Identification and characterization of five polymorphic microsatellite loci in the freshwater copepod Hemidiaptomus gurneyi (Copepoda: Calanoida: Diaptomidae)

Abstract

Hemidiaptomus diaptomid copepods are known to be excellent biological indicators for the highly biodiverse crustacean communities inhabiting Mediterranean temporary ponds (MTPs), an endangered inland water habitat whose conservation is considered a priority according to the “Habitat Directive” of the European Union. This study reports on the characterization of five polymorphic microsatellite loci in Hemidiaptomus gurneyi, to be used as markers for fine-scale studies on the population genetic structure and metapopulation dynamics of a typical and obligate MTP dweller. The five selected loci proved to be polymorphic in the species, with three to five polymorphic loci per studied population. Overall, mean heterozygosity scored for all loci and populations was lower than that reported for the few other diaptomid species for which microsatellite loci have been to date described; this is possibly due to the intrinsically fragmented and isolated peculiar habitat inhabited by the species. Furthermore, the presence of indels within the flanking regions of selected loci was scored. This study, albeit confirming the technical difficulties in finding proper microsatellite markers in copepods, provides for the first time a set of useful polymorphic microsatellite loci for a Hemidiaptomus species, thus allowing the realization of fine-scale phylogeographic and population genetics studies of this flagship crustacean taxon for MTPs.

Keywords:

• SSRs
• Mediterranean temporary ponds
• diaptomid copepods

Introduction

Mediterranean temporary ponds (MTPs) are endangered inland water habitats, which are widespread in the arid and semi-arid countries of the western Palaearctic biogeographical region (e.g., Zacharias & Zamparas 2010). Due to the noteworthy and peculiar biological diversity they host, MTPs are included among those priority habitats “whose conservation requires the designation of special areas of conservation” (European Economic Community (EEC), 2007; Annex I, habitat code: 3170*). Within the MTP biota, crustaceans are unanimously considered among the most representative taxa and, as permanent aquatic residents, they are good indicators of the ecological conditions of ponds (Marrone et al. 2006; Sahuquillo & Miracle 2010). Furthermore, it has been recently proved that the diaptomid copepod genus Hemidiaptomus, which includes 18 species widespread in the Palaearctic biogeographical region (Dussart & Defaye 2002; Stepanova 2005), is an excellent indicator for the highly biodiverse, often endangered crustacean communities exclusive to MTPs (see Marrone & Naselli-Flores 2004; Marrone et al. 2013; Sahuquillo & Miracle 2013; and references therein). The development of polymorphic microsatellite markers for this taxon is thus quite desirable in order to be able to get a sound insight into the biogeographical and metapopulation dynamics of the peculiar biota inhabiting the MTPs. This study reports on the isolation and characterization of five polymorphic microsatellite loci in Hemidiaptomus gurneyi (Roy 1927), with the aim of providing suitable markers for fine-scale studies on the population genetic structure and metapopulation dynamics of a typical and obligate MTP dweller.

Materials and methods

DNA was extracted from 10 H. gurneyi specimens from Tunisia – that is from the terra typica of the species (Roy 1927; Marrone et al. 2010) – using whole specimens and the QIAGEN DNeasy Blood and Tissue kit following the standard protocol. Size-selected fragments from genomic DNA were enriched for short tandem repeats (SSR) content by using magnetic streptavidin beads and biotin-labelled CT and GT or GTAT and GATA repeat oligonucleotides, respectively. The SSR-enriched library was analysed on a Roche 454 platform using the GS FLX Titanium reagents. The total of 27,348 reads had an average length of 177 bp. Of these, 1503 contained a microsatellite insert with a tetra- or a trinucleotide of at least six repeat units, or a dinucleotide of at least 10 repeat units. Suitable primers design was possible for 256 reads, of which 55 were tested for polymorphism (Table SI).

To determine polymorphisms of the newly developed microsatellite markers, the procedure described by Schuelke (2000) was followed. The final 10 μL volume of the polymerase chain reaction (PCR) mixes contained 2 μL of DNA template, 0.08–0.16 μL of the labeled forward primer (10 μM), 0.08–0.16 µL of the reverse primer (10 μM), 1 μL of 10X PCR buffer containing 15 mM magnesium chloride (MgCl₂), 1 μL of dNTP solution (2 mM), and 0.1 μL of HotStarTaq DNA polymerase (Qiagen; www.qiagen.com). A two-step PCR with the following conditions was carried out: initial denaturation at 95°C for 15 minutes, followed by 30 cycles at 95°C for 30 seconds, 56°C for 45 seconds and 72°C for 45 seconds, followed by eight cycles at 95°C for 30 seconds, 53°C for 45 seconds and 72°C for 45 seconds, and a final elongation at 72°C for 30 minutes. Amplifications were checked on a 1.5% agarose gel, and amplicons were run on an ABI PRISM 3130xl Genetic Analyser (Applied Biosystems; www.appliedbiosystems.com) to test for length polymorphisms. Additionally, a total number of 95 amplicons were also directly sequenced on the same machine to confirm the presence of microsatellite repeats. Sequencing conditions were as in Ketmaier et al. (2012).

