNA levels in the jejunum than the CON group (P < 0.05). The 750 mg/kg AOP group showed a significant increase in HO-1 mRNA level in the ileum compared to the CTC group (P = 0.05). The highest level of CAT mRNA expression in jejunum was observed in the 750 mg/kg AOP group (P < 0.01). The 500 and 750 mg/kg AOP groups had higher mRNA levels of CAT in ileum than the CON group (P = 0.05), but there was no significant difference between the AOP and CTC groups. The mRNA expression level of SOD in jejunum was significantly higher than that in the CON and CTC groups (P < 0.01).

Discussion

The present study showed that a broiler diet supplemented with 50 mg/kg CTC promoted broiler growth, and the supplementation of 750–1000 mg/kg AOP showed a similar growth-promoting effect as CTC. The above results demonstrated that adding an appropriate dose of AOP in diets could effectively replace antibiotics. There is no available data to evaluate the effect of A. ordosica polysaccharides on growth performance in broilers.

However, dietary supplementation of other herbal polysaccharides has been widely used to improve the growth performance of broilers. Long, Yan, et al. (2020) reported that dietary supplementation of different doses of Lycium barbarum polysaccharides could improve BW, ADG and ADF. In the current study, the 750 mg/kg AOP group was able to significantly increase the ADG and decrease the F/G of the broiler. Wu (2018) found that adding polysaccharide in diet could improve the growth performance of broilers, and the highest ADG and the lowest FCR were observed when the added amount was 1000 mg/kg, indicating that the addition of an appropriate dose of polysaccharide in diets had a certain promoting effect on the growth of broilers. Several studies have reported that plant polysaccharides can improve the growth performance of poultry by increasing the activity of digestive enzymes in the gut, ameliorating gut morphology, modulating gut microbiome, promoting immunity and antioxidant capacity. (Wu 2018; Qiao et al. 2022; Zhang et al. 2022). The present results indicated that AOP could improve the growth performance of broilers, which may be related to the fact that AOP increases the antioxidant function of broilers. In addition, the results of the present study showed that AOP increased antioxidant enzyme activity in the liver, spleen and intestine, improved the body's ability to resist internal and external stress. The good antioxidant status keeps the physiological function of broilers in a healthy state. The antioxidant capacity of the small intestine is raised to maintain the integrity of the intestinal barrier, which plays a significant role in defense against pathogens. The complete intestinal morphology was conducive to the digestion and absorption of nutrients, thus improving the growth performance of broilers (Kelly et al. 2004).

The body uses the antioxidant system to eliminate excess ROS and maintain the dynamic balance between oxidation and anti-oxidation (He et al. 2017). ROS reacts with cells when the balance between oxidation and anti-oxidation is conducive to oxidation, resulting in oxidative stress such as lipid peroxidation, protein oxidation and chromosome breakage (Sies 1997; Amir and Ghobadi 2016). After being attacked by ROS, lipid peroxidation forms MDA, an important marker of lipid oxidation (Tsikas 2017). In the present study, we found that broiler-fed diets supplemented with AOP reduced MDA levels in the spleen, liver and small intestine, suggesting that AOP may be beneficial in reducing the degree of lipid peroxidation. This finding was similarly shown in a previous study, which found that Artemisia sphaerocephala Krasch seeds polysaccharide administration could lead to a dose-dependent reduction of liver MDA content (Ren et al. 2014). The reasons for this finding might be due to plant polysaccharides as an electron donor to provide electrons for the reduction of certain unsaturated fatty acids, thereby reducing lipid peroxidation (Huang et al. 2017).

