Role of P2X₇ on steroid synthesis in murine luteal cells

ABSTRACT

The extracellular adenosine triphosphate (ATP) regulates different cellular functions through activating purinergic receptors as a signalling molecule or neurotransmitter. P2X₇ is highly expressed in murine small luteal cells. In this study, murine luteal cells were cultured in vitro and treated with P2X₇ agonists – ATP and 2′(3′)-O-(4-benzoyl-benzoyl)-adenosine 50-triphosphate (BzATP) and with P2X₇ antagonist – brilliant blue G (BBG). We found that ATP and BzATP increased the production of progesterone and had no influence on the production of estradiol. BBG reversed the effect of BzATP and ATP. Further studies demonstrated that ATP and BzATP promoted the expression of CYP11A. These results revealed that P2X₇ receptor activation is involved in the steroid synthesis in corpus luteum.

KEYWORDS:

• Luteal cell
• P2X₇
• progesterone

Introduction

The main function of corpus luteum is the secretion of progesterone, which controls the oestrous cycle and is also necessary for the blastocyst implantation. When pregnancy does not occur, the progesterone is decreased and structural luteolysis follows. The progesterone production is strictly controlled by nervous and humoral regulation. Noradrenergic stimulation regulates the progesterone production in luteal cells.[1] Endocrine and paracrine molecules, such as luteinizing hormone, human chorionic gonadotropin (hCG), insulin-like growth factor system and prostaglandin F2α (PGF2α), also regulate the secretion of progesterone in luteal cells.[2–6]

As a signalling molecule or neurotransmitter, extracellular adenosine triphosphate (ATP) regulates different cellular functions through activating purinergic receptors.[7] Some studies have shown that purinergic signalling is activated and plays an important role in ovaries.[8–11] ATP activated the caspase signalling pathway and induced apoptosis in human granulosa-luteal cells.[12,13] In our previous study, we found that P2X₇ was highly expressed in murine small luteal cells.[14] Activation of P2X₇ inhibited luteal cell proliferation, [14] suggesting that the P2X₇ purinergic signalling plays important role in corpus luteum. Studies have also shown that purinergic receptors, such as P2Y₂ and P2Y₄, were involved in the synthesis of steroids in granulose cells.[15] However, the role of P2X₇ purinergic signalling on steroid synthesis of luteal cells is still unclear. In this study, we explored the influence of P2X₇ purinergic signalling on progesterone and estradiol in corpus luteum.

Materials and methods

Animals and treatment

Immature Kunming mice (26-day-old) were purchased from Animal Facility of Nanchang University and housed in a temperature and light controlled facility with free access to water and food. The experimental protocols were approved by the ethical committee of Nanchang University. For each experiment, six mice were injected intraperitoneally with 36 IU of pregnant mare's serum gonadotropin (NingBo Biological Technology) to induce follicular maturation. Seventy two hours later, they were administered with 36 IU hCG (NingBo Biological Technology) to induce ovulation and luteinization. The ovaries were collected seven days after the hCG treatment.

Chemicals

P450 side-chain cleavage enzyme gene (CYP11A, BA4136) was purchased from Boster (Wuhan China). β-Actin (A5316) was purchased from Sigma. Brilliant SYBR Green Quantitative Polymerase Chain Reaction (qPCR) Master Mix (FP-202) was purchased from Tiangen (Beijing, China). Collagenase (type I), DNase I, 2′(3′)-O-(4-benzoyl-benzoyl)-adenosine 50-triphosphate (BzATP), ATP and brilliant blue G (BBG), a P2X₇ specific antagonist, were purchased from Sigma.

Luteal cell culture

The procedure of cells’ isolation from luteinized ovaries was performed as described in previous studies.[14,16] First, the luteinized ovaries were taken out and the fat and capsule tissue, were removed. After the mechanical dissection, the ovaries were digested in medium containing 1 mg/mL collagenase (Sigma, St. Louis, Missouri), 0.025% trypsin (Sigma, St. Louis, Missouri) and 0.02 mg/mL Dnase I (Sigma, St. Louis, Missouri) for 10 min at 37 °C. The digested suspension was filtered through 75 μm strainer to remove the debris and then was centrifuged (Xiangyi centrifuge instrument) at 500 g for 5 min. Following two washes with medium, the cells were inoculated in Dulbecco's modification of Eagle's medium/F12 culture medium (HyClone), supplemented with 5% (v/v) foetal bovine serum, 100 IU/mL penicillin (Solarbio) and 100 µg/mL streptomycin sulphate (Solarbio) and cultured overnight for adhesion. After this period, the cells were cultured only in fresh medium (control) or in fresh medium with 100 μmol/L BzATP, 100 μmol/L ATP, 1 μmol/L BBG,100 μmol/L BzATP + 1 μmol/L BBG or 100 μmol/L ATP + 1 μmol/L BBG.

