Detection of polymorphisms in six genes and their association analysis with litter size in sheep

Abstract

Litter size in sheep is a complex trait controlled by micro-effective polygenes. APAF1, CLSTN2, CTH, PLCB1, PLCB4, and CHST11 are all involved in mammalian reproduction. However, the effects of these genes on litter size in sheep are still unclear. Therefore, in this study, we used Sequenom MassARRAY® SNP assay technology to type the single nucleotide polymorphisms (SNPs) loci of six genes in five sheep breeds. The results showed that most sheep breeds contain three genotypes at each locus. Then, we conducted population genetic analysis on the SNPs of six genes and found that the polymorphic information content in all sheep breeds ranged from 0 to 0.37, and most sheep breeds were in Hardy-Weinberg equilibrium (p > 0.05). In addition, association analysis in Small Tail Han sheep indicated that the rs399534524 locus in CLSTN2 was highly associated with first parity litter size, and litter size in ewes with CT genotype was higher than that in ewes with CC genotype or TT genotype. Furthermore, the rs407142552 locus in CTH was highly associated with second parity litter size in Small Tail Han sheep, and litter size in ewes with CT genotype was higher than that in ewes with TT genotype. Finally, we predicted the CTH and CLSTN2 protein interaction network and found that HTR1E, NOM1, CCDC174 and ALPK3 interact with CLSTN2 and have been reported as candidate genes related to litter size in sheep. These results suggest that they may be useful genetic markers for increasing litter size in sheep.

Keywords:

• Sheep
• litter size
• single nucleotide polymorphisms
• CLSTN2
• CTH

Introduction

Reproductive traits of sheep are one of the most important economic traits that directly determine the production costs and economic benefits of sheep production. Ewes that produce more lambs per litter can provide a large number of lambs, thus increasing economic efficiency. Therefore, it is important to identify molecular markers that influence litter size in sheep. Marker-assisted selection significantly shortens the breeding cycle and improves breeding success compared to traditional methods. The recent discovery of SNPs has been recognized as one of the most useful types of genetic markers.^1,2 In particular, point mutations in genes such as bone morphogenetic protein receptor, type 1B (BMPR1B),³ growth differentiation factor 9 (GDF9),⁴ and bone morphogenetic protein 15 (BMP15)⁵ have been implicated in sheep reproduction and result in litter size differences. We compiled a number of genes that may affect fertility in sheep and found all the SNPs in the region where each gene is located based on previous resequencing data. The population differentiation index (FST) was then calculated for each SNPs locus. The above obtained SNPs annotation results and FST were integrated and screened according to the following conditions: ① non-synonymous mutations with FST > 0.05; ② SNPs in introns with FST > 0.15. We identified SNPs in six genes that were suitable for screening and could be potential genetic markers influencing litter size in sheep.

The protease apoptosis activating factor-1 (APAF1) gene induces programmed cell death and is a critical factor in the mitochondrial-dependent death pathway. And apoptosis has been reported to be involved in oogenesis, folliculogenesis, oocyte loss/selection and atresia.^6,7 APAF1 has been found to be abundant in the granulosa cells of early ovarian antral follicles.⁸ In addition, APAF1 is one of the apoptotic signaling pathways mediated by porcine granulosa cells.⁹ And APAF1 mutations can lead to a decrease in reproductive efficiency in Holstein dairy cattle.¹⁰ Calsyntenin-2 (CLSTN2), also known as alcadein-γ, plays a role in a variety of biological processes, including cell growth, differentiation, cell death and tumorigenesis.^11–13 A previous study found that CLSTN2 is expressed in the uterus of rats.¹⁴ Moreover, this gene is a candidate gene associated with litter size in sheep.¹⁵ Studies have shown that the indel in CLSTN2 is a candidate gene affecting goat fertility.¹³ Cystathionine-γ-lyase (CTH) is a widely distributed enzyme that catalyzes the formation and transformation of hydrogen sulfide (H₂S).¹⁶ The production of endogenous H₂S is involved in the preovulatory cascade reaction and follicular rupture during ovulation in mice. Research has shown that CTH is expressed in mouse and human granulosa cells and increases during ovulation. Furthermore, inhibition of CTH activity can reduce the ovulation rate in mice.¹⁷ And CTH mRNA has also been reported in porcine cumulus cells and oocytes.¹⁸ Moreover, a decrease in CTH activity may also lead to placental abnormalities in pre-eclampsia and fetal growth restriction.^19,20 Phospholipase C beta 1 (PLCB1) and phospholipase C beta 4 (PLCB4) are members of the phospholipase C beta family. The PLCB1 protein is a downstream effector of the G protein-coupled GnRH receptor. G protein-coupled receptor (GPCR) plays a central role in mediating fertility because some hormones such as GnRH, FSH, LH, and oxytocin signal through GPCR.²¹ In addition, PLCB1 has been identified as a candidate gene for human primary ovarian failure and ovarian dysfunction.²² PLCB4 regulates PLCB1 and has a function in calcium signaling,²³ which plays an important role in proper uterine quiescence and smooth muscle contraction during pregnancy.²⁴ Notably, a meta-analysis of GWAS found that PLCB1 and PLCB4 were associated with litter size in sheep.²⁵ Carbohydrate sulfotransferase 11 (CHST11) is a target gene of transforming growth factor β (TGFβ)-like growth factor,²⁶ which may regulate litter size in sheep through TGFβ and BMP signaling.²⁷ Furthermore, CHST11 was found to regulate proliferation and apoptosis of mouse embryonic chondrocytes.²⁸

