Indeterminate domain 3 negatively regulates plant erectness and the resistance of rice to sheath blight by controlling PIN-FORMED gene expressions

ABSTRACT

Plant architecture and disease resistance are the key factors that control the production of yield. However, the mechanism behind these factors is largely unknown. In this study, we identified that indeterminate domain 3 (IDD3) was obviously induced by inoculation of Rhizoctonia solani AG1-IA. Plants that overexpressed IDD3 (IDD3 OX) were more susceptible, while idd3 mutants showed a similar response to sheath blight disease compared with wild-type plants. Interestingly, IDD3 OX plants developed a wider tiller angle and exhibited altered shoot gravitropism, while idd3 knock-out mutants showed no visible morphological differences compared with the wild-type plants. IDD3 is ubiquitously expressed in different tissues and stages, and the IDD3 transcript was induced by exogenously applied auxin. Expression of the PIN-FORMED (PIN) and Aux/IAA genes was altered in IDD3 OX compared with wild-type plants. Furthermore, IDD3 OX plants are sensitive to auxin and the polar auxin transporter inhibitor N-1-naphthylphalamic acid (NPA). Further yeast-one hybrid, chromatin immunoprecipitation (ChIP) and transient assays revealed that IDD3 directly represses PIN1b via promoter binding. Inoculation with R. solani indicated that PIN1b RNAi plants are more susceptible to sheath blight disease (ShB) compared with the wild-type. Taken together, our analyses suggest that IDD3 controls plant architecture and the resistance of rice to ShB via the regulation of PIN auxin transporter genes.

KEYWORDS:

• Indeterminate domain 3
• sheath blight
• planting density
• PIN
• rice

Introduction

Rice (Oryza sativa) is a cereal grain that is the most widely consumed staple food for a large part of the world’s human population; therefore, higher yield potential and yield stability are needed to meet the challenges of increasing demand for its production.¹ Alternatively, with the swift decrease in arable land area that follows quick economic development, food security has become a serious problem. Developing ideal plant architecture varieties that produce substantially more grain has become a critical endeavor for scientists. One of the important goals of crop breeding is yield improvement. Among the yield indices, tiller angle is tightly associated with the enhancement of photosynthetic efficiency and facilitation of enhanced planting density.^2,3 Rice plants with erect tillers, leaves and panicles on high-density planting systems should be optimal for high yield. However, these factors will increase the occurrence of sheath blight disease (ShB) caused by Rhizoctonia solani that results in a reduction in yield. Therefore, the antagonistic relationship between crop yield and pathways of plant resistance renders crop breeding even more difficult.⁴

Extensive studies have focused on the isolation of tiller angle regulators. Polar auxin transport was one of the aspects that was identified for its importance in tiller angle control. The suppression of PIN-FORMED1 (PIN1) or overexpression of PIN2, two auxin efflux transporters that alter auxin transport activity, lead to increased tiller angles in rice.^5,6 Lazy1 plays a negative role in polar auxin transport, and the loss of Lazy1 function impaired endogenous auxin distribution, resulting in reduced shoot gravitropism and a tiller-spreading phenotype.⁷ In addition, quantitative trait loci (QTLs) related to tiller angle have been identified.⁸ Mutation at a major quantitative trait locus, TAC1 (Tiller Angle Control 1), narrows tiller angle, resulting in more efficient plant architecture.⁹ The PROG1 (PROSTRATE GROWTH 1) gene controls a key transition from prostrate to erect growth in the domestication of rice.¹⁰ ShB is one of the three major diseases that are caused by R. solani in rice.¹¹ ShB can reduce rice yield production up to 50% when the disease is severe.¹² In addition, our recent studies observed that lazy1 mutants promote the disease,¹³ while pin1a mutants reduce the resistance of rice to ShB,¹⁴ respectively, suggesting that a complex regulatory mechanism occurs between plant architecture and defense regulation.

