ABA enhanced cold tolerance of wheat ‘dn1’ via increasing ROS scavenging system

ABSTRACT

Abscisic acid (ABA) is an important plant hormone that plays significant roles in cold tolerance regulation. However, whether ABAimproves cold tolerance by increasing the activities of antioxidant enzymes in wheat remains unknown. In this study,the activities of antioxidant enzymes of the winter wheat variety ‘dongnongdongmai 1ʹ (‘dn1ʹ)afterthe application of exogenous ABA under low temperature (0°C, −10°C, −20°C, and −25°C) were investigated. Results showed that cold stress significantly increased H₂O₂ and relative conductivity, whileABA significantly reduced this effect. ABA enhanced cold tolerance in both leaves and rhizomes at −10°C and −20 °Cby increasing CAT, SOD, POD, APX, GR, DHAR, and MDHAR. However, this tolerance was weakenedat −25°C with decreasing ASA, GSH, APX, DHAR, and MDHARthan at-10°C and −20°C.POD, GR, and DHARlevels peaked at −10°C, while CAT, SOD, GSH, APX, and MDHAR content in rhizomes peaked at −20°C. The rate of returning green was significantly increased after ABA treatment than in controls (93.5% vs 83.6 %). In ‘dn1ʹ, rhizomes had a higher cold tolerance than leaves. Thereby, exogenous ABA could enhance cold tolerance byincreasing the activities of antioxidant enzymes.

KEYWORDS:

• Antioxidant
• antioxidant enzyme
• ASA-GSH cycle
• cold stress
• dongnongdongmai1
• real-time PCR

Introduction

Low temperature stress is one of the adverseabiotic stressesthat plants frequently experience in their native growth environments.¹This stress severely limits plant growth and yield worldwide.² The dongnongdongmai1(‘dn1ʹ), cultivated by the Northeast Agricultural University, is the only winter wheat variety that can safelyoverwinter in the northern cold areas of China,such as theHeilongjiang province.The term “returning green” is defined as the recovery growth of a plant with leaves turning from yellow to green after winter. The returning green stage is a crucial periodwhen winter wheat encounters low temperature stress, and the returning green rate reflects the cold toleranceof a plant. Although the returning green rate of the ‘dn1ʹ is usually as high as 80–85%,it is dramatically decreased in a severe cold winter with less snow.Therefore, research to discover the mechanisms causingthe physiological changes and metabolic adjustments of ‘dn1ʹ in response to cold temperature are urgently needed.

Abiotic stresses typicallyinduce increased levels of reactive oxygen species (ROS), such as superoxide anion (O₂·⁻) and hydrogen peroxide (H₂O₂),³ which are toxic for the plants cells. Under normal conditions, ROS can beeffectively eliminated by non-enzymatic and enzymatic antioxidants (AOX), whereas under abiotic stresses, ROS is produced extensively and exceeds the capacity of the antioxidative systems to remove them.⁴This cancause oxidative stress,which attacksthe membrane components,such as membrane lipids andmembrane proteins,and causes the peroxidation or oxidation of them.⁵ To avoid these adverse effectsand to adaptto the environment, plants have to enhance the activity of antioxidant enzymes or increase antioxidant content. Accumulating evidenceshows that activities of several antioxidant enzymes, includingsuperoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and glutathione reductase (GR) are elevated under abiotic stresses such as water-, salt-, drought-, and cold stress.^6-8 Abscisic acid (ABA) is an important plant hormone that plays significant roles in the regulation of osmotic stress tolerance. Endogenous ABA is often increased in response to drought, salt and cold stresses,⁹ and the application of exogenous ABA is reported to significantly promote the activities of SOD, APX, CAT, GR, and GPX under cold stress inmaize seedlings.¹⁰ These findings suggest that ABA might improve the cold tolerance of plantsby increasing the activities of antioxidant enzymes. Although the expression of several genes, such as the PeCPK10¹¹ and DREB1/CBF genes,¹²in response to cold stressis related to ABA, expression of the corresponding enzyme genes are rarely reported.