All of the above genes play a role in animal reproduction, so they may be involved in sheep reproduction and lead to differences in litter size and may be important genetic markers for sheep breeding. Therefore, this study aims to investigate the association between SNPs of six genes and litter size. This information has not been previously elucidated, but is expected to provide valuable genetic markers for sheep breeding.

Materials and methods

Animal preparation and sample collection

The Science Research Department (in charge of animal welfare issues) of the Institute of Animal Science, Chinese Academy of Agricultural Sciences (IAS-CAAS; Beijing, P. R. China) has approved all procedures involving laboratory animals. Ethics approval was also granted by the animal ethics committee of IAS-CAAS (No. IASCAAS-AE-03; December 12th, 2016).

The five sheep breeds used in this experiment included a total of 768 ewes, of which three were polytocous breeds (Small Tail Han sheep, n = 384; Cele Black sheep, n = 96; and Hu sheep, n = 96) and two were monotocous breeds (Sunite sheep, n = 96; and Bamei Mutton sheep, n = 96). The details of the five sheep breeds are displayed in Table 1. Blood samples were collected from all sheep via the jugular vein, anticoagulated with EDTA, and stored at −20 °C. Simultaneously record parity and litter size of the Small Tail Han sheep.

Table 1. Basic information on ewes used in this study.

Breed	Group	Number	District
Small Tail Han sheep	Polytocous	384	Yuncheng, Shandong Province, China
Hu sheep	Polytocous	96	Xuzhou, Jiangsu Province, China
Cele Black sheep	Polytocous	96	Cele, Xinjiang Uygur Autonomous Region, China
Sunite sheep	Monotocous	96	Wulateqianqi, Bayannaoer, Inner Mongolia Autonomous Region, China
Bamei Mutton sheep	Monotocous	96	Linhe, Bayannaoer, Inner Mongolia Autonomous Region, China

Blood DNA extraction

DNA was extracted using a blood DNA extraction kit (Tiangen Biotechnology Co., Ltd., Beijing, China). The extracted DNA samples were tested for concentration using NanoDrop 2000 (Thermo Fisher, USA) and quality was assessed by 1.5% agarose gel electrophoresis, and qualified samples were selected for subsequent experimental analysis.

Genotyping

The rs399534524 locus in CLSTN2, the rs407142552 locus in CTH, the rs414162829 locus in PLCB1, the chr13_1651705 locus in PLCB4 (Genomic version: Oar_v3.1), the rs1092455701 locus in CHST11, and the rs416244410 and rs426974615 locus in APAF1 use Sequenom MassARRAY® SNP technology for genotyping in polytocous and monotocous breeds of sheep. The primers for sheep genes used in this study were designed based on their sequence in GenBank (Table 2). Then, these primers were synthesized by Beijing Compass Biotechnology Co., Ltd. (Beijing, China).

Table 2. Primers used in the present study.