The indeterminate domain (IDD) consists of two C₂H₂ and two C₂HC zinc finger motifs, and the IDD genes have diverse biological functions in plants. Extensive studies were performed to analyze IDD protein functions in plants; ID1 mutants showed delay of flowering time in maize and rice;^15,16 Magpie (MAG)/AtIDD3 and Jackdaw (JKD)/AtIDD10 regulate the fate of root cells;¹⁷ Enhydrous (ENY)/AtIDD1 regulates seed maturation;¹⁸ AtIDD8 modulates plant development and sugar metabolism;¹⁹ AtIDD14, AtIDD15 and AtIDD16 cooperatively regulate lateral organ morphogenesis and gravitropism by promoting auxin biosynthesis and transport in Arabidopsis;²⁰ Loose plant architecture1 (LPA1)/IDD14 regulates shoot gravitropism and the lamina joint angle;^21,22 the regulator of CBF1 (ROC1)/IDD3 activates DREB1B/CBF1 to regulate chilling tolerance in rice;²³ IDD2 regulates secondary cell wall formation in rice,²⁴ suggesting that IDDs play the key roles in diverse aspect of plant biological processes. In addition, the AtIDD4 repressor was reported to constitutively induce immunity in Arabidopsis,²⁵ and LPA1 promotes the resistance of rice to ShB via activation of PIN1a,¹⁴ suggesting that IDDs also function in plant defense. In addition, the binding motifs of the transcription factor IDD have been identified in maize (ID1, 5ʹ-TTTGTC^G/_CTTTT-3ʹ), Arabidopsis (AtIDD8, 5ʹ-TTTTGTCC-3ʹ), and rice (IDD10, 5ʹ-TTTGTC^C/_G);^19,26,27 however, IDD targets and the regulatory mechanism in regulation of plant architecture and defense are largely unknown.

In this study, we elucidated that IDD3 expression and sensitivity to ShB, along with further genetic and molecular study, showed that plants that overexpress IDD3 modulate the resistance of rice to ShB, as well as changing the tiller angle. Further analyses identified that IDD3 is involved in auxin signaling and regulates the expression of PIN and AUX/IAA genes, which could enable IDD3 to regulate the tiller angle and rice defense.

Materials and methods

Mutant isolation and plant growth

T-DNA insertion lines idd3-1 (PFG_3A-09378) and idd3-2 (PFG_3A-14411) were isolated from a rice T-DNA population (http://signal.salk.edu/cgi-bin/RiceGE/).²⁸ The mutant lines were derived from the Japonica rice cultivar ‘Dongjin.’ Transgenic lines were generated from this rice cultivar. Experiments were conducted involving treatment with auxin, a brassinosteroid (BR) and abscisic acid (ABA). Seeds were germinated and grown for 7 days on liquid half-strength Morishige and Skoog (MS) medium, transferred to the same medium containing 1 µM 2,4-D (synthetic auxin), 0.1 µM 2,4-epiBL (BR) and 1 µM ABA for 3 and 6 h, and whole seedlings were sampled for RNA extraction. Seedling growth tests were conducted to determine the dependence of seedling growth on auxin using 2,4-D, NAA and the polar auxin transporter inhibitor NPA. Rice seeds were germinated on half-strength MS media containing auxin (0.5 and 1 µM NPA; 10 and 100 nM 2,4-D; 10 and 100 nM NAA) after being de-husked and surface sterilized. Five-day-old plants were photographed.

Plant growth and inoculation with R. solani AG1-IA

The wild-type (WT) control line (O. sativa Japonica, cultivar Dongjin), idd3-1 (PFG_3A-09378), idd3-2 (PFG_3A-14411) and IDD3-GFP overexpressor (IDD3 OX) plants were used. The plants were grown in a greenhouse at Shenyang Agricultural University, Shenyang, China, at a temperature of 23ºC–30°C. One-month-old rice plants were inoculated with R. solani AG1-IA.²⁹

