Autophagy regulates biliary differentiation of hepatic progenitor cells through Notch1 signaling pathway

ABSTRACT

Autophagy plays important roles in self-renewal and differentiation of stem cells. Hepatic progenitor cells (HPCs) are thought to have the ability of self-renewal as well as possess a bipotential capacity, which allows them to differentiate into both hepatocytes and bile ductular cells. However, how autophagy contributes to self-renewal and differentiation of hepatic progenitor cells is not well understood. In this study, we use a well-established rat hepatic progenitor cell lines called WB-F344, which is treated with 3.75 mM sodium butyrate (SB) to promote the differentiation of WB-F344 along the biliary phenotype. We found that autophagy was decreased in the early stage of biliary differentiation, and maintained a low level at the late stage. Activation of autophagy by rapamycin or starvation suppressed the biliary differentiation of WB-F344. Further study reported that autophagy inhibited Notch1 signaling pathway, which contributed to biliary differentiation and morphogenesis. In conclusions, autophagy regulates biliary differentiation of hepatic progenitor cells through Notch1 signaling pathway.

KEYWORDS:

• autophagy
• biliary differentiation
• hepatic progenitor cells
• Notch1

Introduction

Macroautophagy (hereafter referred to as autophagy), characterized as an important process of cellular homeostasis, takes place in all eukaryotic cells and involves the sequestration of cytoplasmic components in double membrane autophagosomes, which is a basic mechanism involving cell degradation of unnecessary or dysfunctional cellular components by lysosomes.^1,2 Autophagy takes part in physiological and pathological processes including cancer, metabolic disease, neurodegenerative disorders, cell growth, cell death and ontogeny.³ Recent studies have demonstrated autophagy plays important roles in self-renewal and differentiation of stem cells.^4-7 However, how autophagy contributes to self-renewal and differentiation of hepatic progenitor cells is not well understood.

Hepatic progenitor cells (HPCs) are thought to have the ability of self-renewal as well as possess a bipotential capacity, which allows them to differentiate into both hepatocytes and bile ductular cells.^8,9 Its differential process is controlled by many signaling pathways, such as Notch, Wnt, BMP, TGF-B, HGF and FGF signaling pathways.^10,11

Notch signaling pathway is a highly evolutionarily conserved pathway. During ontogeny, Notch signaling pathway controls liver development by regulating biliary differentiation.^12-16 Notch signaling pathway is required for normal bile duct development, and Notch pathway ablation results in bile duct paucity, a characteristic of Alagilles syndrome.^17-19 In mammals, 2 Jagged proteins (Jagged1 and Jagged2) and 3 Deltas (Dll1, Dll3 and Dll4) have been identified as Notch ligands. Four Notch receptors(Notch1-4) interacted with Notch ligands belong to the Delta-Serrate-Lag-2 (DSL) family.^20,21 The Notch signaling pathway is initiated by the interaction between the receptors and ligands, which triggers a metalloprotease cleavage of the Notch receptor followed by its intramembrane proteolysis by the γ-secretase complex.²² The Notch intracellular domain (NICD) then translocates to the nucleus where it forms a NICD/RBPJk complex.²³ The heteromeric transcriptional complex induces protein targets such as Hes and Hey family.²⁴

Autophagy is reported to be related with Notch signaling pathway. In Drosophila oogenesis, the loss of autophagy leads to the activation of the Notch signaling pathway.²⁵ In cardiac differentiation, Autophagy eliminates cytoplasmic NICD to promote cardiac differentiation.²⁶ However, whether autophagy regulates Notch signaling pathways in biliary differentiation is not well understood. Here we report that autophagy regulates biliary differentiation of hepatic progenitor cells through Notch1 signaling pathway.