This study aimsto investigate the changes in antioxidant enzyme activities and their corresponding gene expression inthe ‘dn1ʹwinter wheat variety in response to cold stress, and to explore theinfluence of the application of exogenous ABA on the cold tolerance.

Materials and methods

Plant materialsand ABA treatment

The experimental plant material used was ‘dn1ʹ,the winter wheat variety that was examined and approved by Heilongjiang province in 2007.As the returning green ratio of ‘dn1ʹ is more than 80%, it isidentified as the onlywinter wheat variety that can overwinter in the cold northern area of China.Seedswere mechanicallysowed in September 2010 in the experimental base of the Northeast Agricultural University in Heilongjiang Harbin (45° 34ʹ to 46ʹ N; 126° 22ʹ to 50ʹ E), whichis situated in the cold temperate continental climate.Black soil and cold are two famous characteristics of this area.In January, the average temperature is about −22°C,while the extreme temperaturerange is from-24°Cto – 32°C. The plantingbase was equally divided into different zones, each with the standard of 2 m × 0.5 m (row length × width). The spacing between zones was 0.5 m.

Three experimental treatments were conducted at the three-leaf stage (October 5, 2010, from5 PM to 6 PM). The leaves were sprayedwith 1 × 10^-5mol/L ABA (ABA group);5 × 10^-3mol/L sodium tungstate, the ABA inhibitors (S.T. group); and aclean water (control group), respectively, with the dosage rate of 1 L/row.Applicationwas conducted under good weather conditions with a breeze to ensure the quick absorption of these reagents.Each treatment was repeated 5 times.

Sample collection and determination methods

Leaf and rhizome sampleswere collected at four time points,October 15, 2010, November 30, 2010, December 22, 2010, and January 8, 2011;at which the minimum temperature had been stably maintained for at least 7 days at0°C, −10°C, −20°C, and −25°C, respectively. The samples were then stored at −80°Cin a refrigerator.

Relative conductivity is defined as the conductivity at a fixed time after freezing (R₁) divided by the conductivity at a fixed time after high temperature sterilization (R₂). It was calculated using the formula:(R1/R2)×100%.

H₂O₂activity was determined spectrophotometrically by detection at 410 nm as described by Jana and Choudhuri.¹³ The activity of SOD was measured using the method proposed by Beyer and Fridovich.¹⁴ Peroxidase (POD) activity was measured based on the determination of guaiacol oxidation at 470 nm by H₂O_2.¹⁵ CAT activity was assayed from the rate of H₂O₂ decomposition following the method of Aebi.¹⁶ APX activity was determined according to Nakano and Asada¹⁷at 290 nm. The GR activity was detectedby the formation of NADPH at 340 nm.¹⁸ Dehydrogenation ascorbic acid reductase (DHAR) activity was assayed by following the detection of ascorbate (AsA) at 265 nm.¹⁹ MDHAR activity was measured at 340 nm based on the method of Hossain et al.²⁰ Contents of AsA, DHA, and total ascorbate (AsA+DHA) were determined using the method of Hodgeset al.²¹ Reduced glutathione (GSH) and oxidized glutathione (GSSG) were determined according to the method of Griffith.²²

Gene expression of the above-mentioned enzymes were detected using quantitative real-time reverse transcription-polymerase chain reaction (RT-qPCR). Total RNA was extracted using a Trizol kit (Sigma), and the corresponding primers were designed according to the homology sequences fromNCBI,as presented in Table 1.RNA was transcribed into cDNA using the GeneAmp® PCR system 9700 (Applied Biosystems, California, USA).²³Quantitative real-time RT-PCR was conducted on an Applied Biosystems’ ABI 7900 detection machine (Applied Biosystem, California, USA), with a 25μLreaction system consisting10 μL SYBR1 Green PCR Master Mix, 0.5μLof each primer, and 5 μL cDNA templates. The conditions for PCR were as follows: denaturation at 95ºC for 5 min, followed by 32 cycles of 95ºC for 15 s, 60ºCfor 45 s and 72ºC for 30 s, and a final extension of 72ºC for 10 min. The gene TaActin, which is constitutively expressed in wheat, was used as the internal reference. The relative amount of each transcript was determined using the 2^−ΔΔCt method. Quantification was carried out using three biological replications.²⁴ The accession numbers of TaAPX, TaDHAR, TaMDHAR, and TaGR were FJ890988.1, AY074784.1, JX034702.1, and AJ010455.1, respectively.

