Influence of zinc sulfate and threonine supplementation on mucin 5ac gene expression in the small intestine and intestinal mucosal morphology in broiler chickens

ABSTRACT

A 42-day feeding trial was carried out to evaluate the effect of dietary supplementation of zinc and threonine on the integrity of intestinal mucosa and expression of intestinal mucin 5ac (MUC5AC) gene in broiler chickens. A total of 640-day-old Arbor Acres broiler chicks were allocated to four dietary treatments with eight replicates of 20 birds in a completely randomized design. The experimental diets included T₀: control (standard diet), T_1: standard diet + 40 mg/kg Zinc Sulfate (ZnSO₄), T₂: standard diet + 2% L-Threonine (L-Thr) and T₃: standard diet + (40 mg/kg ZnSO₄+ 0.2% L-Threonine (L-Thr)). During the starter phase, the average daily gain and body weight of birds fed the T₁ diet was lower (p < 0.05) than T₂ and T0. The villus height (VH) of the jejunum in T₂ was longer (p < 0.05) than in T₀ and T₃. In the ileum, VH for T₁ was longer (p < 0.05) than for T₀. The MUC5AC mRNA expression in the duodenum at the starter phase was lower (p < 0.05) in T₃ than in T₂ while in the jejunum, T₁ was higher (p < 0.05) than the other treatment groups. The supplementation of zinc and threonine in the diet can improve the intestinal integrity of broiler chickens.

KEYWORDS:

• Essential nutrients
• intestinal mucosa
• mucin
• threonine
• zinc

Introduction

The digestive system of poultry is a tube containing different tissues including intestinal epithelium, which is the first line of defense against pathogens and toxins (Abreu 2010). Its integrity depends on several factors such as the appearance of the intestinal mucosa and mucus whose major component is mucin. Exposure of the body to pathogens gives rise to the sanitary challenge in livestock production, resulting in significant risks in the extensive system breeding currently practised in Africa. Naturally, the organism is equipped with various lines of defense against pathogens. In the gastrointestinal tract, the pathogens face the alkalinity salivary; gastric acidity, intestinal alkalinity and enzyme defense. On the other hand, the intestinal epithelium has three types of capacity to protect the organism against the pathogens such as physics, microbiology and immunology capacity. It is therefore important to improve the immune capacity of the intestinal epithelium to prevent diseases and reduce antibiotic use in poultry farms (Ducatelle et al. 2015).

Zinc in all animal species is recognized as an essential trace element for many physiological functions (Park et al. 2004; Duffy et al. 2023). Zinc deficiency in chickens alters the innate and adaptive immunity (Hojyo and Fukada 2016), impairs the intestinal mucosa morphology in broilers (Ahmadi et al. 2013), damages cellular function by reducing DNA, RNA synthesis and genes expression (Park et al. 2004; Duffy et al. 2023). National Research Council (2001), and Ibrahim et al. (2017) showed that at 40 mg/kg incorporation of zinc in broiler diet, growth, health and reproductive traits were not improved. Thus, for better performance of chickens resulting from genetic improvement, feed manufacturing industries opt for a supplement of 100 ppm to 120 ppm of zinc in feed (Mahmoud et al. 2020). Furthermore, Azzam and El-Gogary (2015) reported that zinc supplementation improves immunity capacity and growth performance under stress caused by high stocking density. In other hand, Increasing the level of zinc in a broiler’s diet causes a disturbance of the balance of other trace elements such as copper for example (Zhao et al., 2014; Byrne and Murphy 2022). High levels of zinc supplementation increases the production cost and the excretion of minerals in feces causing environmental pollution (Mahmoud et al. 2020). The supplementation of zinc as sulfate of zinc at 40 mg/kg improved the growth performance of broiler chicken and reduce the zinc excretion in environment (Zhang et al. 2018).