Results

Autophagy is decreased in the early stage of biliary differentiation of WB-F344 cells and maintains a low level at the late stage

To determine whether autophagy is involved in biliary differentiation of WB-F344 cells, we examine the morphology and expression of biliary lineage markers of WB-F344 cells cultured with 3.75 mM Sodium butyrate (SB). WB-F344 cells are small and polygonal and have a high nuclear/cytoplasmic ratio when cultured in normal media. However, when WB-F344 cells are treated with SB for 5 days, the sizes of them are larger than control (Fig. 1A). In addition, the nuclear/cytoplasmic ratio is also reduced (Fig. 1A). We also analyze the early biliary transcription factor Hnf1b and the mature biliary lineage makers Hnf6, Krt19 and γ-GT, which are notably increased when treated with SB for 5 d (Fig. 1B).Moreover, under Sodium butyrate induced differentiation conditions, proliferation is decreased relative to control (Fig. 1C). These results show that WB-F344 cells are treated with 3.75 mM SB to promote the differentiation along the biliary phenotype. At the same time, we detect the level of LC3-II/LC3-I and P62 during the whole stage of differentiation. We observe that the LC3-II/LC3-I level is high in WB-F344 cells; when treated with SB, LC3-II/LC3-I level is rapidly decreased in the first 3 days, and maintains a low level until the fifth day(Fig. 1D).On the contrary, P62 level (an indicator of autophagy) is increased(Fig. 1D). We quantify normalized LC3-II/LC3-I that is also decreased (Fig. 1E).In order to observe the formation of autophagic vacuoles intuitively, the electron microscopy is employed. Without SB induction, the autophagic vacuoles in WB-F344 cells are easy to detect. On the contrary, the autophagic vacuoles are decreased in WB-F344 cells treated with SB for 5 d (Fig. 1F). These findings indicate that autophagy is decreased in the early stage of biliary differentiation of WB-F344 cells and maintains a low level at the late stage.

Figure 1. Autophagy is decreased in the early stage of biliary differentiation of WB-F344 cells and maintains a low level at the late stage. (A) The morphology of WB-F344 cells cultured in normal media (Left panel, Ctrl, Control) or treated with 3.75 mM Sodium butyrate (SB) for 5 day (Right panel, SB, Sodium butyrate); (Scale bars = 20 μm, Inset: 2X magnification). (B) qRT-PCR analyzing the expression of biliary lineage markers, the early biliary transcription factor (Hnf1b) and the mature biliary lineage makers (Hnf6, Krt19 and γ-GT) in WB-F344 cells treated with SB for 5 d. (C) The proliferation of WB-F344 cells cultured in normal media (Ctrl, red) or treated with 3.75 mM Sodium butyrate (SB) for 5 day (SB, Green).(D)Western blot showing autophagy in SB-induced WB-F344 cells. The level of LC3-II/LC3-I and P62 at the indicated time-points are determined and Actin is used as an internal control. (E) Densitometric analysis of LC3-II relative to LC3-I normalized to time 0d (0d vs 1d-5d).(F) Autophagic vacuoles (arrowheads) were observed at WB-F344 cells cultured in normal media(Ctrl) or treated with 3.75 mM Sodium butyrate for 5 day (SB) under an electron microscope (Scale bars = 1 μm). WB-F344 cells without treatment of 3.75 mM Sodium butyrate (SB) are used as control. Data represent mean ± SEM *P < 0.05; **P < 0.01. n = 3.

Activation of autophagy suppresses the biliary differentiation of WB-F344 cells

To investigate whether induction of autophagy has an effect on the biliary differentiation of WB-F344 cells, we examine the effect of 2 autophagy stimuli, the mTOR inhibitor rapamycin and starvation, on the biliary differentiation of WB-F344 cells.WB-F344 cells are treated with SB for 4 days, and co-culture DMSO, rapamycin or starvation at the fifth day. Western blot analysis indicates that LC3-II/LC3-I level is increased and P62 level is decreased by rapamycin (Fig. 2A) or starvation (Fig. 2C). Rapamycin decreases the mRNA expression of Hnf1b, Hnf6, Krt19 and γ-GT relative to DMSO (Fig. 2B). Starvation also attenuates the mRNA expression of Hnf1b, Hnf6, Krt19 and γ-GT relative to DMSO (Fig. 2D). These results indicate that Activation of autophagy suppresses the biliary differentiation of WB-F344 cells.

