Advanced search
Publication Cover
Molecular Crystals and Liquid Crystals Volume 639, 2016 - Issue 1: 10th International Conference on Electronic Processes in Organic and Inorganic Materials (ICEPOM-10)
Submit an article Journal homepage
39
Views
1
CrossRef citations to date
0
Altmetric
Original Articles

Luminescence of telomeric fragments of DNA macromolecule

Valeriy M. YashchukFaculty of Physics, National Taras Shevchenko University of Kyiv, Kyiv, UkraineCorrespondence[email protected]
,
Vladislav Yu. KudryaFaculty of Physics, National Taras Shevchenko University of Kyiv, Kyiv, Ukraine
,
Igor Ya. DubeyInstitute of Molecular Biology and Genetics of NAS of Ukraine, Kyiv, Ukraine
,
Kateryna I. KovalyukFaculty of Physics, National Taras Shevchenko University of Kyiv, Kyiv, Ukraine
,
Olesya I. BatsmanovaFaculty of Physics, National Taras Shevchenko University of Kyiv, Kyiv, Ukraine
,
Volodymyr I. Mel'nikInstitute of Physics of NAS of Ukraine, Kyiv, Ukraine
&
Georgiy V. KlishevichInstitute of Physics of NAS of Ukraine, Kyiv, Ukraine
 show all
Pages 151-159 | Published online: 14 Dec 2016
 
Sample our Physical Sciences journals, sign in here to start your FREE access for 14 days

ABSTRACT

Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomeres is associated mainly with G-bases and other long-wave centers, possibly G-quadruplex structures, whereas their phosphorescence is associated with AT-sequences as it takes place for the native DNA. A significant increase of phosphorescence-to-fluorescence intensity ratio was observed for Tel22 as compared to DNA. Results obtained are promising for the detection of DNA macromolecules containing the extended telomeric sequences.

Log in via your institution

Access through your institution

Log in to Taylor & Francis Online

Restore content access

Restore content access for purchases made as guest
Purchase options * Save for later

PDF download + Online access

  • 48 hours access to article PDF & online version
  • Article PDF can be downloaded
  • Article PDF can be printed
USD 61.00 Add to cart

Issue Purchase

  • 30 days online access to complete issue
  • Article PDFs can be downloaded
  • Article PDFs can be printed
USD 2,387.00 Add to cart

* Local tax will be added as applicable

Related Research

People also read lists articles that other readers of this article have read.

Recommended articles lists articles that we recommend and is powered by our AI driven recommendation engine.

Cited by lists all citing articles based on Crossref citations.
Articles with the Crossref icon will open in a new tab.