Threonine is the third most limited amino acid for broilers fed corn-soybean meal basal diets (Kidd et al. 1999; Tugay et al. 2009 Debnath et al. 2019). In supplementation, threonine improves intestinal health in chickens (Dong et al. 2017). The recommended level of threonine supplementation in broilers is from 1-3 g/kg of diet (Chen et al. 2017). Threonine supplementation at an adequate level improves the immunity capacity, and growth performance in broilers under the stress induces by high stocking density (Azzam and El-Gogary 2015). The integrity of the intestinal barrier is most dependent on mucin, which represents the major component of intestinal mucus (Janice et al., 2013). The major component of intestinal mucins in broilers is threonine, representing 30% of its total amino acid content (Bortoluzzi et al. 2018). Threonine is therefore recognized as an amino acid essential for the production of mucins in the gut of chickens and plays a key role in the maintenance of intestinal barrier integrity (Sandberg et al. 2007; Nichols and Bertolo 2008).

Recent studies have demonstrated the link between zinc and amino acids including threonine (Te-Jung et al. 2005). According to Te-Jung et al. (2005), in the gut, threonine fixes the zinc and there is a reduction in the availability of each nutrient by chelation (Farhadi et al. 2021). It is thus, hypothesized that the supplementation of zinc and threonine in the diet of the birds can enhance gut functioning. The objective of this study was to evaluate the effect of dietary threonine and zinc supplementation on the integrity of small intestine mucosa and the expression of intestinal mucin 5ac (MUC5AC) gene in broiler chickens.

Materials and methods

Study area, birds husbandry and experimental design

The experimental procedure was approved by the scientific community of the Animal Eco-Nutrition Lab and conducted at the Poultry Unit of the Shandong Agricultural University of China. Six hundred and forty (640) day-old male Arbor Acres broiler chicks were randomly assigned into four dietary treatments with 8 replicates and 20 birds per cage in a completely randomized design. The chicks were weighed at hatch and individuals with a mean weight of 37.21 ± 0.53 g were selected and randomly placed in windowless environmentally controlled room cages (1 × 0.9 m). The cages had wire flooring and were equipped with one open feeding trough and 2 drinkers. The room temperature was maintained at 33°C during the first 3 days and then decreased gradually by age until reaching 24°C at 21 days. The birds were given access to feed and water ad libitum and light exposure followed 23 h of light during the starter phase (0–21 days) and 16 h of light during the finisher phase (22–42 days). On day 22, the chicks were allotted to their respective cage at 23°C with a surface of 1.54 m². The experiment lasted for 42 days. Prophylaxes and vaccination of birds were administered as recommended for the Arbor Acres strain (Raach-Moujahed and Haddad 2013).

Experimental diets

The experimental diets were formulated with the specification of broiler feed requirements, recommended for Arbor Acres strain (NRC 1994). The feed composition and chemical analysis for both the starter phase (0–21 days) and the finisher phase (22–42 days) are presented in Table 1. Four experimental diets were formulated namely; T₀ (control group): fed a standard diet without Zinc Sulfate (ZnSO₄) and L-Threonine (L-Thr) supplementation, T₁ (standard diet supplemented with 40 mg ZnSO₄/kg diet), T₂ (standard diet supplemented with 0.2% L-Thr) and T₃ (standard diet supplemented with 40 mg ZnSO₄/kg diet and 0.2% L-Thr). These levels employed were in accordance with NRC (1994) recommendations. The ZnSO₄ and L-Thr were procured from Shandong Hemeihua Biotechnology Co., Ltd., Shandong, China.

Table 1. Percent diet composition and nutrient levels of standard diets (as-fed basis).

Ingredients (%)	Starter (0-21 days)	Finisher (22-42 days)
Corn (8.5% CP)	57.16	61.27
Soybean meal (43% CP)	36.68	31.37
Soybean oil	2.07	3.44
Limestone	1.20	1.32
CaHPO4	1.67	1.56
NaCl	0.29	0.27
L-Lys·HCl (99%)	0.21	0.18
DL-Met (98%)	0.21	0.14
Choline Chloride (50%)	0.26	0.20
Vitamin premix^1	0.05	0.05
Mineral premix^2	0.20	0.20
Total	100.00	100.00
Nutrient levels (%)
Crude protein	21.0	19.0
Metabolizable energy (MJ/kg)	12.13	12.68
Calcium	0.90	0.90
Non-phytate Phosphorus	0.45	0.42
Lysine	1.242	1.095
Methionine	0.537	0.449
Methionine + Cysteine	0.865	0.754
Threonine	0.861	0.774
Zinc	0.00401	0.0040
Tryptophan	0.289	0.256