Hormone measurements

Luteal cells were cultured in serum free medium and treated with ATP, BzATP, BBG, ATP + BBG or BzATP + BBG. After 48 h, we harvested the media supernatant and stored it at –80 °C for further hormone measurement. The estradiol (pg/10⁶ cells) and progesterone (ng/10⁶ cells) values were measured with a commercial radioimmunoassay kit at a commercial laboratory (Beijing Sino-uk institute of Biological Technology). For BBG, ATP + BBG and BzATP + BBG groups, only the progesterone quantity was measured. The intra- and inter-assay coefficients of variation were <10%. The cross-reactivity with other peptides and steroid hormones in these kits did not exceed 4%. The sensitivity of the progesterone and estradiol are 0.25 ng/mL and 2 pg/mL, respectively. The total cell number was counted and used to correct the estradiol and progesterone production, because the values of the estradiol and progesterone production will depend on the number of cells in the wells.

RNA extraction and real-time PCR

Steroidogenic acute regulatory protein (StAR), CYP11A and 3β-hydroxysteroid dehydrogenase (3β-HSD) are involved in steroid hormone synthesis. We examined the mRNA expression of StAR, CYP11A and 3β-HSD after treatment with ATP and BzATP, and the effect of BBG on CYP11A mRNA expression, induced by ATP and BzATP through qPCR.[17–21] Luteal cells were lysed with Trizol Reagent. Total RNA was extracted according to the manufacturer's instructions (Invitrogen). Total RNA (2 µg) was reverse transcribed in a mixture with final volume of 25 µL, containing random primers, Moloney murine leukaemia virus reverse transcriptase (M-MLV RT), reaction buffer, dNTP and RNasin following M-MLV First Strand Kit (Invitrogen, C28025032).The sequences of the specific primers are listed in Table 1. Real-time PCR was performed in a 20 μL reaction volume containing 10μL of 2 × Brilliant SYBR Green qPCR Master Mix, 1 μL cDNA, 0.5 μmol/L primers and 300 nmol/L of ROX reference dye, by using the ABI thermal cycler 7500 (Applied Biosystems, Carlsbad, California). The thermal cycling conditions were 94 ℃ for 15 min, followed by 40 cycles at 94 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s. Melting curve analyses were conducted after the real-time PCR. The mRNA expression level was normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA level and analysed using the comparative Ct method.

Table 1. Oligonucleotides used for real-time PCR.

Gene	Primers
3β-HSD	5′CTCAGTTCTTAGGCTTCAGCAATTAC3′ (sense)
3β-HSD	5′GCCCAATTCCCAGACAGTAG3′ (antisense)
StAR	5′CCGGAGCAGAGTGGTGTCA3′ (sense)
StAR	5′CAGTGGATGAAGCACCATGC3′ (antisense)
CYP11A	5′CCAGTGTCCCCATGCTCAAC3′ (sense)
CYP11A	5′TGCATGGTCCTTCCAGGTCT3′ (antisense)
GAPDH	5′TCCTTGGAGGCCATGTAGGCCAT3′ (sense)
GAPDH	5′TGATGACATCAAGAAGGTGGTGAAG3′ (antisense)

Note: steroidogenic acute regulatory protein (StAR); P450 side-chain cleavage enzyme gene (CYP11A); 3β-hydroxysteroid dehydrogenase (3β-HSD); glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Western blotting

Luteal cells were lysed in radioimmune precipitation assay lysis buffer (50 mmol/L Tris (pH 7.4), 150 mmol/L NaCl, 1% NP-40, 0.5% sodium deoxycholate) with Mini protease-inhibitor cocktail tablets (Roche, Mannheim, Germany). We tested the total protein concentration through Bradford assay (Bio-Rad Laboratories, Hercules, CA). Samples with equal amounts of protein were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (Bei jing liu yi biotechnology Co., Ltd) and transferred to nitrocellulose membranes. The membrane was blocked with 5% non-fat dry milk and was incubated overnight with primary CYP11A antibody (1:500) at 4 °C. The membrane was then washed with Tris-buffered saline with Tween-20 (TBST, pH 8.0) and incubated with horseradish peroxidase (HRP)-labelled anti-rabbit secondary antibody (1:2000) for 1 h at room temperature. Specific signals were detected on autoradiography film by using the enhanced chemiluminescence kit (Thermo pierce). Protein expression level was normalized against β-actin.