Gene	Locus	Primer sequence	Tm (°C)
APAF1	rs416244410	F: ACGTTGGATGTCTCTCCTGTTTCAGCTTTG R: ACGTTGGATGATGATGACCCATGGGTAAGC	48.9
	rs426974615	F: ACGTTGGATGGGTCACAGAACAAGAGAGAC R: ACGTTGGATGGGTGTTATGTATCCTCTGGG	45.9
CLSTN2	rs399534524	F: ACGTTGGATGTGACCAGCTGGGACATAACG R: ACGTTGGATGGAAACCATCCTCTGCAACTC	59.2
CTH	rs407142552	F: ACGTTGGATGTATTGAGGATGAGAAGGCAG R: ACGTTGGATGTGCAGTTGACTTAAACGAAG	50.6
PLCB1	rs414162829	F: ACGTTGGATGGGAACTGTTAGATCTCAGCC R: ACGTTGGATGATGCTCCACTTCCTACCTTG	51.8
PLCB4	chr13_1651705	F: ACGTTGGATGGGTGTGTGTGAAGCACATTC R: ACGTTGGATGGACCAAAGTGTACTATGTGAC	45
CHST11	rs1092455701	F: ACGTTGGATGACCAGGTCACCGACACCTGC R: ACGTTGGATGAATAGATGAGCTCGTGGTCC	62

Protein interaction networks predicted by STRING database

We predicted the protein interaction networks involving CTH and CLSTN2 through the STRING database v.11.0²⁹ (https://string-db.org), which is a useful tool for predicting protein interactions.

Statistical analysis

The allele and genotype frequency, polymorphism information content (PIC), heterozygosity (HE), effective allele number (NE), and p-value (Chi-square test) were calculated using the genotyping data. It was considered that the ewe population with p > 0.05 (Chi-square test) was in Hardy-Weinberg equilibrium. To determine the association between genotypes and litter size, the adjusted linear model, y_ijn = μ + P_i+ G_j + I_PG + e_ijn was applied, in which y_ijn is the phenotypic value (litter size); μ represents the population mean; P_i indicates the fixed effect of the i^th parity (i = 1, 2, or 3); G_j represents the effect of the j^th genotypes (j = 1, 2, or 3); I_PG is the interactive effect of parity and genotype; and e_ijn indicates the random error.

Results

Genotyping and population genetic analysis of SNPs in six genes

Two SNPs were detected in APAF1 (rs416244410 and rs426974615) and one SNP in five other genes (CLSTN2: rs399534524, CTH: rs407142552, PLCB1: rs414162829, PLCB4: chr13_1651705, CHST11: rs1092455701), respectively (Fig. 1). The loci rs416244410, rs399534524, rs407142552 and chr13_1651705 are in the intron region, whereas the loci rs426974615, rs414162829 and rs1092455701 are in the exon region. Among them, the rs416244410 and rs426974615 loci in APAF1 had low polymorphisms (PIC < 0.25) in all five sheep breeds and were in Hardy-Weinberg equilibrium (p > 0.05). The rs399534524 locus in CLSTN2 was moderately polymorphic (0.25 < PIC < 0.5) in all five sheep breeds. In addition, this locus was in Hardy-Weinberg equilibrium (p > 0.05) in Cele Black sheep, while it was not in Hardy-Weinberg equilibrium (p < 0.05) in other breeds. The rs407142552 locus in CTH was low polymorphism (PIC < 0.25) in Bamei Mutton sheep, while it was moderately polymorphism (0.25 < PIC < 0.5) in Small Tail Han sheep, Hu sheep, Cele Black sheep and Sunite sheep. Furthermore, this locus was in Hardy-Weinberg equilibrium (p > 0.05) in all five sheep breeds. The rs414162829 locus in PLCB1 and the chr13_1651705 locus in PLCB4 showed moderate polymorphism (0.25 < PIC < 0.5) in all five sheep breeds, and all were in Hardy-Weinberg equilibrium (p > 0.05). The rs1092455701 locus in CHST11 was low polymorphism (PIC < 0.25) and under Hardy-Weinberg equilibrium (p > 0.05) in all five sheep breeds (Table 3).

Figure 1. Genotyping results of candidate SNPs in six genes using MassARRAY® SNP system.

Table 3. Population genetic analysis of SNPs with different genes in five sheep breeds.