Figure 2. Activation of autophagy suppresses the biliary differentiation of WB-F344 cells. (A) Western blot showing the level of LC3-II/LC3-I and P62 in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or rapamycin (Sigma, 200 nM; Rapa) for 24h. (B) qRT-PCR analyzing the expression of biliary lineage markers (Hnf1b, Hnf6, Krt19 and γ-GT) in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or rapamycin (200 nM; Rapa) for 24h. (C) Western blot showing the level of LC3-II/LC3-I and P62 in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or starvation (serum-free medium; Starve) for 24h. (D) qRT-PCR analyzing the expression of biliary lineage markers (Hnf1b, Hnf6, Krt19 and γ-GT) in WB-F344 treated with 3.75 mM SB for 4 d and co-culture DMSO, or starvation (serum-free medium; Starve) for 24h. Data represent mean ± SEM *P < 0.05, **P < 0.01. n = 3.

Notch1 signaling pathway is up-regulated in the biliary differentiation of WB-F344 cells

We have demonstrated that activation of autophagy suppresses the biliary differentiation of WB-F344 cells. Next, we explore how autophagy influences the biliary differentiation. We firstly investigate whether Notch signaling pathway takes part in the biliary differentiation of WB-F344 cells. After exposing to SB for 5 days, the mRNA and protein expression of Jagged1, Notch1 are elevated(Fig. 3A and Fig. 3C); Notch1 protein level is enhanced by immunofluorescence(Fig. 3B).The mRNA expression of Hes1, Hes5, Hey1 and Heyl, the target genes of the Notch1 signaling pathway, are increased during the biliary differentiation of WB-F344 cells(Fig. 3D). Western blot assay also indicate that the expression of Hes1 is increased (Fig. 3A). These findings show that Notch1 signaling pathway is upregulated in the biliary differentiation of WB-F344 cells.

Figure 3. Notch1 signaling pathway is up-regulated in the biliary differentiation of WB-F344 cells. (A) Western blot showing the level of Jagged1, Notch1 and Hes1 in WB-F344 cells treated with 3.75 mM SB for 5 d. (B) Immunofluorescence staining Notch1(red; arrow) and DAPI(blue; DNA) in WB-F344 cells treated with 3.75 mM SB for 5 days(Scale bars = 20 μm).(C)qRT-PCR analyzing the mRNA expression of Jagged1, Notch1 in WB-F344 cells treated with 3.75 mM SB for 5 d. (D) qRT-PCR analyzing the expression of the target genes of the Notch signaling pathway (Hes1, Hes5, Hey1 and Heyl) in WB-F344 cells treated with 3.75 mM SB for 5 d. WB-F344 cells without treatment of 3.75 mM Sodium butyrate (SB) are used as control. Data represent mean ± SEM *P < 0.05, **P < 0.01. n = 3.

Autophagy inhibits Notch1 signaling pathway during the biliary differentiation of WB-F344 cells

It has been reported that autophagy can interfere Notch signaling pathway in Drosophila oogenesis and cardiac differentiation.^25,26 Therefore, we investigate whether Notch1 signaling pathway can be regulated by autophagy during the biliary differentiation of WB-F344 cells. We also examine the effect of 2 autophagy stimuli, the mTOR inhibitor rapamycin and nutrient deprivation medium, on the biliary differentiation of WB-F344 cells. Activation of autophagy by rapamycin, the mRNA and protein expression of Hes1, Hes5, Hey1 and Heyl are decreased (Fig. 4A and Fig. 4B) relative to DMSO. Similarly, starvation also attenuates the mRNA and protein expression of Hes1, Hes5, Hey1 and Heyl (Fig. 4C and Fig. 4D) relative to DMSO. These data demonstrate that the Notch1 signaling pathway is inhibited by autophagy during the biliary differentiation of WB-F344 cells.

Figure 4. Autophagy inhibits Notch1 signaling pathway during the biliary differentiation of WB-F344 cells. (A) qRT-PCR analyzing the expression of the target genes of the Notch signaling pathway(Hes1, Hes5,Hey1 and Heyl) in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or rapamycin( 200 nM,Rapa) for 24h. (B) Western blot showing the level of Hes1, Hes5, Hey1 and Heyl in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or rapamycin( 200 nM,Rapa) for 24 h. (C)qRT-PCR analyzing the expression of the target genes of the Notch signaling pathway(Hes1, Hes5,Hey1 and Heyl) in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or starvation (serum-free medium, Starve) for 24h. (D) Western blot showing the level of Hes1, Hes5, Hey1 and Heyl in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or starvation (serum-free medium, Starve) for 24h. Data represent mean ± SEM *P < 0.05, **P < 0.01, n = 3.