Table 1. Primers for Real-Time RT-PCR* analysis.

Gene		Primer sequences	Melting Temperatures(ºC)	Sizes of amplified fragments(bp)
TaAPX	Forward	GCCGAAGCGTAAGAGGTGTC	59.8	134
	Reverse	AGCCAACGGACATTATTACAGAGAT	60.8
TaGR	Forward	CTCATCCACCCTGTGCTACTGT	59.1	145
	Reverse	ATTCCCGTTGGCTCTTTCTC	58.4
TaDHAR	Forward	AAAGTGAACCCGTAAGCCCTCC	63.6	129
	Reverse	GCGACAACCAGAGCACATCA	63.0
TaMDHAR	Forward	GATTACCTGCCATTCTTCTACTCCA	61.2	112
	Reverse	ACATCGGGCTGTTGCTTGTG	61.6
TaACTIN	Forward Reverse	TCCAATCTATGAGGGATACACGC TCTTCATTAGATTATCCGTGAGGTC	60.0	120

*Reverse-transcription polymerase chain reaction.

The rate of returning green was calculated using the formula:

R = Na/Nb×100%

R: rate of returning green; Na: total number of the ‘dn1ʹ that returns green ‘dn1ʹ; Nb: total number of the ‘dn1ʹ.

Statistical analysis

Thedatafrommultiplegroupswerecompared by One-way ANOVA, followed by the post-hocleast significant difference (LSD)test, and significant difference was defined as P < .05.The Pearson correlation coefficient(PCC) was calculated to reveal relationships between genes.The variance analysis and correlation analysis was conducted using DPS 7.05software.

Results

Influence of exogenous ABA on H₂O₂ content and membrane damage of the‘dn1ʹvariety in response tolow temperature

Changes in H₂O₂ concentration

TheH₂O₂ contents in both rhizomes and leavesofthe ‘dn1ʹunder three treatments increasedwith decreasing ambient temperature. (Figure 1).At the same temperature, H₂O₂ content in leaves(Figure 1a) was slightly higher than in rhizomes(Figure 1b).In leaves, ABA treatment significantly reduced the H₂O₂ content at 0°C and −20°C, compared to the control (P < .05); while there were no significant differences between the ABA treatment and the S.T. treatment plants at each temperature except 0°C (Figure 1a). In rhizomesthe H₂O₂ content was significantly decreased with ABA treatment compared with control plants, at all temperatures except 0°C (P < .05); and S.T. remarkably restored the reduction by ABA at −20°C and −25°C (P < .05) (Figure 1b).

Figure 1. Effect of exogenous ABA on H₂O₂ content and relative electrical conductivity of the ‘dn1ʹ variety.

(a): H₂O₂ content in leaves; (b): H₂O₂ content in rhizomes; (c): Relative electrical conductivity in leaves; (d): Relative electrical conductivity in rhizomes.Different lowercase letters indicate that there is a significant statistical difference between any two of three treatmentgroups at the same temperature(P < .05), while groups labeled with the same letter represent are notstatisticallydifferent. Different symbols representthat there is a significant statistical difference between any two of fourtemperaturegroups at the same treatment(P < .05), while groups labeled with the same symbol represent are notstatisticallydifferent.