Plasmid construction and cytological observation

To generate the IDD3-GFP overexpression transgenic plants, IDD3 ORF sequences were amplified and cloned into BglII and SpeI restriction enzyme sites of the pCAMBIA1302 binary vector, in which IDD3 coding sequences were N-terminally fused to the GFP coding sequences. The 3 kb IDD3 promoter region was fused to GUS in PCAMBIA1381 vector to create the GUS-fusion vector. A total of 300 bp of PIN1b cDNA sequences were fused separately from the GUS intron sequences in sense and antisense directions, respectively, and the construct was cloned into the BamHI and HindIII restriction enzyme sites of the pGA1611 binary vector. The following primers were used for cloning IDD3 ORF and its promoter or PIN1b cDNA: IDD3 cDNA-F: GATTCATACAAGCTTATGGCGGCCGCCTCGTCCGCACCCTTC, IDD3 cDNA-R: AGATCTGCGGCGGCCATGTTTGCCGGGTCCAGTGAGCCGAC, IDD3 PM-F: GAATTCAGGTTTGCTGTCTCCCTTTC, IDD3 PM-R: GAGCTCTCTCGCTGCTTACTTTGTTG, PIN1b C-F: ATGGCGCTGCAGCCGCGGATCATC, PIN1b C-R: GATGTAGTACACCAGCGTGATGGGCAGCG. Rice transformation and GUS detection were performed using standard methods.²⁸

RT-PCR analysis

Total cellular RNA was isolated using RNeasy Plant Mini Kits (Qiagen, http://www.qiagen.com/). The cDNA was synthesized using reverse transcriptase RNaseH (Toyobo, http://www.toyobo.co.jp/e/). qRT-PCR products were quantified using Illumina Research Quantity software (Eco 3.0) (Illumina, San Diego, CA, USA), and values were normalized against Actin and Ubiquitin cDNA from the same samples. The following primers were used for RT-PCR or qRT-PCR are shown in bellow: IDD3 RT-F: ACCGGGATCAAGAAGCACTACTG, IDD3 RT-R: GATCAAACTGAGAGGCGCCATTG, IAA3-F: GGGTTCTCCAAGACATGCAATC, IAA3-R: GGATGGAAATCAAAGCATTGAAGC, PIN1a-F: TCATCTGGTCGCTCGTCTGC, PIN1a-R: CGAACGTCGCCACCTTGTTC, PIN1b-F: TGCACCCTAGCATTCTCAGCA, PIN1b-R: CCCTCCTCCCAAATTCTACTT C, PIN2-F: CAGGGCTAGGAATGGCTATGT, PIN2-R: GCAAACACA AACGGGACAA, TAC1 F: GAGATGGCTCTAAAGGTGTTC, TAC1 R: CGTGCCAATTGCAAGTATACC, Lazy1 F: ACGGTGACGAAGAGCAAGTT, Lazy1 R: ACAGCACATTCAAGCCCTTC, Ubiquitin-F: GCACAAGCACAAGAAGGTGA, Ubiquitin-R: GCCTGCTGGTTGTAGACGTA, Actin-F: CTTCATAGGAATGGAAGCTGCGGGTA, Actin-R: CGACCACCTTGATCTTCATGCTGCTA.

Northern blot analysis

Formaldehyde gels (1.3%) were prepared in MOPS/EDTA buffer (0.5 M MOPS, pH 7.0; 0.01 M Na₂EDTA, pH 7.5) to use for Northern hybridizations. Twenty micrograms of each RNA sample were dissolved and heat-denatured in formaldehyde/formamide buffer. After electrophoresis, the gels were washed with water and 10× SSC and blotted onto a Hybond N⁺ membrane (Amersham Pharmacia Biotech, Little Chalfont, UK) prewetted in 10× SSC. rRNA was stained with ethidium bromide (EtBr) and used as a loading control. Hybridization was performed at 65°C in Church buffer (1% bovine serum albumin [BSA], 200 µM EDTA, 0.5 M sodium phosphate, and 7% SDS) containing a ³²P-labeled probe. The membranes were autoradiographed using Fuji X-ray film. An IDD3 cDNA fragment (637–1608 bp) was used as a probe.