¹ Vitamin premix provided the following per kilogram of diet: VA (retinyl acetate) 10 000 IU, VD₃ (cholecalciferol) 2 000 IU, VE (DL-α-tocopheryl acetate) 11.0 IU, VK 1.0 mg, VB₁ 1.2 mg, VB₂ 5.8 mg, VB₆ 2.6 mg, VB₁₂ 0.012 mg, niacin 66.0 mg, pantothenic acid (calcium pantothenate) 10.0 mg, biotin 0.20 mg, folic acid 0.70 mg.

² Mineral premix provided the following per kilogram of diet: Mg 100 mg, Zn 75 mg, Fe 80 mg, I 0.65 mg, Cu 8.0 mg, Se 0.35 mg.

Measurements and data collection

Feed intake (FI) was recorded and birds were weighed individually on a weekly basis for the replicates. Average daily gain (ADG) and feed conversion ratio (FCR) were calculated during both starter (0–21 days) and finisher (22–42 days) phases. On days 21 and 42, one bird from each cage of each treatment was randomly selected (8 birds per treatment), weighed and humanely sacrificed by the cervical dislocation to collect the intestinal sample including the duodenum, jejunum and ileum. The small intestine was isolated (from the stomach-duodenal pylorus at the ileocecal junction) from the digestive tract and divided into three segments, duodenum (from the pylorus to the distal portion of the duodenal loop covering the pancreas), jejunum (from the distal portion of the duodenal loop to Meckel's diverticulum) and ileum (from Meckel's diverticulum to the ileum-caeca junction). Approximately 1 cm from the middle of the duodenum, jejunum and ileum was incised and then fixed in a 4% paraformaldehyde solution for histological measurements. Additionally, 2 cm of each of the duodenum, jejunum and ileum were collected, opened longitudinally, rinsed with a solution of sodium chloride (NaCl) to remove the digesta, and then put in a sealed tube that is placed in liquid nitrogen for the determination of the gene expression of MUC5AC gene. The immune organs such as Bursa and spleen were also carefully isolated and then weighed to determine the relative weight of the immune organs following the procedure of Chen et al. (2017) with slight modification. $\mathrm{Average}\mathrm{daily}\mathrm{gain}(\mathrm{ADG})={\displaystyle \frac{\mathrm{Weekly}\mathrm{weight}}{7}}$ $\mathrm{Feed}\mathrm{conversion}\mathrm{ratio}(\mathrm{FCR})={\displaystyle \frac{\mathrm{Feed}\mathrm{intake}}{\mathrm{Weight}\mathrm{gain}}}$ $\mathrm{Relative}\mathrm{immune}\mathrm{organ}\mathrm{weight}(\text{\%})={\displaystyle \frac{\mathrm{Immune}\mathrm{organ}\mathrm{weight}}{\mathrm{Live}\mathrm{weight}}x100}$

Histological measurement

Approximately 0.5 cm of each of the 4% paraformaldehyde-preserved intestine samples was dehydrated and left under a low-pressure tap running water for 24 h to rinse and remove the digesta. After removal of the digesta, the segments were immersed in paraffin in order to immobilize them in a position that will allow a view of the entire structure of the villi and crypts under a microscope. They were then recovered and using a microtome (Fully automatic rotary paraffin HM355S slicer), 5 microns of each segment was cut and slid, and then the paraffin was removed with xylene, rehydrated and stained with hematoxylin and eosin. The villous height (HV), and the crypt depth (CD) of well-oriented villi were measured by section using an inverted phase contrast fluorescence microscope (model TE2000-5, purchased from Nikon Corporation of Japan) following the procedure of Nighot (2008).