Changes in relative conductivity

With decreasing temperature, the relative conductivity in both rhizomes and leavesof the ‘dn1ʹincreased (Figure 1c-d). At the same temperature, the relative conductivity in rhizome (Figure 1d) was lower in rhizomes than in leaves(Figure 1c).In leaves, ABA treatment significantly reduced the relative conductivity compared to the control at −20°C and −25°C, and S.T. significantly restored the reduction of relative conductivity by the ABA group, even more than the control, at all the temperatures (P < .05) (Figure 1c). In rhizomes, the relative conductivity was significantly reduced with ABA treatment, and significantly increased, but not significantly more than the control, with S.T. treatment at all the temperatures(P < .05) (Figure 1d).

Influence of exogenous ABA on antioxidant enzyme activity of the ‘dn1ʹvariety in response to low temperature

Changes in SOD activity

In leaves, SOD activity in the control significantlyincreased with a decrease in temperature down to −20°C and −25°C, and SOD activity was highest at −20°C; ABA treatment significantly increased SOD activity (P < .05), while S.T. significantly reducedSOD activity at each temperature (P < .05)(Figure 2a).In rhizomes, SOD activity gradually increasedin the controlwith decreasing temperature; ABA treatment caused a significant increase of SOD activity (P < .05), with the highest value at −20°Ccompared to the control, while S.T. significantly reduced the SOD activity at all temperatures(P < .05) (Figure 2b). SOD activity was higher in rhizomesthan in leaves at 0°Cand −10°C, butwas higher in leavesat −20°Cand −25°C.

Figure 2. Effect of exogenous ABA on activities of antioxidants of the ‘dn1ʹ variety.

(a): SOD activity in leaves; (b): SOD activity in rhizomes; (c): CAT activity in leaves; (d): CAT activity in rhizomes; (E): POD activity in leaves; (F): POD activity in rhizomes.Different lowercase letters indicate that there is a significant statistical difference between any two of three treatment groups at the same temperature(P < .05), while groups labeled with the same letter represent are notstatisticallydifferent. Different symbols representthat there is a significant statistical difference between any two of fourtemperature groups at the same treatment(P < .05), while groups labeled with the same symbol represent are notstatisticallydifferent.

Changes in CAT activity

Changes of CAT activity in both rhizomes and leaveswereslightwhen temperature decreased (Figure 2c-d).Compared with the control, ABA treatment significantly increased the CAT activity in both leaves and rhizomesat each temperature (P < .05), and the CAT activity peaked at −10°C in leaves(Figure 2c) and at −20°C in rhizomes (Figure 2d). S.T. treatment significantly reduced CAT activityin both leaves and rhizomes(P < .05) (Figure 2c-d).

Changes in POD activity

Astemperature decreased, the POD activity kept stable from 0 °C to −25°Cin leaves, but increased significantly at −25°Ccompared with 0°C in rhizomes(P < .05) (Figure 2e-f).In leaves, POD activity increasedsignificantly after ABA treatmentonce temperature decreased to −10°Cand peaked at −20°C.This increase was significantly inhibited by S.T. treatment at all temperatures(P < .05) (Figure 2e). In rhizomes, ABA also resulted in a pronounced increase of POD activity at all temperature points (P < .05), and POD peaked at −10°C. Likewise, S.T. significantly inhibited the increase in POD activity(P < .05) (figure 2f).

Influence of Exogenous ABA on antioxidant content of the ‘dn1ʹvariety in response to low temperature

Changes in AsA activity

As temperature decreased,AsA contents in leaves slightlyincreased at first and then decreased and peaked at −10°C in leaves(Figure 3a),but no significant difference (Figure 3a), while AsA contents in rhizomewas only significantly increased at −20°C than in other ambient temperatures (Figure 3b).The AsA content in rhizomes was always less than in leaves at the same temperatures. In leaves, ABA treatment only significantly increased the AsA content at −20°C (P < .05), and S.T. significantly inhibited the increase at −10°C and −20°C (P < .05) (Figure 3a). However, neither ABA nor S.T. treatment had a significant influence on rhizome AsA activity at any temperature (Figure 3b).

Figure 3. Effect of exogenous ABA on contents of antioxidants of the ‘dn1ʹ variety.