Gene	Locus	Breed	Genotype frequency			Allele frequency		PIC	HE	NE	Chi-square test(p-value)
APAF1	rs416244410		GG	GA	AA	G	A
		Small Tail Han sheep	0.86	0.14	0.00	0.93	0.07	0.13	0.14	1.16	0.97
		Hu sheep	0.81	0.18	0.01	0.90	0.10	0.16	0.18	1.22	0.95
		Cele Black sheep	0.94	0.06	0.00	0.97	0.03	0.06	0.06	1.06	0.75
		Sunite sheep	0.90	0.10	0.00	0.95	0.05	0.09	0.10	1.11	0.59
		Bamei Mutton sheep	0.98	0.02	0.00	0.99	0.01	0.02	0.02	1.02	0.92
	rs426974615		GG	GA	AA	G	A
		Small Tail Han sheep	0.01	0.09	0.90	0.05	0.95	0.09	0.10	1.11	0.32
		Hu sheep	0.03	0.17	0.80	0.11	0.89	0.18	0.20	1.25	0.08
		Cele Black sheep	0.00	0.04	0.96	0.02	0.98	0.04	0.04	1.04	0.83
		Sunite sheep	0.00	0.08	0.92	0.04	0.96	0.08	0.08	1.09	0.67
		Bamei Mutton sheep	0.00	0.02	0.98	0.01	0.99	0.02	0.02	1.02	0.92
CLSTN2	rs399534524		CC	CT	TT	C	T
		Small Tail Han sheep	0.69	0.22	0.09	0.80	0.20	0.27	0.32	1.48	0.00
		Hu sheep	0.59	0.24	0.17	0.71	0.29	0.33	0.41	1.69	0.00
		Cele Black sheep	0.31	0.43	0.26	0.53	0.47	0.37	0.50	1.99	0.16
		Sunite sheep	0.45	0.35	0.20	0.62	0.38	0.36	0.47	1.88	0.02
		Bamei Mutton sheep	0.43	0.25	0.32	0.55	0.45	0.37	0.49	1.98	0.00
CTH	rs407142552		CC	CT	TT	C	T
		Small Tail Han sheep	0.41	0.45	0.14	0.64	0.36	0.35	0.46	1.86	0.61
		Hu sheep	0.46	0.44	0.10	0.68	0.32	0.34	0.44	1.78	1.00
		Cele Black sheep	0.62	0.34	0.04	0.79	0.21	0.28	0.34	1.51	0.82
		Sunite sheep	0.46	0.38	0.16	0.65	0.35	0.35	0.46	1.84	0.08
		Bamei Mutton sheep	0.88	0.12	0.00	0.94	0.06	0.11	0.12	1.13	0.51
PLCB1	rs414162829		CC	CT	TT	C	T
		Small Tail Han sheep	0.06	0.40	0.54	0.26	0.74	0.31	0.38	1.62	0.38
		Hu sheep	0.04	0.29	0.67	0.19	0.81	0.26	0.30	1.44	0.68
		Cele Black sheep	0.15	0.47	0.38	0.38	0.62	0.36	0.47	1.89	0.96
		Sunite sheep	0.03	0.42	0.55	0.24	0.76	0.30	0.36	1.57	0.16
		Bamei Mutton sheep	0.09	0.43	0.48	0.31	0.69	0.34	0.43	1.74	0.98
PLCB4	chr13_1651705		GG	GT	TT	G	T
		Small Tail Han sheep	0.54	0.40	0.06	0.74	0.26	0.31	0.39	1.63	0.54
		Hu sheep	0.30	0.44	0.26	0.52	0.48	0.37	0.50	2.00	0.23
		Cele Black sheep	0.42	0.42	0.16	0.62	0.38	0.36	0.47	1.88	0.28
		Sunite sheep	0.40	0.42	0.18	0.61	0.39	0.36	0.48	1.91	0.31
		Bamei Mutton sheep	0.61	0.34	0.05	0.78	0.22	0.29	0.35	1.53	0.91
CHST11	rs1092455701		CC	CT	TT	C	T
		Small Tail Han sheep	0.71	0.27	0.02	0.84	0.16	0.23	0.27	1.37	0.71
		Hu sheep	0.80	0.19	0.01	0.90	0.10	0.17	0.19	1.23	0.96
		Cele Black sheep	0.95	0.05	0.00	0.97	0.03	0.05	0.05	1.05	0.79
		Sunite sheep	0.84	0.16	0.00	0.92	0.08	0.13	0.14	1.17	0.41
		Bamei Mutton sheep	0.95	0.05	0.00	0.97	0.03	0.05	0.05	1.05	0.79

NE: number of effective alleles; HE: heterozygosity; PIC: polymorphism information content; PIC > 0.5 is high polymorphism, 0.25 ≤ PIC ≤ 0.5 is moderate polymorphism, PIC < 0.25 is low polymorphism; p > 0.05 is in Hardy-Weinberg equilibrium; p < 0.05 is not in Hardy-Weinberg equilibrium.