mRNA extraction and real-time polymerase chain reaction

About 100 mg of each sample of the intestine preserved in liquid nitrogen, in separate tubes was taken and used for extraction of the mRNA with TRI-zol reagent (TaKaRa, Nojihigashi 7-4-38 Kusatsu, Shiga, Japan 525-0058) by the method described by Zhang et al. (2014). After extraction, the concentration and quality of mRNA of each sample were checked with U-2450 (Shimadzu Corporation, Kyoto, Japan). Subsequently, mRNA samples were diluted with diethyl pyrocarbonate-treated water (DEPC water) to the correct concentration for transcription. The mixture of the reverse transcriptor ‘Roche Transcriptor Kit’ for obtaining the complementary strand of DNA (cDNA) was carried out according to the indications of the kit and then 9 μl of the reverse transcriptor mixed was added to 11 μl of each diluted mRNA sample. The mRNA mixture and reverse transcriptase were used for transcription to obtain cDNA using the Qualitative Gradient PCR instrument. The primer sequence of the target gene is shown in Table 2. Real-time Polymerase Chain Reaction (PCR) was performed using the Quantitative Fluorescence (Q5) Real-Time PCR System (Applied Biosystems, CA, U.S.A.). The data were analysed with QuantStudioTM Design & Analysis Software Primer 5.0 software (SPS Inc., CA, U.S.A.) and synthesized by Shanghai Sangon Company (Shanghai, China). The cDNA samples were diluted before their use for Real-time PCR: 4 μl of the cDNA sample with 16 μl of DEPC water. For Real-time PCR, 2 μl of the diluted cDNA was mixed with 0.5 μl forward (F) MUC5AC primer, 0.5 μl reverse (R) MUC5AC primer, 10 μl of SYBR green and 7 μl of DEPC water. The primer sequence of the target gene is shown in Table 2. The prepared mixtures for the PCR were made in sufficient quantities to be deposited in 48 wells of the PCR plate. The gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a standard in the remaining 48 wells of the plate. Once the reaction media have been gently deposited in the various wells of the plate, it was centrifuged and then positioned in the thermocycler and the Real-time PCR steps (denaturation: 95°C for the 30s per cycle, hybridization: 60°C for 30 s) were launched in 40 cycles. The 2^-ΔΔCT method was used to determine the expression level of MUC5AC relative to the sample (Livak and Schmittgen 2001). MUC5AC expression level values were grouped by intestinal portion and group to compare duodenum, jejunum and ileum between treatments.

Table 2. Primer sequences for real-time PCR assay.

Target genes	Primer sequence F/R	TA (°c)	Length	Gene Bank ID
MUC5AC	F: TGGCTCCTTGTGGCTCCTCAG R: AGCTGACACATGAGGCACATTCAC	78	146	XM_025151099.1
GAPDH	F: CTACACACGGACACTTCAAG R: CGTCTGGTTGAGGATGTGACTC	82	271	NM_204305

T_A: amplification temperature; MUC5AC: Mucine5 AC; GAPDH: Glyceraldehyde-3- phosphate deshydrogenase.

Statistical analysis

The data were analysed with R software version 3.5.2 (2018-12-20). The mean values of the different parameters were expressed as mean ± standard error. In the first step, a normality test was performed for each parameter. At the baseline, average daily gain, feed conversion ratio, duodenal crypt depth and the level of expression of the MUC5AC gene mRNA did not follow the normal distribution and the non-parametric Kruskal–Wallis test was used to analyse these data. The difference was significant if p < 0.05. The mean values of FI, FCR, ADG, BW and the weight of the Bursa and spleen were compared by the one-way ANOVA and significant averages were submitted to the post-test of Tukey.

Results

Growth performance

The growth performance of chickens supplemented with dietary zinc and threonine is shown in Table 3. Similar results on performance (p > 0.05) were found across all the treatment groups during the growth phase. However, during the starter phase, the zinc-supplemented group (T₁) recorded the lowest feed intake (p = 0.012) compared to the control group (T₀). The average weight gain and body weight of birds in the T₀ and L-Thr supplemented group (T₂) groups were significantly improved (p = 0.012 and p = 0.01) relative to ZnSO4 supplemented group (T₁) group.