(a): AsA in leaves; (b): AsA in rhizomes; C: GSH in leaves; D: GSH in rhizomes; (e): AsA+DHA in leaves; (f): AsA+DHA in rhizomes; G: GSH/GSSG in leaves; (h): GSH/GSSG in rhizomes.Different lowercase letters indicate that there is a significant statistical difference between any two of three treatment groups at the same temperature(P < .05), while groups labeled with the same letter represent are notstatisticallydifferent. Different symbols representthat there is a significant statistical difference between any two of fourtemperature groups at the same treatment(P < .05), while groups labeled with the same symbol represent are notstatisticallydifferent.

Changes in GSH activity

With decreasing temperatures, theGSH content increased in bothleaves and rhizomes at first and then decreased, with a peak at −10°C in leaves and at −20°C in rhizomes(Figure 3c-d). The GSH content in rhizomeswas lower in than leaves at the same temperature. In leaves, GSH content increasedsignificantly with ABA treatment(P < .05), and reduced significantly when treated with S.T. at −10°C and −20°C (P < .05) (Figure 3c). On the contrary, ABA did not cause any significant change in GSH activity in rhizomes, and asignificant reduction caused by S. T. treatment was only detected at 0°C (P < .05) (Figure 3d).

Changes of AsA/DHA and GSH/GSSG contents

The activityof AsA/DHA weregenerally not influenced bydecreasing temperature in both leaves and rhizomes, with the exception of at −25°C,wherethe values in leaveswere significantlylower(P < .05)(Figure 3e-f).ABA treatment significantly increased the AsA/DHA content at −20°C in leaves(P < .05), and S.T. significantly decreased the content at all temperatures except −25°C (P < .05) (Figure 3e). In rhizomes, ABA treatment did not affect AsA/DHA activity at any temperature point, while a significant reduction was detected with S.T. treatment, compared with ABA treatment (P < .05)(figure 3f).

The contents of GSH/GSSG in rhizomesgradually increased (Figure 3h) with decreasing temperature,but kept stablein leaves(Figure 3g).ABA significantly increased the GSH/GSSG content at −10°C in leaves, and S.T. significantly decreased the content at all temperature points (Figure 3g). In rhizomes, ABA treatment significantly increased the GSH/GSSG contentat all temperatures (P < .05), while S.T. significantly decreased the GSH/GSSG content at −20°C and −25°C(P < .05) (Figure 3h).

Influence of exogenous ABAonAsA–GSH cycle-related enzyme activities andgene expression of the ‘dn1ʹ variety in response to low temperature

Changes inAPX activity and TaAPX expression

The activity of APX in leaves increased initially as temperature decreased, and the peaked at −10°C before decreasing somewhat; ABA treatmentreflected the same trend as the control, and significantly increased the activity at −10°C (P < .05); while S.T. significantly countered the increase by ABA at all temperatures except 0°C(P < .05) (Figure 4a). The change of expression pattern of TaAPXwas similar to the change of APX activity under all three treatments, except that ABA also caused a significant increase of TaAPXexpression at −25°C (P < .05) (Figure 4c).

Figure 4. Effect of exogenous ABA on APX and GR activity and TaAPXand TaGRexpression of the ‘dn1ʹ variety.

(a): APX activity in leaves; (b): APX activity in rhizomes; (c): TaAPX expression in leaves; (d): TaAPX expression in rhizomes; (e): GR activity in leaves; F: GR activity in rhizomes; (g): TaGR expression in leaves; (h): TaGR expression in rhizomes.Different lowercase letters indicate that there is a significant statistical difference between any two of three treatment groups at the same temperature(P < .05), while groups labeled with the same letter represent are notstatisticallydifferent. Different symbols representthat there is a significant statistical difference between any two of fourtemperature groups at the same treatment(P < .05), while groups labeled with the same symbol represent are notstatisticallydifferent.

In rhizomes, both APX activity and TaAPX expression remained stable from 0°C to −20°C, and then significantly decreased at −25°C (Figure 4b, d). Trends ofAPX activity and TaAPX expression under ABA and S.T. treatments in the rhizomes were the same asin the leaves, except that the peak value was reached at −20°C (Figure 4b, d).