The number of alleles, observed and expected heterozygosity, and P values for the Hardy–Weinberg equilibrium were calculated using Arlequin 3.5.1.2 (Excoffier & Lischer 2010). Resulting P-values were adjusted with the sequential Bonferroni correction for multiple comparisons (Rice 1989). Micro-Checker 2.2.3 (Van Oosterhut et al. 2004) was used to check for null alleles and scoring errors. FREENA (Chapuis & Estoup 2007) was used to compare uncorrected and corrected Fst values to test for the impact of null alleles, when present. Unfortunately, only five of the tested candidate loci proved to be sufficiently polymorphic and were thus retained (Table I).

Table I. Polymorphic microsatellite loci scored for Hemidiaptomus gurneyi. Bp: base pairs; Na: number of scored alleles; H_O: observed heterozygosity; H_E: expected heterozygosity.

Locus	Repeat motif	Primer sequence 5ʹ -> 3’	Size range (bp)	Na	Ho	He	Fluorescence label	Multiplex panel
1. Hemgur_000378	(TTAGG)12	F: AGTCAGCGGTTCGCAATTT R: CCGAGCATCTTCTTGTTTCC	154–170	8	0.401	0.399	VIC/1	1
2. Hemgur_001409	(TACA)18	F: TCCGCCGTTGAAGGTTTATC R: GTTCCTATCCCCGACATCCCC	73–159	6	0.171	0.197	PET/1	1
4. Hemgur_201232	(CTAT) 7	F: GATTGCCCCTCTGTTTTCCG R: CACACCTCGTCACACACTTG	139–145	5	0.305	0.313	VIC/3	3
9. Hemgur_205235	(ATG)7	F: TGTCGACGAGAATGGTGATG R: ACTGAGGAAAAGATTGACAGTGC	116–119	3	0.071	0.079	FAM/2	2
10. Hemgur_207140	(ATCT)11	F: GTAGCAAAGTCACGGGTTCG R: AACAGTTCACCTGGCAAAGC	153–166	8	0.511	0.460	FAM/4	4

A total of 92 H. gurneyi specimens collected from five populations in Algeria, Tunisia and Italy (Table II) were then genotyped with the corroborated primer pairs, with forward primers fluorescent dye-labelled (FAM, VIC, PET) and the same PCR conditions described above. In the light of the widespread presence of cryptic or pseudo-cryptic species within diaptomids, samples were collected from populations, which were previously tested to be strictly conspecific through sequencing of an mtDNA marker (see Marrone et al. 2010, and Marrone & Ketmaier, unpublished data). The fragment length was assessed on an ABI PRISM 3130xl Genetic Analyser (Applied Biosystems) and analysed with the software Peak Scanner^TM v. 1.0 (Applied Biosystems) with an internal size standard (LIZ500(−250) by Applied Biosystems).

Table II. List of the sampled localities.

Country	Site name	Population code	Latitude N (WGS84)	Longitude E (WGS84)	Elevation (m a.s.l.)
Tunisia	Oued El Amor	F014	36.927287	8.755628	4
Tunisia	Sejenane	F015	37.056287	9.233482	140
Tunisia	Tabarka	F249	36.936295	8.761124	2
Algeria	Kebouda	T4	36.732700	8.029717	3
Italy	Gorgo del Cerro	PA079	37.889944	13.394575	750

a.s.l.: above sea level.

Results and discussion

The five loci retained proved to be polymorphic in the species, with three to five polymorphic loci per studied population. The overall number of alleles per locus ranged from three to eight (Table I). Locus 4, Hemgur_201232, showed evidence of the presence of null alleles in the Algerian population “T4” (Table III); however, the uncorrected and corrected Fst values for this locus estimated in FREENA are similar (0.495415 vs 0.478804), thus showing that the effect of null alleles is negligible.

Table III. Characteristics of the five polymorphic microsatellite loci in five different Hemidiaptomus gurneyi populations. H_O: observed heterozygosity; H_E: expected.