Table 3. Growth performance and relative immune organs weight of broilers at 21 and 42 days of age

Items		T0	T1	T2	T3	SEM	P-Value
Growth performance
Starter (0-21 days)	FI (g/d)	42.15^a	39.35^b	41.73^ab	39.89^ab	0.68	0.027
	ADG (g/d)	27.40^a	25.38^b	27.43^a	26.59^ab	0.27	0.03
	FCR (g/g)	1.54	1.55	1.52	1.50	0.01	0.35
	Body weight (g)	612.84^a	569.97^b	613.04^a	595.70^ab	13.0	0.01
Finisher (22-42 days)	FI (g/d)	127.36	127.60	121.88	125.10	1.33	0.75
	ADG (g/d)	67.93	65.76	66.19	65.76	0.77	0.74
	FCR (g/g)	1.87	1.94	1.84	1.9	0.03	0.43
	Body weight (g)	2039.30	1950.90	2003.10	1976.70	51.0	0.37
Immune organs weight (%)
Starter	Bursa	2.52^a	2.22^ab	2.06^ab	1.95^b	0.10	0.039
	Spleen	0.89	0.93	1.00	1.11	0.05	0.19
Finisher	Bursa	0.84^ab	0.64^b	0.95^a	0.72^ab	0.06	0.035
	Spleen	0.99	1.15	1.04	1.05	0.05	0.76

Abbreviations: FI: Feed intake, ADG: Average Daly Gain, FCR: Feed Conversion Ratio. T₀ (standard diet with no supplementation). T₁ (standard diet supplemented with 40 mg ZnSO4/kg diet). T₂ (standard diet supplemented with 0.2% L-Thr). T₃ (standard diet supplemented with 40 mg ZnSO4/kg diet and 0.2% L-Thr).

^a,b Means in the same row with different superscripts are significant at P < 0.05. SEM: Pooled Standard Error of Means (n = 8).

Relative immune organs weight

Relative immune organs weights at the starter and finisher phases are shown in Table 3. At the starter phase, the weight of the Bursa of the birds in the zinc and threonine-supplemented group (T₃) was significantly smaller (p = 0.039) than those in the control group (T₀). However, on day 42, the birds that received threonine (T₂) in the diet had the highest (p = 0.035) weight of Bursa compared to those that received the zinc-supplemented diet (T₁).

Intestinal morphology

The supplementation of zinc, threonine or both in the diet did not affect the villi height in the duodenum of the chickens at starter and finisher phases (p > 0.05) (Table 4) (Figure 1). In the jejunum, the supplementation of threonine increased the villi height compared with the control group at the starter (p = 0.010) phase but was not significantly different (p > 0.05) at the finisher phase. At the starter phase, the villi height in the ileum of the chickens that were supplemented with zinc increased when compared with the control group (p = 0.044). Additionally, the villi height in the jejunum of chickens fed the diet supplemented with both zinc and threonine decreased significantly (p = 0.010) when compared with the group of chickens that received only threonine in the diet during the starter phase.

Figure 1. Clear micrograph of intestinal segments of broilers from different treatments (T₀, T₁, T₂ and T₃). A₁, A₂ and A₃ represent respectively the duodenum, jejunum, and ileum of chickens from treatment T₀. B₁, B₂ and B₃ represent respectively the duodenum, jejunum, and ileum of chickens from treatment T₁. C₁, C₂ and C₃ represent respectively the duodenum, jejunum, and ileum of chickens from treatment T₂. D₁, D₂ and D₃ represent respectively the duodenum, jejunum, and ileum of chickens from treatment T₃.

Table 4. Intestinal morphology of broilers at 21 and 42 days of age.

Items		T0	T1	T2	T3	SEM	P-Value
Starter (0–21 days)
VH	Duodenum	1915.86	1819.66	1948.30	1727.83	53.60	0.98
	Jejunum	755.39^b	1007.232^a,b	1193.40^a	831.43^b	55.30	0.01
	Ileum	553.40^b	770.53^a	668.67^a,b	636.53^a,b	29.95	0.047
CD	Duodenum	149.25	152.87	239.50	152.83	17.10	0.57
	Jejunum	149.17	137.47	141.83	151.47	8.45	0.94
	Ileum	102.53	123.05	118.03	110.38	6.11	0.70
Finisher (22–42 days)
VH	Duodenum	1768.73	1621.30	1743.40	1816.30	6.58	0.82
	Jejunum	1333.80^a,b	1479.40^a	1084.10^b	1233.10^a,b	54.72	0.043
	Ileum	733.60	818.50	808.50	780.20	37.33	0.87
CD	Duodenum	176.20^a,b	201.42^a	165.70^a,b	145.80^b	6.58	0.005
	Jejunum	217.70^a	155.50^b	155.10^b	180.00^a,b	7.82	0.004
	Ileum	176.90	191.70	163.62	157.80	6.55	0.26