Statistical analysis

The data were evaluated for statistical differences by using SPSS computer software. Data are expressed as mean ± standard error of the mean (SEM) One-way analysis of variance followed by a least-significant-difference test was used for statistical comparisons among multiple groups. The significance was assured when the P value was less than 0.05.

Results and discussion

P2X₇ receptors are extracellular ATP-gated ion channels, which are expressed in different cell types. P2X₇ activation is involved in numerous physiological and pathological processes, such as the induction of the inflammatory cascade, tumour progression and pain mechanisms.[22–24] P2X₇ signalling is also related to cell proliferation and apoptosis.[25,26] Studies have shown that P2X₇ is expressed in porcine ovarian theca cells and murine/human ovarian surface epithelium and is involved in ATP-induced apoptotic cell death.[14,27,28] In a previous study, we also reported that P2X₇ was expressed in murine small luteal cells.[14] The activation of P2X₇ receptors decreased the proliferation of luteal cells.[14] These data implied that P2X₇ signalling is involved in corpus luteum formation. However, the main function of corpus luteum is the secretion of progesterone, which is useful for the control of the oestrous cycle and is necessary for the implantation of the blastocyst. The influence of P2X₇ signalling on steroid synthesis is not clear. In this study, we explored the influence of P2X₇ activation on steroid synthesis in luteal cells. We cultured murine luteal cells and harvested the media supernatant to measure the progesterone and estradiol after treatment with ATP and BzATP. As shown in Figure 1(A) and 1(B), ATP and BzATP treatment increased the progesterone secretion and had no effect on estradiol. To confirm that the progesterone increase was dependent on P2X₇ signalling, we employed BBG, as a P2X₇ specific antagonist.[29] The results showed that BBG partially reversed the influence of ATP and BzATP on the progesterone production (Figure 2). These results suggested that P2X₇ signalling was involved in regulating the progesterone synthesis in luteal cells.

Figure 1. Influence of P2X₇ purinergic signalling on (A) progesterone and (B) estradiol secretion in luteal cells.

Figure 2. Effect of BBG on progesterone secretion in luteal cells, induced by ATP and BzATP.

To analyse the possible mechanism, we found that ATP and BzATP promoted the protein level and expression of CYP11A. There was no obvious change in 3β-HSD and StAR expression levels (Figure 3). CYP11A cleaves the cholesterol to pregnenolone. It is an important step in progesterone biosynthesis.[18] BBG also reversed the change of CYP11A induced by ATP and BzATP (Figure 4), suggesting that ATP and BzATP possibly influenced the progesterone production through regulating CYP11A.

Figure 3. mRNA level of (A) CYP11A, 3β-HSD, StAR and (B) protein level of CYP11A in luteal cells assessed by real-time PCR and Western blotting.

Figure 4. The effect of BBG on CYP11A mRNA expression induced by ATP and BzATP.

Mitogen-activated protein kinases (MAPKs) include a large family of kinases that respond to diverse physiological stimuli. Several MAPK signalling pathways were involved in progesterone synthesis in corpus luteum. Extracellular regulated protein kinases1/2 (ERK1/2) activation is required for progesterone production in human granulosa-lutein cells.[30] Studies of water buffalo showed that c-Jun N-terminal kinase (JNK) and p38 MAPK played an important role in the PGF2α-mediated apoptotic cell death in the corpus luteum.[31] Studies of bonnet monkey showed that all three MAPKs appeared to be constitutively active in the mid-luteal-phase corpus luteum. During the late-luteal phase, ERK1/2 and p38MAPK decreased. However, JNK-1/2 activities increased significantly. hCG also activated ERK1/2 and p38MAPK activity, but inhibited JNK-1/2. Intraluteal administration of p38 kinase inhibitor (SB203580) inhibited the luteal function.[32] These studies revealed that there is a disagreement about the p38MAPK function in luteal cells. Our previous studies showed that ATP and BzATP inhibited the p38MAPK signalling pathway in luteal cells.[14] The study of granulosa cell tumours showed that inhibition of p38MAPK signalling contributed to the increase of progesterone production induced by staurosporine.[33] Therefore, p38MAPK signalling is possibly involved in regulating the progesterone production induced by ATP and BzATP. Further studies should be done to explore the mechanism in details.

Conclusions

The results from this study demonstrated that P2X₇ signalling was involved in progesterone synthesis in murine corpus luteum through regulating CYP11A. The finding will help to explain the physiological and pathological effects of ATP on corpus luteum, as an endocrine molecule or neurotransmitter. Further researches need to be done to explore the exact mechanism.

Disclosure statement

No potential conflict of interest was reported by the authors.

Additional information

Funding

This study was supported by Jiangxi science and technology support project [grant number 20141BBG70065]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.