To further explore whether Notch1 signaling pathway is able to regulate autophagy, we co-culture either DMSO or DAPT (a γ- secretase inhibitor) in differentiation medium. WB-F344 cells are treated with SB for 4 days, and co-culture DMSO, DAPT at the fifth day. Inhibition of Notch1 signaling pathway by DAPT results in the lower mRNA expression of Hes1, Hes5, Hey1 and Heyl (Fig. 5A) and the lower protein level of Hes1, Hes5, Hey1 and Heyl (Fig. 5B). The lower Hes and Hey mRNA expression are associated with the lower mRNA expression of Hnf1b, Hnf6, Krt19 and γ-GT (Fig. 5C), but there is no effect on LC3-II/LC3-I and P62 levels (Fig. 5D) when Notch1 signaling pathway is Inhibited. These results indicate that autophagy is not able to be influenced by Notch1 signaling pathway during the biliary differentiation of WB-F344 cells.

Figure 5. Autophagy is not able to be influenced by Notch1 signaling pathway during the biliary differentiation of WB-F344 cells. (A) qRT-PCR analyzing the expression of the target genes of the Notch1 signaling pathway (Hes1, Hes5, Hey1 and Heyl) in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or DAPT (Sigma, 25 μM) for 24h. (B)Western blot showing the level of Hes1, Hes5, Hey1 and Heyl in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or DAPT (25 μM) for 24h. (C) qRT-PCR analyzing the expression of biliary lineage markers (Hnf1b, Hnf6, Krt19 and γ-GT) in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or DAPT (25μM) for 24h. (D) Western blot showing the level of LC3-II/LC3-I and P62 in WB-F344 cells treated with 3.75 mM SB for 4 d and co-culture DMSO, or DAPT (25μM) for 24h. Data represent mean ± SEM *P < 0.05, **P < 0.01. n = 3.

Discussion

In this study, we demonstrate that autophagy regulates biliary differentiation of hepatic progenitor cells through Notch1 signaling pathway (Fig. 6A). Autophagy is decreased in the early stage of biliary differentiation of WB-F344 cells and maintains a low level at the late stage. Activation of autophagy by rapamycin or starvation suppresses the biliary differentiation of WB-F344 cells. Autophagy plays important roles in self-renewal and differentiation of stem cells.^4-7 In haematopoietic stem cells (HSCs), mesenchymal stem cells (MSCs), dermal stem cells (DSCs), epidermal stem cells (Epi-S) and adipocyte, basal autophagy level is higher.^27-33 After induced differentiation, autophagic level is decreased. On the contrary, autophagy is increased during their differentiation in neural stem cells (NSCs), cardiac stem cells (CSCs), embryonic stem cells (ESCs).^34-39 It has been reported that autophagy plays a critical role in regulating stemness of hepatic progenitor cells(HPCs).⁴⁰ High autophagic activity is observed in most of stem cells relative to differentiation cells, which is crucial for the maintenance of cellular homeostasis and stemness. In the future, we will explore that the role and the mechanism of autophagy in hepatic differentiation of HPCs.

Figure 6. (A) Model for how autophagy regulates Notch1 signaling pathway in biliary differentiation of hepatic progenitor cells. (B) Schematic illustration of how the mTOR-Notch pathway regulates cell differentiation through the mTOR-STAT3-Notch cascade and the mTOR-autophagy-Notch cascade.

Our results also confirm that Notch1 signaling pathway is up-regulated in the biliary differentiation of WB-F344 cells, inhibition of Notch1 signaling pathway suppresses biliary differentiation. These results support past studies that Notch1 signaling pathway controls liver development by regulating biliary differentiation.^12-16