Gravitropism assay

The gravity response was analyzed as previously described.⁷ Rice seeds were grown on half-strength liquid Morishige and Skoog (MS) medium after surface sterilization. Six-day-old plants were placed horizontally under 16 h dim-light/8 h dark at 26°C to examine the gravitropic responses. The gravity response was determined by measuring the curved angle after reorientation by 90°.

Yeast one-hybrid analysis

Yeast-one hybrid assays were performed using a 1.5-kb section of the PIN1b promoter that was amplified by PCR and cloned into a pLacZi vector. Screening of the interaction clones was conducted via mating using Matchmaker Gold Systems (Clontech, Takara Bio USA, USA). The ORF sequences of IDD3 were cloned into the pGAD424 vector. The constructed pGAD424-IDD3 or empty vector pGAD424 were transformed into the yeast one-hybrid bait strain (YM4271), and the growth of the yeast cells was monitored on synthetic dropout media lacking Leu and Ura. The cells were transferred to 3 M paper and incubated with X-gal at 37°C for a chromogenic reaction. The following primers were used to cloning PIN1b promoter: PIN1b PF: GAATTC GAATAGGTCAACTCATTCC, PIN1b PR: CTTGCAGCCAAGAAAAACCACGACTTC.

Chromatin-immunoprecipitation (ChIP) assay

Eight grams of rice calli were collected from transgenic plants that expressed 35S:IDD3-GFP for the ChIP assay. The ChIP assay and subsequent ChIP-PCR assays were performed as previously described.³⁰ The primers used for the ChIP-PCR are shown in bellow: P1 F: AAAATATTGATTAAAGGGTG, P1 R: CTCACTAAGAATATCACCAGC, P2 F: AGAAGATGTTTGGTTGATGC, P2 R: TAATTTTACCTGATCGAAAG.

Transient expression assay

The effector plasmid (35S:IDD3) and reporter (pPIN1b or mutated promoter, mpPIN1b), as well as an internal control plasmid (35S:LUC), were co-transformed into protoplast cells for the transient expression assay.³¹ The GUS activity analyses were performed as previously described.²⁷ The luciferase assay was performed using a Luciferase Assay Kit (Promega Bio Sciences, LLC, San Luis Obispo, CA, USA), and PEG-mediated transformation and luciferase activity assays were performed as previously described.³² The primers used for the transient assay are shown in bellow: PIN1b PF: GAATTC GAATAGGTCAACTCATTCC, PIN1b PR: CTTGCAGCCAAGAAAAACCACGACTTC, mP-F: ATTCCAAAAAAATTCAAACC, mP-R: GGTTTGAATTTTTTTGGAAT.

Statistical analysis

Statistical calculations were performed using Prism 5 (GraphPad, San Diego, CA, USA). All data were expressed as the mean ± SE. Comparisons between the groups were performed using a one way analysis of variance (ANOVA) and at least P > .05 was considered as a significant difference.

Results

Patterns of expression of IDD3

To test whether the expression of IDD3 responds to ShB, qRT-PCR was performed using sheaths inoculated with R. solani. The results showed that IDD3 was obviously induced after 24 and 72 hours of inoculation, while it was suppressed after 48 hours of inoculation (Figure 1(a)). Transgenic plants in which GUS was driven by a 3.0 kb endogenous IDD3 promoter were generated to confirm the patterns of expression of IDD3 in plants. GUS expression was obviously induced upon R. solani inoculation in the sheath (Figure 1(b)). In addition, the patterns of expression of IDD3 were analyzed in leaves, roots, sheath, shoot apices and flowers. The results indicated that IDD3 was detected in all the tissues, and the lowest level of expression was detected in flowers (Figure 1(c)).