Genotype and allele frequencies of seven SNPs in the six genes in monotocous and polytocous sheep

We classified the five breeds into two categories based on litter size characteristics: polytocous (Small Tail Han sheep, Cele Black sheep, and Hu sheep) and monotocous (Sunite sheep and Bamei Mutton sheep). Genotyping of seven SNPs in five sheep breeds showed that the allele and genotype frequencies of the rs416244410 locus in APAF1, the rs399534524 locus in CLSTN2, the rs407142552 locus in CTH, and the rs1092455701 locus in CHST11 were significantly different (p < 0.05) between polytocous and monotocous sheep breeds (Table 4). The allele frequency of the rs426974615 locus in APAF1 was significantly different (p < 0.05) between polytocous and monotocous sheep breeds, but the genotype frequency was not significantly different (p > 0.05). In addition, the allele and genotype frequencies of the rs414162829 locus in PLCB1 and the chr13_1651705 locus in PLCB4 were not significantly different (p > 0.05) in polytocous and monotocous breeds.

Table 4. Genotype and allele frequencies in sheep populations of different fecundity.

Gene	Locus	Types of fecundity	Genotype frequency(count)			Chi-square test (p-value)	Allele frequency		Chi-square test (p-value)
APAF1			GG	GA	AA		G	A
	rs416244410	Polytocous sheep	0.86(497)	0.13(75)	0.01(3)	0.02	0.93	0.07	0.01
		Monotocous sheep	0.94(180)	0.06(12)	0.00(0)		0.97	0.03
	rs426974615	Polytocous sheep	0.01(5)	0.10(56)	0.89(515)	0.06	0.06	0.94	0.01
		Monotocous sheep	0.00(0)	0.05(10)	0.95(182)		0.03	0.97
CLSTN2	rs399534524		CC	CT	TT		C	T
		Polytocous sheep	0.61(351)	0.26(149)	0.13(76)	0.00	0.74	0.26	0.00
		Monotocous sheep	0.44(84)	0.30(58)	0.26(50)		0.59	0.41
CTH	rs407142552		CC	CT	TT		C	T
		Polytocous sheep	0.46(262)	0.43(247)	0.11(66)	0.00	0.67	0.33	0.00
		Monotocous sheep	0.67(128)	0.25(48)	0.08(16)		0.79	0.21
PLCB1	rs414162829		CC	CT	TT		C	T
		Polytocous sheep	0.07(40)	0.39(226)	0.54(310)	0.76	0.27	0.73	0.76
		Monotocous sheep	0.06(12)	0.42(81)	0.52(99)		0.27	0.73
PLCB4	chr13_1651705		GG	GT	TT		G	T
		Polytocous sheep	0.48(276)	0.41(235)	0.11(65)	0.85	0.68	0.32	0.73
		Monotocous sheep	0.50(96)	0.39(74)	0.11(22)		0.69	0.31
CHST11	rs1092455701		CC	CT	TT		C	T
		Polytocous sheep	0.76(439)	0.22(125)	0.02(12)	0.00	0.87	0.13	0.00
		Monotocous sheep	0.90(172)	0.10(20)	0.00(0)		0.95	0.05

Associations between seven loci in six genes with litter size in Small Tail Han sheep

Association analysis (Table 5) revealed that the rs399534524 locus in CLSTN2 was significantly associated with the first parity litter size in Small Tail Han sheep (p < 0.05), and the litter size of ewes with CT genotype was higher than that of ewes with CC and TT genotypes in all parities. The rs407142552 locus in CTH was significantly associated with the second parity litter size in Small Tail Han sheep (p < 0.05), and the litter size of ewes with CT genotype was higher than that of ewes with TT genotype in all parities. However, locus rs426974615 and rs416244410 in APAF1, the rs414162829 in PLCB1, the chr13_1651705 in PLCB4, and the rs1092455701 in CHST11 have no significant correlation with litter size in Small Tail Han sheep (p > 0.05).

Table 5. Least squares mean and standard error of litter size in Small Tail Han sheep with different genotypes.