Further studies suggest that activation of autophagy by rapamycin or starvation attenuates Notch1 signaling pathway. These results demonstrate that autophagy inhibits Notch1 signaling pathway, which contributes to biliary differentiation and morphogenesis. These results are consistent with previous reports showing the loss of autophagy leads to the activation of the Notch signaling in Drosophila oogenesis²⁵ and autophagy eliminates cytoplasmic NICD to promote cardiac differentiation.²⁶ Autophagy is activated by mammalian target of rapamycin protein kinase pathway (mTOR).⁴¹ mTOR is a center of autophagy regulation molecule, which is inhibited autophagy associated gene(ATG) to regulate autophagy. Autophagy is initiated by the inhibition of mTOR.⁴² Autophagy is a novel activator of mTORC2 signaling, leading to CTGF induction and myofibroblast differentiation.⁴³ mTOR-STAT3-P63-Jagged-Notch signaling pathway plays an important role in regulating cell differentiation.⁴⁴ We find mTOR signaling is increased in biliary differentiation (data not shown).These findings suggest that mTOR-autophagy-Notch signaling pathway is important for cell differentiation (Fig. 6B).

Furthermore, autophagy may exert a multifactorial influence on the initiation and progression of cancer.⁴⁵ Notch signaling pathway is also considered to have a dual role in tumor development.⁴⁶ There are a growing number of evidences show that abnormal regulation of signaling pathway results in aberrant differentiation, which most likely lead to liver cancer stem cells that give rise to hepatocellular carcinoma as well as cholangiocarcinoma.^10,11,47,48 These findings indicate autophagy and Notch signaling pathway plays crucial roles in the initiation and progression of cancer. Further studies are needed to fully explain the mechanisms how autophagy regulates Notch signaling under physiological and pathological conditions.

Conclusion

The present results describe a direct link between autophagy and Notch1 signaling pathway, both of them regulate biliary differentiation. Firstly, autophagy is decreased in the early stage of biliary differentiation of WB-F344 cells and maintains a low level at the late stage. Activation of autophagy by rapamycin or starvation suppresses the biliary differentiation of WB-F344 cells. Secondly, Notch1 signaling pathway is upregulated in the biliary differentiation of WB-F344, inhibition of Notch signaling pathway suppresses biliary differentiation. At last, activation of autophagy by rapamycin or starvation attenuates Notch1 signaling pathway. These results demonstrate that autophagy regulates biliary differentiation of hepatic progenitor cells through Notch1 signaling pathway.

Materials and methods

Cell culture and treatments

WB-F344 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco-BRL, Gaithersburg, MD, USA) containing 10% FBS and antibiotics (100 mg/L penicillin and 100mg/L streptomycin) in a humidified incubator under 5% CO2 at 37°C.

WB-F344 cells had been used as a good model to study the mechanism of biliary differentiation. To induce biliary differentiation, WB-F344 cells were treated with 3.75 mM sodium butyrate (Sigma-Aldrich).^49,50 The medium was changed every 2 d. The days of differentiation were numbered consecutively beginning at the first day of the SB treatment (0d) to the last day (5d).

Real-time quantitative PCR

Total RNA was isolated using TRIZOL (Invitrogen) and cDNA synthesis was performed using the Prime Script RT reagent Kit (Takara) according to the manufacturer's instructions. The primers are listed in Table 1. Quantitative PCR was performed using SYBR Green PCR Kit (Applied BI) according to the manufacturer's instructions. The relative quantities of mRNAs were obtained by using the comparative Ct method and were normalized with glyceraldehydes-3-phosphate dehydrogenase (GAPDH). The primers were presented in Table 1.

Table 1. Primers used for quantitative real-time RT-PCR.

Gene	Sequence (5′–3′)	Product length (bp)
Krt19	F: CAGCAGTATTGAAGTCCAGC	129
	R: TCAAGCAGGCTTCGGTAGGT
γ-GT	F: ATCCGAACCTTGCCGTCCTTA	317
	R: ACCACTCACCCAACCGCCTAC
Hnf6	F: GAAAATAAGCGTCCGTCCAAAG	95
	R: CTGGCATTCATGAAGAAGTTGC
Hnf1b	F: TGGCTCAGTTCAGTAGCACACA	200
	R: TATTGTCGTAATGCCTCTCCCA
Jagged1	F: CAGCGCACGCCGACAAAAC	120
	R: TATGGCGGCACGCACTGTCT
Notch1	F: CCAGTACAACCCGCTAAGGC	119
	R: GGGACAAGGTATTGGTGGAGA
Hes1	F: CTGCCAAGGTTTTTGGCGGCT	151
	R: GACACTGCGTTAGGACCCACCGA
Hes5	F: GCACCAGCCCAACTCCAAAC	144
	R: TGCAGGCACCACGAGTAACC
Hey1	F: TCCGCCACCATGAAGAGAGCTCAC	121
	R: AACCCAGCGCCGAACTCAAGT
Heyl	F: CTCACCCTCCTCACCACTGAC	166
	R: CTCACCTCTTCATTGGAGCAA
Gapdh	F: CCGTGTTCCTACCCCCAATG	116
	R: CCTTTAGTGGGCCCTCGGC