Locus	Population	Specimens	HO	HE	Null allele	PHW
1. Hemgur_000378	F014	16	0.750	0.659	No	1
	F015	20	0.650	0.723	No	0.141
	F249	19	0.526	0.513	No	1
	T4	13	0.231	0.345	No	0.372
	PA079	16	0.250	0.226	No	1
2. Hemgur_001409	F014	16	-	-	No	No test done
	F015	20	0.650	0.711	No	0.512
	F249	20	-	-	No	No test done
	T4	16	0.375	0.502	No	0.328
	PA079	16	-	-	No	No test done
4. Hemgur_201232	F014	16	0.187	0.175	No	1
	F015	20	0.450	0.358	No	0.528
	F249	19	0.05	0.145	No	0.025
	T4	16	0.375	0.643	Yes	0.039
	PA079	20	0.700	0.642	No	0.041
9. Hemgur_205235	F014	16	-	-	No	No test done
	F015	20	0.300	0.261	No	1
	F249	20	-	-	No	No test done
	T4	16	0.125	0.226	No	0.190
	PA079	17	-	-	No	No test done
10. Hemgur_207140	F014	16	0.812	0.669	No	0.387
	F015	19	0.526	0.501	No	1
	F249	20	0.750	0.592	No	0.581
	T4	5	0.625	0.718	No	0.516
	PA079	20	0.350	0.358	No	1

heterozygosity; P_HW: probability that the population is in Hardy Weinberg equilibrium; -: monomorphic.

The overall mean expected (He) and observed (Ho) heterozygosity for all loci and populations were 0.290 (0.079–0.460) and 0.292 (0.071–0.511), respectively (Table III); these values are lower than those reported for other diaptomid species for which microsatellite loci have been to date described (cf. Zeller & Reusch 2004; Marszalek 2007), and are possibly to be ascribed to the intrinsically fragmented and isolated peculiar habitat inhabited by the species. In fact, in spite of their theoretical high potential for long-range passive dispersal, a high degree of regionalism and molecular structuring have been observed in MTP-dwellers (cf. Ketmaier et al. 2012; Incagnone et al. 2015), as also confirmed by the mostly significant pairwise Fst values scored in the frame of this survey (Table IV). After the sequential Bonferroni correction, no locus deviates from Hardy–Weinberg equilibrium with α = 0.05 for any population (Table III).

Table IV. Pairwise comparison among the studied Hemidiaptomus gurneyi populations. Below the diagonal: Fst values; above the diagonal: linear distance between populations (km); *: significant value after Bonferroni correction (α = 0.05).

	F014	F015	F249	T4	PA079
Oued El Amor – F014	-	44.9	1.1	68.3	424.3
Sejenane – F015	0.45677*	-	44.1	113.2	379.5
Tabarka – F249	−0.00609	0.50901*	-	69.1	423.5
Kebouda – T4	0.41813*	0.43387*	0.48276*	-	492.5
Gorgo del Cerro – PA079	0.59689*	0.56698*	0.63524*	0.46733*	-

The sequencing of homozygote specimens for loci 1 (Hemgur_000378) and 2 (Hemgur_001409) showed the presence of variability within the flanking regions. In more detail, for locus 1 we found a T–G transversion consistently discriminating between the North African and the Italian populations and for locus 2 a deletion in all samples of the PA079 population. While in the case of these two loci, the observed variability in the flanking regions did not affect the overall amplification rate that remained high, we cannot exclude that – on a more general level – such a variability might affect primer binding sites, thus also possibly preventing amplification success. The presence of sequence and/or length polymorphisms in the microsatellite flanking regions might account for microsatellite length variability not in line with what is expected on the basis of microsatellite motif only. These findings are in good agreement with what is known on the peculiar genomic features of microsatellite flanking regions in copepods (cf. Marszalek 2007). This study confirms the difficulties in finding proper microsatellite markers in diaptomid copepods, which proves to be a challenging task: in fact, they are currently available only for two European species belonging to the genus Eudiaptomus (with seven and three loci, respectively; Zeller & Reusch 2004) and for the North American species Hesperodiaptomus shoshone (five loci; Marszalek 2007); none of these species occur in MTPs. Nevertheless, the polymorphic microsatellite loci identified and described in this study can be used for future phylogeographic and population genetics studies of this flagship copepod species for Mediterranean temporary ponds.

Supplemental data

Supplemental data for this article can be accessed here: http://dx.doi.org/10.1080/11250003.2015.1126363.

Acknowledgements

FM’s stay at the University of Potsdam was supported by a “research stay” grant provided by the Deutscher Akademischer Austausch Dienst (DAAD, ref. code: A/13/04399). FM thanks Roberto Biello (University of Ferrara, Italy) for the useful discussions and comments provided. The comments of an anonymous referee allowed us to improve a first draft of the manuscript.