Gene	Locus	Genotype	1st parity litter size(n)	2nd parity litter size(n)	3rd parity litter size(n)
APAF1	rs416244410	GG	2.22 ± 0.05(296)	2.43 ± 0.06(230)	2.91 ± 0.12(81)
		GA	2.18 ± 0.12(49)	2.61 ± 0.14(38)	3.06 ± 0.19(16)
		AA	2.00 ± 0.00(2)	2.50 ± 0.50(2)	–
	rs426974615	GG	2.50 ± 1.50(2)	–	–
		GA	2.12 ± 0.13(34)	2.57 ± 0.14(28)	3.00 ± 0.25(12)
		AA	2.22 ± 0.05(311)	2.43 ± 0.06(240)	2.93 ± 0.12(84)
CLSTN2	rs399534524	CC	2.15 ± 0.05^a (240)	2.42 ± 0.06(187)	2.91 ± 0.14(64)
		CT	2.46 ± 0.10^b (76)	2.63 ± 0.12(57)	3.08 ± 0.17(26)
		TT	2.03 ± 0.11^a (31)	2.28 ± 0.23(25)	2.71 ± 0.42(7)
CTH	rs407142552	CC	2.20 ± 0.07(142)	2.40 ± 0.08^ab (108)	2.87 ± 0.14(38)
		CT	2.22 ± 0.06(161)	2.58 ± 0.09^a (120)	3.01 ± 0.18(45)
		TT	2.18 ± 0.15(44)	2.24 ± 0.13^b (42)	2.73 ± 0.27(15)
PLCB1	rs414162829	CC	2.05 ± 0.15(21)	2.73 ± 0.15(15)	2.33 ± 0.33(3)
		CT	2.26 ± 0.07(137)	2.57 ± 0.09(114)	3.10 ± 0.16(47)
		TT	2.19 ± 0.06(189)	2.33 ± 0.08(140)	2.81 ± 0.14(47)
PLCB4	chr13_1651705	GG	2.24 ± 0.06(196)	2.42 ± 0.07(156)	2.79 ± 0.12(57)
		GT	2.16 ± 0.08(130)	2.56 ± 0.10(95)	3.22 ± 0.21(32)
		TT	2.19 ± 0.18(21)	2.17 ± 0.23(18)	2.88 ± 0.35(8)
CHST11	rs1092455701	CC	2.21 ± 0.05(245)	2.44 ± 0.07(190)	2.99 ± 0.13(68)
		CT	2.20 ± 0.09(91)	2.48 ± 0.10(73)	2.88 ± 0.18(25)
		TT	2.36 ± 0.28(11)	2.50 ± 0.22(6)	2.50 ± 0.65(4)

Predicted protein interaction networks involving CTH and CLSTN2

To further explore the functions of CTH and CLSTN2 in sheep reproductive traits, proteins associated with them were predicted using the STRING website. The results (Fig. 2) showed that CTH and CLSTN2 were predicted to interact with 10 proteins, respectively. Among them, HTR1E,³⁰ NOM1, CCDC174 and ALPK3, which interact with CLSTN2, have been reported as candidate genes related to sheep litter size that may be involved in the reproductive process.¹⁵ Therefore, it is hypothesized that CLSTN2 is important for the development of reproductive traits in sheep.

Figure 2. Interactions between proteins including CTH (A) and CLSTN2 (B).