Western blotting analysis

Protein samples were collected directly by cell extraction buffer (Beyotime, P0013) containing a protease inhibitors PMSF. Proteins were separated by electrophoresis on 10–12%SDS-polyacrylamide gels, transferred to Polyvinylidene Fluoride membrane, and incubated with corresponding primary antibodies overnight at 4°C. Following incubated with secondary antibody 1h at room temperature. The immunoreactive proteins were detected by enhanced Chemoluminescence Substrate (Millipore), and the blot was scanned and densitometric analysis with Image J software. The primary antibodies used in our experiment including: P62 (CST, #5114, diluted 1:1000), LC3A/B (CST, #4108, diluted 1:1000),Notch1(CST, #3608, diluted 1:1000),Hes1(CST, #11988, diluted 1:1000),Hes5(abcam, ab194111, diluted 1:1000),Hey1(Sigma, SAB2106265, diluted 1:1000),Heyl(Sigma, AV31866, diluted 1:1000),Jagged1(Novus, NBP-95754, diluted 1:1000) and Actin (Bioworld, AP0060, diluted 1:5000).

Immunofluorescence staining

After treatment, cells in 24 well plate were fixed with 4% paraformaldehyde and incubated with Notch1(CST, #3608, diluted 1:200)overnight at 4°C. And then incubated with Alexa Fluor 488-labeled secondary antibodies (Molecular Probes, Invitrogen, Paisley, UK, diluted1:200) for 1h at 37°C. DAPI (Sigma-Aldrich) was used to stain the nuclei. Fluorescence intensity was evaluated by using a confocal microscope (Leica TCS SP2).

Cell proliferation assay

The measurement of cell proliferation was performed by E-Plate 16. Fisrtly, 100 µl culture medium was added to each well and established background line. After 1h, Cells were seeded in each well (5000 cells per well) and started to measured dynamic of cell proliferation.

Statistical analysis

Analysis of variance was performed by GraphPad Prism 6.0 (GraphPad Software). Quantitative data were expressed as mean ± S.E.M for each experiment. Significance between the experimental groups and control groups were performed by Student's test. P < 0.05 was considered statistically significant.

Abbreviations

HPCs	=	Hepatic progenitor cells
WB-F344 cells	=	rat hepatic progenitor cell lines
γ-GT	=	γ-glutamyltranspeptidase
SB	=	sodium butyrate
NICD	=	Notch intracellular domain
Rapa	=	rapamycin
Starve	=	starvation
DAPT	=	N-[N-(3,5-difluorophenacetyl)–l–alanyl]–S-phenylglycinet-butylester
HSCs	=	haematopoietic stem cells
MSCs	=	mesenchymal stem cells
DSCs	=	dermal stem cells
Epi-S	=	epidermal stem cells
NSCs	=	neural stem cells
CSCs	=	cardiac stem cells
ESCs	=	embryonic stem cells
mTOR	=	the mammalian target of rapamycin
ATG	=	autophagy associated gene

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Funding

This project was supported by the Key Basic Research Project of China (Grant NO. 2012CBA01303); National Natural Science Foundation of China (Grant No. 81372312, 81472737, 81402018, 81402020, 81401308, 81402026, 81372330, 81572444, 81502417, 81502543); Special Funds for National Key Sci-Tech Special Project of China (Grant No. 2012ZX10002-016, 2012ZX10002011-011); Shanghai Science and Technology Committee (Grant No.14ZD1900403,14ZR1409200, 15PJ1410600); Shanghai Municipal Education Commission (Grant No. 14ZZ086).