Changes in GR activity and TaGR expression

With decreasing of temperatures,the activity of GR in both rhizomes and leavesincreased at first and then decreased, withpeaks at-10 °Cand −20°C in leaves (Figure 4e) and at −10°C in rhizomes (figure 4f).In leaves, ABA only significantly increased GR activity at −20°C (P < .05), where the value peaked;while S.T. significantly decreased the activity at −20°C and −25°C(P < .05) (Figure 4e). In rhizomes, ABA caused a significant increase of GR activity at all temperatures (P < .05), and the activity peaked at −10°C; while S.T. significantly decreased GR activity except at 0°C (P < .05) (figure 4f).

ChangesinTaGR expressionhad the same trend as GR activity under all three treatments in leaves and rhizomes (Figure 4g-h).ABA and S.T. had the same influence on GR activity and TaGR expression at all temperatures (Figure 4g-h).

Changes in DHAR activity and TaDHAR expression

As temperature decreased,the activity of DHAR in leavesincreased at first and then decreased, peaking at −10°C; ABA significantly increased the activity of DHAR at all the temperatures(P < .05) which peaked at −10°C; while S.T. dramatically reduced the activity of DHARat all the temperatures(P < .05)(Figure 5a). The expression trend of TaDHARwas the same as DHAR activity under all the treatments at all four temperature points (Figure 5c).

Figure 5. Effect of exogenous ABA on DHAR and MDHAR activity and TaDHAR and TaMDHARexpression of the ‘dn1ʹ variety.

(a): DHAR activity in leaves; (b): DHAR activity in rhizomes; (c): TaDHAR expression in leaves; (d): TaDHAR expression in rhizomes; (e): MDHAR activity in leaves; (f): MDHAR activity in rhizomes; (g): TaMDHAR expression in leaves; (h): TaMDHAR expression in rhizomes.Different lowercase letters indicate that there is a significant statistical difference between any two of three treatment groups at the same temperature(P < .05), while groups labeled with the same letter represent are notstatisticallydifferent. Different symbols representthat there is a significant statistical difference between any two of fourtemperature groups at the same treatment(P < .05), while groups labeled with the same symbol represent are notstatisticallydifferent.

The patterns of both DHAR activity and TaDHAR expression were similar in both leaves and rhizomes, and both peaked at −10°C (Figure 5b, d).

Changes in MDHAR activity and TaMDHAR expression

In leaves,decreasing temperatures lead to increasingactivity of MDHAR at first, which then decreasedafter peaking at −10°C; ABA significantly increased the value of MDHAR except at 0°C (P < .05), and MDHAR peaked at −20°C; while S.T. had a significant decreasing effect on MDHAR except at 0°C (P < .05) (Figure 5e).Changes in TaMDHARexpression exhibited the same trend as MDHAR activity across all treatments at all temperatures (Figure 5g).

The effects of decreasing temperature on MDHAR activity and TaMDHAR expression were similar in rhizomes to that in leaves, except that the MDHAR activity peaked at −20°C (figure 5f) andTaMDHAR expression peaked at −20°C (Figure 5h). Likewise, ABA and S.T. had the same effects on changes of MDHAR activity and TaMDHAR expressionas in leaves (figure 5f, h).

Correlation analysis among AsA-GSHcycle-related genes

The PCCsof gene expression of key metabolic enzymes in AsA-GSH cycle are listed in Table 2. Expression ofTaAPXwas significantly associated withTaMDHAR (r = 0.780, p < .01), and TaGRwas significantly associated with TaDHAR(r = 0.613, p < .05).

Table 2. Correlations of different gene expression in the AsA-GSH cycle.