Figure 1. Patterns of expression of IDD3 in rice

(a) Infection by R. solani mediated the patterns of expression of IDD3 and PBZ1, which were analyzed at 0, 24, 48, and 72 hours post inoculation. Ubiquitin was used as an internal control to normalize the level of expression. Different letters indicate significant differences at P < .05. (b) The levels of expression of IDD3 mediated by infection with R. solani were analyzed using transgenic plant sheaths in which GUS was expressed from an endogenous IDD3 promoter. (c) qRT-PCR was performed on the mRNA from roots and leaves of one-week-old plants, sheath and shoot apices from the one-month old plants and flowers of three-month-old plants. Ubiquitin was used as the loading control. The experiments were repeated at least three times.

IDD3 overexpressors exhibit an enlarged tiller angle and reduced resistance to ShB

To elucidate the function of IDD3 in the resistance of rice to ShB, two independent mutants were isolated from a T-DNA population using PCR and target-specific primers. The T-DNAs were inserted into the second intron of the IDD3 locus. RT-PCR showed a lack of IDD3 transcripts in the IDD3 mutants (idd3-1 and idd3-2) (Figure 2(a)). In parallel, IDD3 overexpressors (OXs) were generated. The levels of expression of IDD3 are significantly higher in OX lines than in the wild-type (Figure 2(b)). idd3 mutants did not exhibit any visible morphological differences, but IDD3 OXs displayed increased tiller angles compared with the wild-type plants, and the tiller angles corresponded with the levels of expression of IDD3 in OX lines (Figure 2(c)).

Figure 2. Phenotypic expression of IDD3 mutants and overexpression plants

(a) The diagram shows the genomic structure along with the T-DNA insertion site. Black and white boxes indicate exons and UTR regions, respectively. The triangle in the second intron indicates the T-DNA insertion sites in idd3 mutants (idd3-1 and idd3-2). The short horizontal arrows indicate the location of primers used in RT-PCR. Three-month-old idd3 mutants and wild-type controls were photographed. IDD3 transcripts from wild-type (WT) and two idd3 mutants were analyzed by RT-PCR. Actin was used as an internal control. (b) Three-month-old overexpression lines (OX1, OX2, OX5 and OX6) were aligned based on the degree of tiller angles. Northern blot analysis was employed to measure the levels of expression of IDD3 from individual OX lines using RNA from 2-week-old seedlings. EtBr staining of total RNA was shown as the loading control. (c) The measurement of tiller angles and numbers from indicated OX lines shown in A and B are shown in the diagrams. Data represent the mean ± SD of more than 10 plants from the lines analyzed. Different letters indicate significant differences at P < .05. (d) The response of IDD3 mutants (idd3-1 and idd3-2) and IDD3 overexpressors (OX5 and OX6) to R. solani AG1-IA compared with the wild-type (WT). (E) The percentage of sheath area covered with lesions in IDD3 mutants (idd3-1 and idd3-2), and IDD3 overexpressors (OX1 and OX2) compared with that of the WT. Data represent the means ± standard error (n > 10). Different letters indicate significant differences at P < .05.

The results of inoculation with R. solani showed that the idd3 mutants exhibited a response to ShB similar to that of the wild-type, while IDD3 OX exhibited enhanced susceptibility to infection with R. solani compared with the wild-type plants (Figure 2(d)). The percentage of the sheath area covered with lesions was 29.3% in WT, 30.3% in idd3-1, 29.5% in idd3-2, 39.2% in IDD3 OX #5 and 39.1% in IDD3 OX #6 plants (Figure 2(e)).

Overexpression of IDD3 resulted in an altered response to auxin

Since IDD3 OX lines exhibited an enlarged tiller angle, the 2.0 kb promoter of IDD3 was analyzed via the PLACE database. Interestingly, one AuRE (auxin-responsive element), four E-box (BR signal transcription factor RAVL1 binding motif), and two ABRE (ABA-responsive element) appeared within a 2.0 kb promoter (Figure 3(a)). In addition, phytohormone-mediated patterns of expression of IDD3 were examined in more detail. After treatment with 2,4-D (an auxin mimic), 2,4-epiBL (BR) and ABA, IDD3 was specifically induced by 2,4-D but not by 2,4-epiBL and ABA after 3 and 6 hours of accumulation (Figure 3(b)). Additionally, the levels of expression of the IAA3 and IDD3 genes were sensitive to auxin treatment in a time-dependent manner (Figure 3(c,d)).