Discussion

CLSTN2 is a calcium-related gene involved in cell proliferation, differentiation, cell death, tumorigenesis and follicle expression.^13,31 Previous reports have shown that CLSTN2 is expressed in the uterus of rats, followed by an increase in 17-β-estradiol during the estrous cycle.¹⁴ In another study, the CLSTN2 gene was expressed in the ovary and fallopian tube of goat tissue.¹³ The ovary produces follicles containing eggs, which has a significant impact on mammalian fertility. Therefore, gene expression in the ovary is likely to be related to litter size. Additionally, a genome-wide association study revealed that CLSTN2 may be a candidate gene associated with litter size in Pelibuey sheep.¹⁵ And research has shown that the indel within the CLSTN2 gene is a candidate gene that affects goat fertility and can be used for marker assisted selection in goats.¹³ In addition, the gene coordinates the secretion of follicle-stimulating hormone from the hypothalamus,³² resulting in elevated estrogen levels, prolonged estrous cycle, and prolonged luteal phase, which inhibits ovulation and affects litter size.¹⁴ In this study, we found that the rs399534524 locus in CLSTN2 contained three genotypes in five sheep breeds, and the PIC values showed a moderate level of polymorphism, suggesting that it can be used for selection in sheep breeding; moreover, the locus was not in Hardy-Weinberg equilibrium in four breeds except Cele Black sheep, which may be the result of natural and artificial selection. We also found that the rs399534524 locus in CLSTN2 differed significantly in genotype frequency and allele frequency between polytocous and monotocous breeds, implying that this locus is significantly associated with lambing traits. Furthermore, we determined that the rs399534524 locus in CLSTN2 is highly correlated with first parity litter size in Small Tail Han sheep, and the litter size of ewes with CT genotype is higher than that of ewes with CC or TT genotype in all parities. This is consistent with previous studies suggesting that it may affect reproductive traits in sheep. Most physiological processes are supported by multiple proteins; therefore, building networks of protein interactions can enhance our understanding of complex traits such as reproduction. We predicted the protein interaction network involving CLSTN2, which interacts with 10 proteins, among which HTR1E,³⁰ NOM1, CCDC174 and ALPK3 have been reported as candidate genes related to sheep litter size and may be involved in the reproductive process.¹⁵ The HTR1E gene was enriched in the cAMP signaling pathway, where persistent cAMP signals from internalized LH receptors contribute to the transduction of LH effects within follicle cells and the oocyte.^15,33 The NOM1 gene is a member of the MIF4G/MA3 family, which is involved in processes that affect translation.³⁴ It is also an essential eukaryotic serine/threonine phosphatase required for many cellular processes, including cell division, signal transduction, and metabolism.³⁵ The CCDC174 gene is essential for neuronal differentiation.³⁶ Expression levels of CCDC174 as a potential marker for assessing semen quality and fertility in bulls.³⁷ The ALPK3 gene has been implicated in a variety of cellular processes, including protein translation, Mg²⁺ homeostasis, intracellular trafficking, cell migration, adhesion and proliferation.³⁸ These genes have not been reported in ewe reproduction and lambing and require further investigation. Therefore, we believe that the rs399534524 locus in CLSTN2 can be used as a potential molecular marker for litter size traits in Small Tail Han sheep.

CTH is one of the major enzymes involved in the production of the gasotransmitter H₂S in the body, using cystathionine and cysteine as substrates.³⁹ The production of free radicals such as H₂S has been linked to the regulation of ovarian function, including ovulation. Research has found that the H₂S generation system plays an important role in the propagation of preovulatory cascade reactions and follicular rupture.¹⁷ As a vasodilator and angiogenesis molecule, H₂S can regulate uterine vasodilation and stimulate placental angiogenesis, which affects the ovarian cycle and pregnancy.^40,41 And endogenous H₂S is one of the key factors in maintaining uterine quiescence during pregnancy.⁴² Additionally, research has found that CTH can be expressed in ovarian granulosa cells and affect ovulation rate in mice.¹⁷ Moreover, the H₂S-releasing enzyme CTH is present in porcine oocytes and produces endogenous H₂S, which is involved in the regulation of oocyte maturation and oocyte mound expansion.¹⁸ The CTH gene affects animal reproduction, but its effect on litter size in sheep has not been studied. In this study, we found that the rs407142552 locus in CTH contained three genotypes in sheep breeds except Bamei Mutton sheep, which may be due to low polymorphism, and three genotypes may be detected if we increase the number of ewes tested. The PIC values of the remaining four breeds showed moderate polymorphism. In addition, the locus was in Hardy-Weinberg equilibrium in five breeds. We also found that the rs407142552 locus showed a significant difference in genotype frequency and allele frequency between polytocous and monotocous breeds, suggesting that this locus is significantly associated with lambing traits. The present study also determined the relationship between rs407142552 and litter size in Small Tail Han sheep. It is worth noting that our results indicate a significant correlation between the rs407142552 locus in CTH and second parity litter size in Small Tail Han sheep. The ewes with CT genotype were significantly higher than the ewes with TT genotype, and it is also similar in the first and third parity. The results suggest that the rs407142552 locus may influence litter size in sheep. In addition, a protein interaction network was predicted in which CTH interacts with 10 proteins. CBS is expressed in oocytes and granulosa cells^18,43 and interacts with CTH to produce H₂S, which plays a role in the ovulation process.¹⁷ AHCYL1 is a novel estrogen-stimulated gene expressed in chicken oviduct epithelial cells and may affect growth and development and calcium metabolism in mature hens oviducts through the estrogen-mediated ERK1/2 MAPK cell signaling pathway.⁴⁴ Choline and folate intake in healthy pregnant women may be associated with polymorphisms in MTHFR, BHMT.⁴⁵ However, these genes have been less studied in reproduction, especially sheep reproduction has not been reported and needs further research. Therefore, we think that the rs407142552 locus in CTH can be used as a potential molecular marker for litter size traits in Small Tail Han sheep.