Antioxidant enzymes are important ROS scavengers in the body, removing excess free radicals (Hamzah et al. 2012; Urrutia-Hernández et al. 2019). T-AOC is an index used to evaluate the ability of the antioxidant system, which could reflect the compensatory ability of the antioxidant enzyme system and non-enzyme system to external stimulation and the metabolism state of free radicals (Li et al. 2019b). Studies have shown that heat stress, disease, ammonia (NH3) and other factors can lead to the antioxidant system's disorder and increase ROS (Estévez 2015). Modern intensive raising methods can also reduce the activity of antioxidant enzymes in poultry. Increasing antioxidant enzyme activity can inhibit oxidative stress, raising poultry health, performance and food quality (Estévez 2015; Rehman et al. 2017). Numerous plant polysaccharides have been proven to have good antioxidant capacity and can play an important role in animal antioxidant system by directly scavenging free radicals or enhancing antioxidant enzyme activity (Huang et al. 2017, 2021; Zhang, Zhu, et al. 2022). The present study showed that, to some extent, AOP treatment could enhance CAT, GSH-Px, SOD and T-AOC activities in the spleen, liver and small intestine. Similarly, broilers fed CTC improved antioxidant status, suggesting that AOP could repeat the beneficial effect on antioxidant status. Wang et al. (2020) study found that dietary Artemisia selengensis Turcz polysaccharide supplementation increased CAT, T-AOC, SOD and GSH-Px content in the liver of mice under cyclophosphamide-challenge conditions. Huang et al. (2021) found that Nelumbo nucifera leaf polysaccharide could promote the expression of antioxidation-related genes by activating the Nrf2 signalling pathways in the intestinal cell of mice, which could protect intestinal cells from oxidative damage and improve the intestinal function of mice. The current results might be that plant polysaccharides could scavenge free radicals, improve the activity of antioxidant enzymes, either by acting directly as reducing agents or through the Nrf2 signalling pathway (Park et al. 2014; Gao et al. 2018).

On this basis, we further explored the molecular mechanism of the antioxidant effect of AOP. In a review of the literature, the study of the antioxidant mechanism of AOP in animals is quite limited. However, numerous studies have shown that plant polysaccharides reduce oxidative damage by activating an Nrf2/ARE (antioxidant response element) pathway (Farag et al. 2019; Zhao et al. 2019; Mu et al. 2021). Nrf2-ARE signalling pathway plays a significant function in activating the expression of a variety of downstream protective genes, such as antioxidant protease gene, phase II detoxification enzyme gene and molecular chaperone gene, including HO-1, GSH-Px, SOD, CAT and a large number of protective gene transcription (Kensler et al. 2007). For instance, L. barbarum polysaccharide induced Nrf2 phosphorylation and activated the Nrf2/ARE pathway, which mediated cellular protection and induced the expression of HO-1, SOD2 and CAT proteins in mouse liver, and reduces the level of ROS (Yang et al. 2014). The present study found that dietary AOP supplementation significantly increased the mRNA expression of Nrf2, SOD, CAT and GSH-Px at days 21 and 42. In contrast, similar beneficial consequences were observed in the CTC group, suggesting that AOP may enhance the tissue antioxidant status of broiler chickens. Furthermore, HO-1 is a target gene regulated by the Nrf2 signalling pathway, widely exists in body tissues and could catalyse heme into carbon monoxide, bilirubin and free iron (Ryter and Choi 2009). These catabolites have exhibited potent protective activities in antioxidant and anti-inflammatory properties (Yoon and Park 2019). It has been indicated that dietary plant polysaccharide upregulates HO-1 and Nrf2 expression and GSH-Px and SOD activities in liver homogenate by activating keap1-Nrf2-ARE signal pathway, thus ameliorates liver tissue injury induced by CCl4 (Hou et al. 2020). In our study, AOP increased gene expression of HO-1 and antioxidant enzymes. These results suggested that AOP may activate the antioxidant defense system, at least in part via the Nrf2/HO-1 pathway, and subsequently improve the production of various antioxidant enzymes in the tissues.

Summary

In conclusion, under the present experimental conditions, the addition of 750 mg/kg AOP in broiler diets could significantly improve the growth performance. In addition, the current study demonstrated that AOP as an antibiotic substitute could effectively stimulate the antioxidant defense system under nonchallenged conditions, in part through the Nrf2/HO-1 pathway, to promote the production of antioxidants in the tissues of broilers, and the best effect was achieved when the addition amount was 750 mg/kg, which is beneficial for the growth performance and health of broilers.

Acknowledgements

This work was supported by National Natural Science Foundation of China (Project No. 31960667). The author thanks his laboratory colleagues for their assistance in the data and sample collection, and laboratory analysis.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This work was supported by National Natural Science Foundation of China [Project No. 31960667].