Figure 3. Auxin-dependent levels of IDD3 and IDD3 overexpression phenotype

(a) The schematic shows the location of AuRE (auxin-responsive element), E-box (brassinosteroid signaling transcription factor RAVL1 binding motif) and ABRE (ABA-responsive element) within the 2.0 kb promoter of IDD3. (b) Hormonal regulation of IDD3 transcription. Seven-day-old seedlings were treated with 1 µM 2,4-D, 0.1 µM 2,4-epiBL (BR) or 1 µM ABA for 3 and 6 hr. qRT-PCR was performed to analyze the patterns of expression of IDD3 following hormone treatment. The levels of expression were normalized against that of Ubiquitin mRNA. Different letters indicate significant differences at P < .05. Auxin-dependent patterns of expression of IDD3 (c) and IAA3 (d) were analyzed following 0, 3, 6 and 12 hours of 1 µM 2,4-D treatment. Different letters indicate significant differences at P < .05. (e) Gravitropic response of 5-day-old wild-type, idd3 mutants and OX plants were performed up to 3 days after horizontal gravistimulation. (f) The angles of the shoot apices with respect to the horizontal were measured at each point during the time course. Data represent the mean ± SD of more than 15 plants from the lines analyzed. Different letters indicate significant differences at P < .05. (g) Five-day-old wild-type (WT) and two independent IDD3 OX lines (OX5 and OX6) germinated on 0.5x MS medium containing the concentrations indicated of NPA (a polar auxin transporter inhibitor), 2,4-D and NAA were photographed. The shoot length of each line grown on 0.5x MS medium containing NPA (h), 2,4-D (i) and NAA (j) were analyzed. Significant differences between wild-type and OX plants are shown. *P < .05.

Tiller angle changes have been explained as effects of gravitropism.⁵ Therefore, the shoot gravity responses between wild-type, idd3 mutants and IDD3 OX plants were compared. Five-day-old wild-type, idd3 mutants and IDD3 OX plants were gravistimulated by horizontal placement, and their responses to gravity were measured for up to 3 days (Figure 3(e)). The curvature of wild-type and idd3 mutants reached approximately 90° on day 3. However, IDD3 ox plants exhibited weak gravitropism compared with the wild-type and mutant plants, and the curvature reached approximately 60–70° after 5 days of gravistimulation (Figure 3(f)).

Auxin-dependent plant growth was analyzed in more detail using wild-type and IDD3 OX plants. 2,4-D, NAA and NPA were used to analyze the response of each line. The results showed that IDD3 OX seedlings exhibited a growth pattern similar to that of the wild-type plants. A high concentration of exogenously supplied NPA, 2,4-D and NAA inhibited the growth of shoots of wild-type plants, and two independent IDD3 OX lines (OX5 and OX6) exhibited a sensitive response to NPA, 2,4-D and NAA compared with the wild-type plants (Figure 3(g–j)).