Abbreviations: VH: Villi height, CD: Crypt depth. T₀ (control group). T₀ (standard diet with no supplementation). T₁ (standard diet supplemented with 40 mg ZnSO4/kg diet). T₂ (standard diet supplemented with 0.2% L-Thr). T₃ (standard diet supplemented with 40 mg ZnSO4/kg diet and 0.2% L-Thr).

^a,b Means in the same row with different superscripts are significant at P < 0.05. SEM: Pooled Standard Error of Means (n = 8).

The jejunum of the group of chickens that received the zinc or threonine in supplementation had the lowest (p = 0.004) crypt depth compared with the control group at day 42 of age. Comparably, the group supplemented with both zinc and threonine decreased (p = 0.005) the crypt depth in the duodenum compared with the group of chickens that received the diet supplemented with zinc.

Relative expression of intestinal MUC5AC mRNA

Treatments did not affect the mRNA MUC5AC gene expression in the jejunum and ileum at 0–21 days of age and 22–42 days of age (Figure 2). However, the level of mRNA MUC5AC gene expression was higher in the duodenum of the group of chickens that received the supplementation of threonine than in the duodenum of chickens that received both zinc and threonine at the starter phase. The group of chickens that received the supplementation of zinc showed a high level of mRNA gene expression in the jejunum of chicken at 21 days of age.

Figure 2. Relative mRNA expression levels of mucin 5ac (MUC5AC) in duodenum at 21 d-old (A), duodenum at 42 d-old (B), jejunum at 21 d-old (C), jejunum at 42 d-old (D), ileum at 21 d-old (E) and ileum 42 d-old (F). Values are represented as means and SEM are represented by vertical bars. Means with different superscripts differ significantly (P < 0.05) (n = 8)

Discussion

In this study, the Zn supplementation as ZnSO₄ affected growth performance at a starter phase and this is in line with Zhang et al. (2018) who reported similar result after supplementation of Zn as ZnSO₄ at 40 mg/kg in the diet. Zinc is one of the most important trace elements for many physiological functions including growth performance (Park et al. 2004; Ogbuewu and Mbajiorgu 2023) but when the rate of zinc exceeds the required rate for chickens; feed intake and average daily gain are negatively affected. According to NRC (1994), the recommended diet level of Zn in broilers is 40 g/kg. Reduction in energy intake from low feed intake caused by inadequate dietary zinc is not the primary cause of low growth rate in individuals (MacDonald 2000). However, zinc deficiency in chickens causes a disturbance in the concentration of growth hormone (GH) and a reduction in insulin-like growth factor 1 (IGF-I) in the blood (MacDonald 2000; Sahin et al. 2009). Furthermore, zinc deficiency also affects the membrane signalling system and intracellular second messengers, resulting in disturbance of cell proliferation in response to IGF-I (MacDonald 2000). On the other hand, this study showed that zinc supplementation increased the villi height in the jejunum. Wang et al. (2017) obtained the same result after the supplementation of zinc at 80 mg/kg. The authors asserted that zinc supplementation improved the morphology of the intestinal mucous membrane.