		TaAPX	TaGR	TaMDHAR	TaDHAR
TaAPX	Pearson Correlation	1	0.351	0.780**	0.613*
	Sig.(2-tailed)		0.264	0.003	0.034
TaGR	Pearson Correlation	-	1	−0.147	0.954**
	Sig. (2-tailed)	-		0.649	0.000
TaMDHAR	Pearson Correlation	-	-	1	0.109
	Sig.(2-tailed)	-	-		0.737
TaDHAR	Pearson Correlation	-	-	-	1
	Sig.(2-tailed)	-	-	-

**. Correlation is significant at the 0.01 level (2-tailed).

*. Correlation is significant at the 0.05 level (2-tailed).

Influence of exogenous ABAon returning green rate of the ‘dn1ʹ variety

Thereturning greenrate of the ‘dn1ʹvariety with ABA treatment was significantly higher thanin the control (93.5% vs 83.6%, P < .05) (Figure 6), while S.T. treatment significantly decreased this ratecompared with the ABA treatment (79.1% vs 93.5%, P < .05).

Figure 6. Rate of returning green.

Different lowercase letters indicate that there is a significant statistical difference between any two of three treatment groups at the same temperature(P < .05), while groups labeled with the same letter represent are notstatisticallydifferent.

Discussion

Under abiotic stress, levels of ROS (H₂O₂ and O₂·⁻)are accumulated in plants.If ROS is not scavenged timely, it could cause the peroxidation of membrane lipids and the impairment of cellular membranes.²⁵ Therefore, it is understandable that the H₂O₂ contents and relative conductivity in leaves of the ‘dn1ʹ variety is significantly increased under cold stress. Antioxidant enzymes such as SOD, POD, CAT,and antioxidants in the AsA-GSH cycle play important roles in eliminating H₂O₂.^26,27 SOD eliminatesO₂·⁻and transforms it to H₂O₂,which is then transformedto H₂Oby CAT.^28,29 POD is also responsible for the elimination of H₂O₂ to protect plant tissue from lipid peroxidation.³⁰ Under abiotic stresses such as cold stress, enzymes in the AsA-GSH cycle are essential for the maintenance of cellular redox states and the detoxification of H₂O_2.³¹Reportedly, SOD activity is elevated under cold stress in many plant species, such as chickpea and potato.^32,33In Solanum melongena, activities of SOD, POD, and APX are significantly increased under cold stress.³⁴ In tobacco plants, elevated SOD and POD activities are found in leavesunder cold stress.³⁵In pepper seedlings, chilling stress significantly induces the AsA-GSH cycle.³⁶ The increased contents of AsAand GSH, and the increased activities of SOD, POD, CAT, APX, GR, DHAR and MDHAR could enhance the resistances of plants in various abiotic stresses.^37,38In the present study, we found a unimodal bell-shaped trend ofthe activities of antioxidant enzymes (SOD, CAT and POD), contents of antioxidants (AsA, GSH, AsA/DHA, and GSH/GSSG), enzyme activity and AsA-GSH cycle-related gene expressionin leaves and rhizomes of the ‘dn1ʹ variety under cold stress. The activities of POD, GR, and DHAR peaked at −10°C, while thatof CAT, SOD, GSH, APX, and MDHAR in rhizomes peaked at −20°C. These results suggest that the ‘dn1ʹvariety hasa strong tolerance under cold stress caused by the increased activities of several antioxidant enzymes and their relevant gene expression.However, the tolerance was weakenedat temperatures below-25°C with decreasing ASA, GSH, APX, DHAR, and MDHAR activity reported compared to that at −10°C and −20°C.

ABA plays a crucial role in plant responses to cold stress. At normal growth temperatures, exogenous ABA could enhance the cold tolerance in herbaceous plants.³⁹ Under cold stress, exogenous ABA could also enhance the resistance of plants byenhancingthe antioxidant system. For instance, GSH and AsA levels and APX activity are higher in ABA-treated Stylosanthes guianensisSw. than those without ABA treatment.⁴⁰ By increasing the activities of SOD and PODand theexpression of Mn-SOD and POD, ABA is reported to enhance the tolerance to chilling-induced oxidative damage in peppers.³⁶ In the present study, we discovered that ABA had a remarkable effect in terms of reducing H₂O₂ contents and relative conductivity; while it had a significant influence on increasing the activities of antioxidant enzymes, levels of antioxidants, and AsA-GSH related enzyme activities and gene expression. However, the interplay between increasing activity in antioxidant enzymes and decreasing content of H₂O₂ was not obvious in the wheat leaves, which is possible because the accumulation of H₂O₂ was concentrated in the leaves during the removal process. Notably, ABA can significantly enhance antioxidant levelsat lower temperatures (from −10°C to −20°C), suggesting an improved cold tolerance of the ‘dn1ʹ variety. This might be the reason for the increased returning green rate of the ‘dn1ʹ with ABA treatment.