IDD3 directly represses PIN1b

PIN-FORMED (PIN), IAA3 and Lazy1 are involved in auxin transport or auxin response, as well as in the control of tiller angle and gravitropism. TAC1 serves as a QTL locus control for tiller angles in rice.⁹ The expression of PIN1a, PIN1b, PIN2, IAA3, Lazy1 and TAC1 was compared in wild-type and IDD3 OX plants. Two-week-old wild-type and two independent OX plants (OX5 and OX6) were used for qRT-PCR assays. The levels of PIN1a and PIN1b are ~25% and ~75% lower, while those of PIN2 and IAA3 are ~70% higher in OX lines than in the wild-type plants (Figure 4(a)). However, no significant differences in the expression of Lazy1 and TAC1 were observed (Figure 4(a)). Analysis of the promoter sequence identified that one IDD-binding motif appeared within 1.5 kb of PIN1b promoter (Figure 4(b)). The results of this binding assay were confirmed using a yeast-one hybrid assay, which indicated that IDD3 can bind to the putative IDD-binding motif within the 1.5 kb PIN1b promoter (Figure 4(b)). The ChIP assay using 35S:IDD3:GFP transgenic plant calli showed that the precipitation of IDD3 enriched the P2 region, but not the P1 region, of the PIN1b promoter (Figure 4(c)). To verify if these cis-elements were responsible for the transcriptional activation of the PIN1b promoter via IDD3 in vivo, we performed a transactivation assay by transient expression in Arabidopsis thaliana protoplasts. The results suggested that IDD3 transrepresses the P2 promoter, but not the IDD-binding motif mutated promoter, mP2 (Figure 4(d)), indicating that IDD3 could repress the expression of PIN1b via promoter binding.

Figure 4. IDD3 directly regulates the expression of PIN1b.

(a) Total RNA was extracted from 2-week-old wild-type and two IDD3 overexpression lines (OX5 and OX6). The levels of expression of PIN1a, PIN1b, PIN2, IAA3, Lazy1 and TAC1 were monitored by qRT-PCR. The expression of each gene was normalized against that of Ubiquitin. Significant differences between wild-type and OX plants are shown. *P < .05. (b) A diagram of the 1.0 kb PIN1b promoter. The red oval indicates the putative IDD-binding motif. P1 and P2 indicate the regions detected in ChIP-PCR. A yeast one-hybrid assay was performed to analyze IDD3 activation of the 1.5 kb PIN1b promoter. Yeast cells harboring either AD-IDD3 or AD together with pPIN1b-LacZ were grown on SD media lacking Leu and Ura. The LacZ expression levels were examined using X-gal. (c) ChIP-PCR was performed to analyze the binding affinity of IDD3 to the P1 and P2 regions shown in B. Anti-GFP antibody was used for immunoprecipitation. The error bars are the mean ± SE (n = 3). (d) A transient expression assay was conducted by co-transfection with p35S:IDD3 and each of the vectors expressing the β-glucuronidase gene (GUS) under control of native (P2) and IDD-binding motif mutated (mP2) PIN1b promoters in protoplast cells. The luciferase gene driven by the 35S promoter was used as an internal control to normalize the expression of GUS. Error bars represent ± SE (n = 6). The experiments were repeated at least three times, and different letters indicate significant differences at P < .05.

PIN1b positively regulates the resistance of rice to ShB

RNAi plants were generated to analyze the function of PIN1b in defense of rice to sheath blight. qRT-PCR confirmed the levels of expression of PIN1b in wild-type and PIN1b RNAi lines (#1-#4). The results indicated that the level of expression of PIN1b was significantly lower in PIN1b RNAi lines than in the wild-type plants (Figure 5(a)). The results from inoculation with R. solani showed that the PIN1b RNAi lines were more susceptible to infection with R. solani than the wild-type plants (Figure 5(b)). The percentage of the sheath area covered with lesions was 30.8% in WT, 40.8% in PIN1b RNAi #1, 39.3% in PIN1b RNAi #2, 40.2% in PIN1b RNAi #3, and 38.7% in PIN1b RNAi #4 plants (Figure 5(c)).

Figure 5. The response of PIN1b RNAi plants to sheath blight

(a) qRT-PCR was performed to examine the levels of expression of PIN1b in wild-type (WT) and PIN1b RNAi lines (#1, #2, #3, and #4). The error bars are the mean ± SE (n = 3). Different letters indicate significant differences at P < .05. (b) The response of WT and PIN1b RNAi lines to R. solani AG1-IA were analyzed. (c) Percentage of the sheath area covered with lesions in WT and PIN1b RNAi lines were calculated. Data represent the means ± standard error (n > 10). Different letters indicate significant differences at P < .05.