L-Thr supplementation has many beneficial effects on broilers, such as increasing growth performance, improving immunity capacity and having a positive effect on the integrity of the intestinal barrier (Dong et al. 2017). This study shows that the L-Thr supplementation did not affect the growth performance at the starter and finisher phases. A similar result was obtained by Chen et al. (2017), who reported that the supplementation of Thr at different levels (0, 1 and 3 g/kg) unaffected the growth performance. Our study showed that the L-Thr supplementation improved the villi height in the jejunum at the starter phase, and it is consistent with the finding of Chen et al. (2017). Zinc influences the morphology of the small intestine, improving growth and absorption capacity (Kumar et al. 2021). Zinc is also necessary for the division and proliferation of cells, especially for DNA synthesis and mitosis in the mucous membrane (Dosoky et al. 2022). Threonine increases intestinal goblet cells and enhances intestinal shape and barrier function (Mao et al. 2011). Excessive supplementation of Threonine may lead to a rise of mucin in the colon, which shields the intestinal epithelium from digestion enzymes and acids (Gómez-Guillén and Montero 2021). Mucins, which are composed of proline, serine, and Threonine, serve as a physical barrier against pathogens and allow nutrients into the digestive tract (Paone and Cani 2020).

The heavier weight observed in the lymphatic tissue (bursa) of the birds supplemented with threonine shows the positive effect of threonine in enhancing immune capacity. Bursa of Fabricius actively contributes to the manufacture of antibodies by promoting the differentiation and amplification of B lymphoid progenitors in its follicular microenvironment, which guarantees the B cell's functional development (Ratcliffe and Härtle 2022). It has been reported that in ovo injection of threonine resulted in heavier bursa weight compared to non-injected (Bhanja et al. 2012).

Mucin glycoproteins have been involved in mucosal formulation (Ospina-Rojas et al. 2013) and intestinal immunity function (Dong et al. 2017). Some nutrients level in the diet improves mucin production in the small intestinal by adding Zn at 120 mg/kg (Wen et al. 2017) and L-Thr at 0.75% (Azzam and El-Gogary 2015). This study showed that the zinc supplementation impaired the FI and ADG, however, the intestinal mucosal morphology was not affected at the starter phase in the duodenum and jejunum. Given the intestinal mucosal morphology is not affected by the Zn supplementation and the FI was affected negatively, that would decrease the ADG. Kim and Patterson (2004) had shown that the Zn supplementation at 100 mg/kg negatively affected the growth performance. On the other hand, our study showed that the Zn supplementation improves the MUC5ac gene expression in the jejunum of the chickens at 21 days. The finding of Wen et al. (2017) supports our results which revealed that Zn level in diet affects MUC5ac gene expression in the jejunum.

The L-Thr supplementation improves MUC5ac gene expression and the intestinal mucosal morphology respectively in the duodenum and jejunum also. The weight of the immunity organs like the Bursa was The weight of the immunity organs like the Bursa was higher with L-Thr supplementation compared to zinc supplementation at the finisher phase. The effects on the intestinal mucosal morphology in this study conform with the results of Debnath et al. (2019) who reported that L-Thr supplementation improved the intestinal morphology through the increasing villus height, crypt depth, villus surface area and mean goblet cell number/villus. The increase in Bursa weight in our study showed that L-Thr supplementation could affect the immunity of chickens.

In this study, the supplementation of zinc and threonine in the same diet adversely affected growth performance, immunity organ weight, intestinal mucosal morphology and MUC5ac mRNA gene expression. That result confirms the chelation link between zinc and threonine illustrated by Te-Jung et al. (2018). It could therefore be inferred that the chelation’s link acted on the availability of both zinc and threonine thereby decreasing the beneficial action of each of them on growth performance, intestinal mucosal morphology and the MUC5ac mRNA gene expression.

Conclusion

Conclusively, zinc or threonine supplementation improved intestinal morphology but overall did not influence growth performance. The combinatory effect of zinc and threonine interacted negatively as one decreased the positive action of the other on the intestinal morphology and mucin MUC5ac gene expression in the duodenum, jejunum and ileum. Further study is warranted to bridge the knowledge gap on the impact of zinc and threonine on other tight-junction (TJ) proteins and on digestive enzymes.

Acknowledgements

The authors are grateful to Jerome Parobali, Wang Minghui, Jiangxue Cai and Zhao Mei for their support and assistance with the animal experiment and guidance with laboratory analysis.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

All data used is available and can be provided upon reasonable request.

Additional information

Funding

The authors are much grateful to the World Bank grant International Development of Association (IDA) 5424 through the Regional Center of Excellence in Poultry Science, (CERSA) of the University of Lomé (Togo) for sponsoring this study.