The responses to abiotic stresses might be different in leavesand rhizomes due to differences in cell specialization. Reportedly, 86% of the alterations caused by cold are different between rhizomes and leaves in Arabidopsis.⁴¹ In support of this concept, we found that in rhizomes of the ‘dn1ʹ variety, change trends of several indicators were different than in leaves. For instance APX activity and TaAPX expression showed a unimodal bell-shaped response to decreasing temperature in leaves butstayed stable in rhizomes. Moreover, peak valuesin rhizomesoccurred at a lower temperaturefor AsA and GSH contents than in leaves (−20°C vs −10°C).In maize, the influence of ABA on leaves and roots under chilling-induced water stress are different: ABA content is highly associated with chilling tolerance at the leaf level but not at the root level.⁴² In our study, ABA also showed a stronger effect on antioxidant enzyme activities and corresponding gene expression in rhizomesthan in leaves at each temperature. However, the peak value of APX activity and TaAPX expression were at a lower temperature in rhizomes than in leaves (−20°C vs −10°C). These results collectively suggest a higher cold tolerance of rhizomes than leavesof the ‘dn1ʹ variety.

APX in the AsA-GSH cycle can oxidize AsA to MDAsA, and MDHAR can restore MDAsA to produce AsA. The expression of TaGR is linked withTaDHARto maintain anappropriate redox level in plant cells. We found that expression of TaAPX and TaMDHAR were tightly associated, as was TaGR and TaDHAR, suggesting the consistent regulation of these genesby cold stress.

Although the effect of ABA on antioxidant enzymes or cold tolerance in wheat has been reported in past, how ABA can improve the cold tolerance by increasing the activities of antioxidant enzymes is rarely reported. In addition, our study has the following merits. First, our wheat cultivar (dn1) is an extreme cold resistant variety, which can resist freezing at −30°C, which is different from common winter wheat. Second, we tested the effect of different low temperatures (0°C, −10°C, −20°C, and −25°C) in open ground plots in order to reflect the long-term effects of lower temperatures with ABA treatment. Third, the detection indicators of antioxidant scavenging systems are now relatively complete. However, there are still several limitations of the present study. Many of the indicators reported here were not detected in other trials run for three years under similar environmental conditions, except for SOD, POD, and CAT. In addition, the roles of various isoforms of these enzymes and their correlated abundance with a low temperature response of wheat were not studied. Moreover, the enzymes we detected were not verified by other critical methods.

Conclusion

Exogenous ABA enhanced the cold tolerance in both leaves and rhizomes at −10°C and-20 °Cby increasing CAT, SOD, POD, APX, GR, DHAR, and MDHAR activity levels.The cold tolerance was weakenedat −25°C with decreasing ASA, GSH, APX, DHAR, and MDHARthan at temperaturesof-10°C and −20°C.

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Author contributions

Conception and design of the research: JC; acquisition of data: QL and BF; analysis and interpretation of data: QX and WL; statistical analysis: XW; obtaining funding: JC; drafting the manuscript: JY; revision of manuscript for important intellectual content: JC. All authors read and approved the final manuscript.

Data availability statement

All data generated or analyzed during this study  are available upon request by contact with the corresponding author .

Additional information

Funding

This study was funded by National Natural Science Foundation Project [project number: 31971831] and Postdoctoral fund of Heilongjiang province [project number: LBH-Z13038]