Discussion

Sheath blight disease caused by R. solani is a major disease of rice and severely reduces grain yield. However, the resistance mechanisms of the host remain elusive. Previously, we elucidated that LPA1/IDD14 promoted the defense of rice against ShB via the activation of PIN1a,¹⁴ and interestingly, we identified the additional IDD member IDD3 that was significantly induced by R. solani infection, which was confirmed by qRT-PCR and an examination of the pattern of GUS expression in a transgenic plant. Inoculation with R. solani revealed that the two idd3 mutant lines did not differ significantly from the wild-type plants in their response to ShB. To further verify IDD3 function, IDD3 overexpressors were generated, and their response to ShB was analyzed to provide additional evidence. The results indicated that IDD3 overexpressors are more susceptible to ShB compared with wild-type plants. These results suggest that IDD3 negatively regulates rice defense to ShB.

Tiller angle is one of the traits that significantly contributes to plant architecture. A larger tiller angle results in lower humidity and can reduce the incidence of disease. However, it also consumes too much space and causes shading by reducing the time available to capture light. In contrast, erect plants increase photosynthesis and planting number, but they are more susceptible to insects and pathogens.⁶ Therefore, an exploration of the regulatory mechanism that underlies tiller development and disease resistance is important for rice breeding. The use, distribution and transport of auxin play an important role in the alteration of plant architecture.^33,34 PIN1a and PIN2 are members of the PIN-FORMED family of genes, and the suppression of PIN1a and overexpression of PIN2 lead to increased tiller angles in rice.^5,6 The IDD3 promoter contains AuRE, E-box and ABRE motifs, but the IDD3 transcript is only regulated by auxin. It is possible that IDD3 is one of the auxin signaling proteins that is involved in the developmental regulation of plants mediated by auxin. The overexpression of IDD3 in transgenic rice plants showed that IDD3 OX greatly increased tiller angles. Furthermore, the levels of expression of PIN1a and PIN1b were lower, while that of PIN2 was higher in IDD3 OX than in wild-type plants, implying that IDD3 OX may increase the tiller angle via regulation of the expression of PIN1a and PIN2. The overexpression of IDD3 increased the tiller angle, but idd3 knock-out mutants exhibited normal tiller growth. In A. thaliana, IDD14, 15 and 16 cooperatively regulate organ development and gravitropism by the direct regulation of TAA1, YUCCA5 and PIN1 genes,²⁰ which provided strong evidence that IDD proteins act as a complex on certain types of gene regulation. Further genetic studies are required to understand the role of IDDs in tiller development. The overexpression of IDD3 affects shoot gravitropism, which is a response similar to those of the LPA1/IDD14 mutants.²² Our study identified the role of IDD3 on the regulation of polar auxin transporters that control the tiller angle of rice and gravitropism, suggesting that IDD3 might control polar auxin transport to modulate plant architecture.

In addition, PIN1b was suppressed in IDD3 OX plants, and ChIP and yeast-one hybrid assays confirmed that IDD3 directly bound to the PIN1b promoter. The suppression of PIN1b also increased the susceptibility of rice plants to ShB. Recently, we also identified the function of IDD3 in directly repressing PIN1a to regulate resistance to ShB,³⁵ suggesting that IDD3 might function via the repression of both PIN1a and PIN1b to modulate resistance to ShB. The suppression of PIN1a and overexpression of PIN2 enlarged the tiller angle,^5,6 suggesting that IDD3 might control the expression of multiple PIN genes to regulate tiller angle development and the resistance of rice to ShB. In conclusion, our analyses indicated that IDD3 functions as a transcriptional repressor to regulate the expression of PIN genes to modulate auxin distribution, which significantly contributes to the modulation of resistance to ShB in rice.

Disclosure of Potential Conflicts of Interest

The authors declare no conflict of interest.

Additional information

Funding

This work was supported by the Support Program for Science and Technology Innovation Talents of Shenyang (RC190489), Natural Science Foundation of Liaoning Province (2020-YQ-05), and the Support Plan for Innovative Talents in Colleges and Universities of Liaoning Province (LR2017037).