Apoptosis has been shown to play a critical role in maintaining ovarian homeostasis in mammals.^7,46 In mammalian ovaries, more than 99% of follicles undergo a degenerative process known as ‘atresia’, and only a few follicles ovulate during ovarian follicular development. Granulosa cell apoptosis plays a critical role in this process, follicular atresia.⁴⁷ APAF1 induces apoptosis by binding to cytochrome c and caspase-9, and the resulting complex accumulates in the cytoplasm where caspase-9 subsequently activates the caspase cascade leading to cell death.⁷ In the ovary, APAF1 was found to be abundant in granulosa cells of early antral follicles and the APAF1 and caspase-9 mediated mitochondrial signaling pathway plays a critical role in determining granulosa cell fate in porcine ovarian atresia. PLCB1 and PLCB4 are members of the phospholipase C beta family.²⁵ PLCB1 has been implicated in ovarian function, particularly in the regulation of oocyte meiotic timing.^48,49 Female mice with homozygous deletion mutations in the PLCB1 gene have altered reproductive behavior, ovulation, and pre-implantation embryo development and exhibit impaired implantation.^49–51 In addition, PLCB1 is a downstream effector of the GPCR signaling pathway, which plays a central role in mediating reproductive physiology; many reproductive hormones, particularly GnRH, FSH, LH, and oxytocin, are signaled by the GPCR. PLCB1 appears to play an important role in mediating GPCR signaling in reproductive physiology, as PLCB1 null mice are sterile and have pleiotropic reproductive defects. PLCB1 is essential for uterine implantation preparation and defects in PLCB1 mediated signaling during implantation are associated with aberrant ovarian steroid signaling and endogenous cannabinoid metabolism.²¹ PLCB4 acts as a master regulator that modulates PLCB1 and plays a role in calcium signaling, which is essential for proper uterine quiescence and smooth muscle contraction during gestation. In addition, PLCB4 plays a role in the embryonic development of the internal and external structures of the face, and when development is impaired, disruption of development can lead to fetal death.²⁴ Notably, a meta-analysis of global genomic studies found that both PLCB1 and PLCB4 were associated with litter size in sheep.²⁵ CHST11 is a target gene for TGFβ-like growth factors (such as TGFβ, BMP2, and activin).²⁶ Study finds that CHST11 regulates proliferation and apoptosis in mouse embryo chondrocytes.²⁸ CHST11 mRNA levels increase when BMP4 interacts with the phosphorylated Smad3 binding site in the CHST11 promoter.⁵² Furthermore, CHST11 has been associated with ovarian cancer, endometrial carcinomas and porcine farrowing interval.^53–55 These results suggest that CHST11 may regulate litter size in sheep through TGFβ and BMP signaling. We detected and analyzed SNPs and population genetic analysis, and found that the polymorphism information content of all sheep breeds ranged from 0 to 0.37, with most sheep breeds in Hardy-Weinberg equilibrium. In addition, the allele and genotype frequencies of the rs416244410 locus in APAF1 and the rs1092455701 locus in CHST11 differed significantly between polytocous and monotocous breeds. This suggests that SNP loci may be significantly associated with lambing traits. However, no significant correlation was found between these SNP loci and litter size in Small Tail Han sheep. Further investigation of the mechanisms is required.

Conclusions

The present study revealed that the allele and genotype frequencies of SNP for APAF1 (rs416244410), CLSTN2 (rs399534524), CTH (rs407142552), and CHST11 (rs1092455701) were significantly different between polytocous and monotocous breeds, and it was speculated that there might be a correlation between these loci and lambing traits. In addition, SNP rs399534524 in CLSTN2 and rs407142552 in CTH were significantly correlated with litter size in STH sheep, suggesting that SNPs rs399534524 and rs407142552 could be used as potential genetic markers in sheep breeding. Increased sample populations and additional function analyses of these two SNPs are needed to help verify our results.

Authors’ contributions

Kai Liu performed the experiments, analyzed the data, and wrote the first draft. Yufang Liu participated in tissue and serum collection and sample pretreatment. Mingxing Chu participated in the experimental design and revision of the manuscript.

Disclosure statement

The authors have declared that no competing interests exist.

Additional information

Funding

This research was funded by the National Natural Science Foundation of China (32172704), the Agricultural Science and Technology Innovation Program of China (CAAS-ZDRW202106 and ASTIP-IAS13), and the China Agriculture Research System of MOF and MARA (CARS-38).